Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Solubility
You are aware that gases are soluble in liquid. Solubility of a gas in a liquid depends on the partial pressure, temperature and presence of other solutes. Table shows the solubility of oxygen, carbon dioxide and nitrogen at different temperatures. You can see that solubility of carbon dioxide is much greater than oxygen and that as the temperature increases, solubility decreases.
Table: Solubility of gases in cm3 of gas per cm3 of water
Q. What are immunoglobulins? Immunoglobulin is the alternate name given to antibody and Immunoglobulins are complex proteins containing a variable portion and an invariable por
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What do you mean by hemodialysis? Hemodialysis is the artificial blood filtration made by specific machines in alternative of the kidneys. Hemodialysis may be necessary in p
What is the Procedure of Uristix 1. Collect the urine. 2. Remove one strip from bottle and replace cap. 3. Completely immerse reagent areas of the strip in urine and remo
The key enzymes of gluconeogenesis,include: a) Pyruvate carboxylase b) Phosphoenol pyruvate carboxykinase c) Fructose- 1,6-bisphosphatase, and d) Glucose-6-phosph
Predation is a process by which one organism (predator) eats another organism (prey). If the prey population is abundant, the predator population also becomes abundant. If the pred
Explain the technology in which transgenic plant was constructed in which seeds that will produce plants for a single crop.
Changes in the conformation of molecules - Qualitative Changes You may recall that linear chain of amino acids of a protein folds into a characteristic structure. Acidic resid
List the benefits of LSM. Life style modification helps in the following ways: - Reduction of weight - Good sugar control - Good blood pressure control - Reduction
Q. What is a population? In the Biology a population is a set of individuals of the same species living in a given place and in a given time.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd