Slow moving waters - biota of rivers, Biology

Assignment Help:

Slow Moving Waters - Biota of Rivers

The habitat of a slowly moving part of the river is very different from the one just described. Here the water flow is comparatively slow and so current is less.

817_Slow Moving Waters.png

Figure: Slow Moving Waters Organisms

As a result the erosive power of the water is greatly reduced, resulting in the deposition of smaller sediments on the bottom, instead of being carried away by the stream.


Related Discussions:- Slow moving waters - biota of rivers

Rigid fixation to evaluate osseointegration, Q. Rigid fixation to evaluate ...

Q. Rigid fixation to evaluate osseointegration? Is a clinical term that means absence of observed mobility. Rigid fixation indicates the absence of clinical mobility of an impl

Can you define p-waves, Q. Can you define P-Waves? Changes in P-wave mo...

Q. Can you define P-Waves? Changes in P-wave morphology have been well described in resting tracings and are very useful in identifying right and left sided hemodynamic alterat

Explain common concerns during pregnancy, Explain Common Concerns during Pr...

Explain Common Concerns during Pregnancy? Many of the physiological changes that occur during pregnancy affect the digestive tract and may cause discomfort to the mother. Most

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Genetics, What is the term for the pattern of base pairing between one DNA ...

What is the term for the pattern of base pairing between one DNA strand and its partner in a duplex?

What are the elements that constitute the stomata, What are the elements th...

What are the elements that constitute the stomata? The Stomata is made of a central opening the ostiole or slit delimited by two guard cells responsible for its closing or open

Thalassemia, Thalassemia   Thalassemias are the commonest hemolytic ana...

Thalassemia   Thalassemias are the commonest hemolytic anaemias or disorder seen in children in India. This is characterised by deficiency  in the synthesis  of one of the norm

Number of chromosomes, NUMBER Benden and Boveri first indicated tha...

NUMBER Benden and Boveri first indicated that number of Chromosomes is definite in each organism. (1) Haploid (n) - One set of Chromosomes. i.e. one Chromosome of each

What is the typical localization of the tropical forests, What is the typic...

What is the typical localization of the tropical forests regarding latitude? Tropical rain forests, as the Amazon forest and the Congo forest, are typically located in low lati

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd