Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Why is it significant for chromosomes to be condensed during mitosis and decondensed during interphase?
During mitosis the major problem to be solved is the correct separation of chromosome sets between daughter cells. If chromosomes were decondensed long tiny fibers of the DNA would be dispersed in cytoplasm after the karyotheca breaking and chromosomes could not be easily pulled and organized by the spindle fibers.
During interphase the function of chromosomes that is of DNA molecules, is the synthesis of the RNA and thus of proteins. For this task it is necessary for functional molecular regions to be decondensed these regions form the euchromatin. During interphase in addition DNA replication occurs as a preparatory step for cell division. In this procedure it is fundamental for the exposition of the DNA molecules to serve as templates to new DNA chains under production.
EPITHELIA L TISSUE OR EPITHELIA Epithelium term coined by Ruysh, it was applied originally to thin skin covering the nipple. (G.epi = upon, thele = nipple) Epithelial tis
Q. What is selective waste collection? The Recyclable waste is waste that can be reprocessed and used again. The waste recycling depends on the separation of the recyclable res
characterstics and classification of vertebrates
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What structure does the sheath replace in a dicot?
Determine the importance of Calcium in soils Calcium in soils is usually abundant except in acid soils, which occur in humid areas due to excessive leaching. Deficiency of calc
what are viruses
Stages of Research Process: Planning Stage The planning stage of research process includes a series of interdependent steps consisting of 1) conceptualizatioq of the r
describe each and every step in nutrition in animals?
Simple Febrile Convulsions These are convulsions associated with fever and infection, and is commonest causes of seizures during infancy and early childhood. These convulsio
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd