Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What are the main functions of the blood? The blood is a means of substance transportation all by the body. The blood distributes nutrients, oxygen, antibodies, hormones, and c
Q. What are the sources of dietary fibre in our diet? The sources of dietary fibre include whole grain cereals, legumes, whole pulses, leafy vegetables, vegetables like peas,
Explain about Riboflavin Aqueous solution shows a pronounced green-yellow fluorescence, which is maximal at a pH of about, 6-7 and disappears upon the addition of acids and al
Q. What are the euchromatin and heterochromatin? Chromatin is uncondensed nuclear the DNA the typical DNA morphology in interphase the phase of the cell cycle in which the cell
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Diagrams of organisms in phylum porifera
Q. Which is the kind of muscle tissue that contracts and relaxes the heart chambers? The myocardium of the heart is made of cardiac striated muscle tissue.
please i want detailed explanation on the mechanism of enzyme catalysis
LYSOSOMES Like mitochondrial lysosomes are also typical membrane bound and dense fluid filled sac like cytoplasmic organelles of all eukaryotic cells these however, diffe
Define Gastrointestinal tract - Excretion of Zinc in Humans? Majority of zinc is lost from the body in faeces. Endogenous zinc in the form of enzymes or metallo-proteins is sec
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd