Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
STERNUM -
It is long, naroow, flat vertical bone in the middle of the front wall of the chest. 15 cms long.
It is dagger shaped having manubrium body & xiphoid process.
FUNCTIONS -
1. It forms protective thoracic basket. Helpful in respiration
Metazoa In the two kingdom classification, the unicellular 'animals' used to be clubbed together under a single phylum Protozoa that constituted sub-kingdom - Protozoa. The re
Under which conditions do aerobic cells carry out fermentation? Some cells that as a rule get energy from aerobic cellular respiration can carry out fermentation when oxygen is
Define Carbohydrate Metabolism of manganese? Mn is required for carbohydrate metabolism. Enzymes pyruvate carboxylase and phosphoenol pyruvate carboxy kinase involved in glucon
Explain in detail about soil micromorphology A good examination with optical aid reveals more detailed features which are helpful in understanding pedogenesis. This is known as
Predisposing Factors The patients with diabets mellitus, malignancies and those on immunosuppressive drugs have reduced resistance and are more susceptible to develop meningi
Which one of the following statements about morula in humans is correct? 1. It has almost equal quantity of cytoplasm as an uncleaved zygote but much more DNA 2. It has far l
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Horizontal Chart: Horizontal chart which read from left to right are occasionally used. The pyramid lies horizontally instead of standing in the vertical position. The line of
Explain the theory of Law of Minimum This is one of the earliest hypotheses put forward by von Liebig on the relationship between the amount of plant nutrient in the soil a
What are the Haversian canals and the Volkmann's canals of the bones? Is the osseous tissue vascularized? The Haversian canals are longitudinal canals show in the osseous tissu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd