Skeletal system - sternum, Biology

Assignment Help:

STERNUM -

It is long, naroow, flat vertical bone in the middle of the front wall of the chest. 15 cms long.

It is dagger shaped having manubrium body & xiphoid process.

FUNCTIONS -

1.         It forms protective thoracic basket. Helpful in respiration 

 

126_rib cage.png

782_man sternum.png           2047_rabbit sternum.png


Related Discussions:- Skeletal system - sternum

Metazoa, Metazoa In the two kingdom classification, the unicellular 'a...

Metazoa In the two kingdom classification, the unicellular 'animals' used to be clubbed together under a single phylum Protozoa that constituted sub-kingdom - Protozoa. The re

When aerobic cells carry out fermentation, Under which conditions do aerobi...

Under which conditions do aerobic cells carry out fermentation? Some cells that as a rule get energy from aerobic cellular respiration can carry out fermentation when oxygen is

Define carbohydrate metabolism of manganese, Define Carbohydrate Metabolism...

Define Carbohydrate Metabolism of manganese? Mn is required for carbohydrate metabolism. Enzymes pyruvate carboxylase and phosphoenol pyruvate carboxy kinase involved in glucon

Explain in detail about soil micromorphology, Explain in detail about soil ...

Explain in detail about soil micromorphology A good examination with optical aid reveals more detailed features which are helpful in understanding pedogenesis. This is known as

Predisposing factors and pathphysiology of meningitis, Predisposing Factors...

Predisposing Factors The patients with diabets mellitus, malignancies and those on immunosuppressive drugs have reduced resistance and are more susceptible to develop meningi

Morula in humans, Which one of the following statements about morula in hum...

Which one of the following statements about morula in humans is correct? 1. It has almost equal quantity of cytoplasm as an uncleaved zygote but much more DNA 2. It has far l

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Horizontal chart - organization chart, Horizontal Chart: Horizontal ch...

Horizontal Chart: Horizontal chart which read from left to right are occasionally used. The pyramid lies horizontally instead of standing in the vertical position. The line of

Explain the theory of law of minimum, Explain the theory of Law of Minimum ...

Explain the theory of Law of Minimum    This is one of the earliest hypotheses put forward by von Liebig on the relationship between the amount of plant  nutrient in the soil a

What are the haversian canals, What are the Haversian canals and the Volkma...

What are the Haversian canals and the Volkmann's canals of the bones? Is the osseous tissue vascularized? The Haversian canals are longitudinal canals show in the osseous tissu

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd