Sinus venarum, Biology

Assignment Help:

The interior of the right atrium has a rough anterior part, the atrium proper and a smooth part called the sinus venarum. Also it has an appendage called the auricle. All the large veins open into the smooth part. The opening of the superior vena cava is situated in its upper and posterior part and that of inferior vena cava into its lower part, close to the interatrial septum. The opening of the inferior vena cava is bounded by a fold called the valve of the inferior vena cava. Just to the left of this is the opening of the coronary sinus.


Related Discussions:- Sinus venarum

Plasmodesmata, PLASMODESMATA Termed by Tangl & Strasburger. Cytop...

PLASMODESMATA Termed by Tangl & Strasburger. Cytoplasmic / Protoplasmic bridges between 2 adjacent cells. Desmotubules connects the E.R. of 2 cells. Plasmodesmata p

Define methods for estimation of iron and haemoglobin, Define Methods for E...

Define Methods for Estimation of Iron and Haemoglobin? In this section we shall study the procedure involved in estimation of iron in any sample first followed by a review on t

Define vegetable as a rich source of protein, Define Vegetable as a rich so...

Define Vegetable as a rich source of protein? Fresh vegetables are not considered to be a very good source of proteins. On fresh weight basis, the average protein content of so

Define the effect of breastfeeding on mother, Normal 0 false ...

Normal 0 false false false EN-IN X-NONE X-NONE

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is radioactivity , What is Radioactivity ? Radioactivity :  Som...

What is Radioactivity ? Radioactivity :  Some isotopes, called radioisotopes, have unstable nuclei that release high energy particles or radiant energy, or both. An example

Nutrition occurs in protozoans, Nutrition occurs in Protozoans All typ...

Nutrition occurs in Protozoans All types of nutrition occur in Protozoa. Some protozoans synthesize their own food from inorganic precursors (carbon dioxide, nitrates or ammon

Principle of echocardiography, Echocardiography Utilizes principle of ultra...

Echocardiography Utilizes principle of ultrasound for visualization of heart and great vessels. It uses sound in the frequency of 1-10 MHz. As the frequency of probe increase

Is osmolarity of the interstitial fluid increase or decrease, If the osmola...

If the osmolarity of plasma (inside a capillary) is 300 mOsM, the osmolarity of the tissue fluid (interstial fluid) is 400, and the membranes are permeable to water but not to salt

Integumentary system - nails, NAILS - Cover terminal segment of fing...

NAILS - Cover terminal segment of fingers & toes. Highly vascular dermis under lying the nail is called nail bed . It gives pinkish colour to nail. The small part

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd