Social determinants of health - unemployment, Biology

Assignment Help:

Social Determinants of Health - Unemployment

That unemployment gives rise to social insecurity and psychological stress is well recognised. Fears and uncertainties are known to cause anxiety related illnesses. As such, whatever be the path of development and governance chosen, the central objective should be the maximisation of employment opportunities in the economy. The views of proponents as well as the opponents of market reform policies relating to the issue of unemployment in the light of its effects on health therefore merit discussion.


Short term unemployment becomes inevitable when the state dominated industries or economies are liberalised and restructured. The proponents of increased government’s role for mitigating the ill-health effects of unemployment suggest that one way of increasing the employment opportunities is to adopt measures by the state for smoothening out the highs and lows of the business cycle. The opponents of increased government role however argue against this approach and cite experiments world over that have revealed that such an approach would have a stifling effect on economic output, employment prospects and human health.


Related Discussions:- Social determinants of health - unemployment

What are the types of proteins in metabolism of lens, What are the types of...

What are the types of proteins in metabolism of lens? Soluble Proteins Its synthesis takes place in the equatorial part on the surface of lens. a. Alpha crystallins

Equipment and supplies -pre-requisite of nursing unit, Equipment and Suppli...

Equipment and Supplies: Nurses who are aware of location of equipment and supplies do give accurate delivery of patient care without delay and wastage of  time and energy for

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine how nutrition used to prevent dehydration, Determine How Nutritio...

Determine How Nutrition used to Prevent Dehydration? Maintaining optimal hydration status along with sufficient muscle glycogen stores delays the onset of fatigue and enables

Tissue culture, Tissue Culture It is an important technique for maintai...

Tissue Culture It is an important technique for maintaining a'pm or piece of animal or plant tissue alive after their culture dishes. It is necessary to provide an environment

Glycogen degradation and glycogen synthesis , If glycogen degradation  and...

If glycogen degradation  and glycogen synthesis were allowed to occur concurrently,  the  net  effect  would  be  hydrolysis  of  UTP,  a  so-called  futile  cycle. To stop this, b

Surface Processes on Earth, Which of the following is not a type of mass mo...

Which of the following is not a type of mass movement that results from the force of gravity? A. Landslide B. Creep C. Deflation D. Mudflow

What is the karyotype found in down syndrome, What is the karyotype found i...

What is the karyotype found in Down syndrome? Down syndrome is an aneuploidy, i.e., a numeric changing of chromosomes within the cells compared to the normal number of chromoso

Valvular heart diseases, Valvular heart diseases :  Congenital and acquire...

Valvular heart diseases :  Congenital and acquired valvular heart diseases often require surgical intervention. 1 is well known that conservative surgery by valve repair gives bet

Explain fungi - nutritional types of microorganisms, Explain Fungi - Nutrit...

Explain Fungi - Nutritional Types of Microorganisms? Fungi are filamentous, eukaryotic microorganisms, ubiquitous in nature. These grow best in dark and moist habitats. Their h

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd