Similarities between cardiac, skeletal and smooth muscles, Biology

Assignment Help:

SIMILARITIES BETWEEN CARDIAC AND SKELETAL MUSCLES -

  1. Both cardiac and skeletal muscles are made up of elongated fibres which have numerous myofibrils.
  2. The myofibrils of cardiac muscle have the same structure as those skeletal muscle and are made up of actin and myosin filaments.
  3. The cardiac and skeletal muscle fibres have dark and light bands.
  4. The connective tissue framework and the capillary network around cardiac muscle fibres are similar to those in skeletal muscle.

 

SIMILARITIES BETWEEN CARDIAC AND SMOOTH MUSCLES -

  1. Both cardiac and smooth muscles are uninucleate containing nucleus at the centre and are involuntary in function.

Related Discussions:- Similarities between cardiac, skeletal and smooth muscles

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the scientific means about cat and mouse, Toxoplasma cycles between...

Toxoplasma cycles between its rodent and feline hosts, living out different phases of its existence in each. What is the scientific means about the cat and mouse?

Conventional cabg on cardiopulmonary bypass, Conventional CABG on Cardiopul...

Conventional CABG on Cardiopulmonary Bypass   Chest is opened by midline incision and median sternotomy. Simultaneously saphenous vein or radial artery is harvested. 'T

Explain about the invert sugar, Explain about the Invert sugar? Invert ...

Explain about the Invert sugar? Invert sugar is sucrose, which can be hydrolysed to split the disaccharide into its component sugars, fructose and glucose. It is known as inver

How mathematics and statistics related to biology, How mathematics and stat...

How mathematics and statistics related to Biology? This report emphasizes the benefits that the fields of mathematics and statistics can bring to biology, but there are recipro

How mineral salts participate in enzymatic activity, Q. How mineral salts p...

Q. How mineral salts participate in enzymatic activity? Many mineral salts are cofactors of enzymes that are the substances without which enzymes do not work.

Explain what is genetic engineering, Explain brifly what is Genetic Enginee...

Explain brifly what is Genetic Engineering ? Genetic Engineering : Engineering techniques have been used in agriculture and horticulture for centuries. Certain plants or ani

Illustrate dilated cardiomyopathy, Q. Illustrate Dilated cardiomyopathy? ...

Q. Illustrate Dilated cardiomyopathy? It is a disease of unknown etiology, affecting myocardium. Its diagnosis is established by presence of left ventricular dilatation and sys

Ecosystem, what is the main excretory organ of a lizard

what is the main excretory organ of a lizard

What is the essential concepts of endosseous healing, Essential Concepts of...

Essential Concepts of Endosseous healing 1) Osteoblast is the prime bone matrix synthesizing cell. Like most secretory cells, osteoblasts are polarized cells, and the direction

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd