Significant for chromosomes, Biology

Assignment Help:

Q. Why is it significant for chromosomes to be condensed during mitosis and decondensed during interphase?

During mitosis the major problem to be solved is the correct separation of chromosome sets between daughter cells. If chromosomes were decondensed long tiny fibers of the DNA would be dispersed in cytoplasm after the karyotheca breaking and chromosomes could not be easily pulled and organized by the spindle fibers.

During interphase the function of chromosomes that is of DNA molecules, is the synthesis of the RNA and thus of proteins. For this task it is necessary for functional molecular regions to be decondensed these regions form the euchromatin. During interphase in addition DNA replication occurs as a preparatory step for cell division. In this procedure it is fundamental for the exposition of the DNA molecules to serve as templates to new DNA chains under production.


Related Discussions:- Significant for chromosomes

Epithelial tissue, EPITHELIA L TISSUE OR EPITHELIA Epithelium term coi...

EPITHELIA L TISSUE OR EPITHELIA Epithelium term coined by Ruysh, it was applied originally to thin skin covering the nipple. (G.epi = upon, thele = nipple) Epithelial tis

What is selective waste collection, Q. What is selective waste collection? ...

Q. What is selective waste collection? The Recyclable waste is waste that can be reprocessed and used again. The waste recycling depends on the separation of the recyclable res

Vertebrates, characterstics and classification of vertebrates

characterstics and classification of vertebrates

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine the importance of calcium in soils, Determine the importance of C...

Determine the importance of Calcium in soils Calcium in soils is usually abundant except in acid soils, which occur in humid areas due to excessive leaching. Deficiency of calc

Stages of research process, Stages of Research Process: Planning Stage...

Stages of Research Process: Planning Stage The planning stage of research process  includes a  series of  interdependent steps consisting of 1)  conceptualizatioq of  the r

Nutition in animals, describe each and every step in nutrition in animals?

describe each and every step in nutrition in animals?

Simple febrile convulsions, Simple Febrile Convulsions These are convu...

Simple Febrile Convulsions These are convulsions associated with fever and infection, and is commonest causes of seizures during infancy and early childhood. These convulsio

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd