Show the peptide found in the brain, Biology

Assignment Help:

Q. Show the Peptide found in the brain?

There are as many as 300 peptide neurotransmitters found in the brain. Peptide is a short protein consisting of fewer than 100 amino acids. Examples of peptides are somatostatin, neuropeptide Y, galanin, substance P, neurotensin, vasopressin adenosine etc.


Related Discussions:- Show the peptide found in the brain

Differentiation of tissues - root apex, Differentiation of Tissues - Root A...

Differentiation of Tissues - Root Apex New cells generated from the divisions of meristematic cells start expanding and differentiating further. Epidermis, cortex and stele a

Skin., what are the main functions of basal (Malpighian)layer?

what are the main functions of basal (Malpighian)layer?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Overturn - thermal stratification, Overturn - Thermal stratification T...

Overturn - Thermal stratification The summer or winter stratification is seasonal. Circulation of lake water occurs twice a year, in the spring and autumn (fall) seasons by a

Explain infants and preschool children, Explain Infants and Preschool Child...

Explain Infants and Preschool Children Growth? In this unit we will be studying about one of the crucial phases of human growth and development i.e. infancy to preschool years.

Cellular morphology, Speculate on the necessity of interdependence of volvo...

Speculate on the necessity of interdependence of volvox organisms in the colonial existence

Explain the procedure of taking blood pressure, Explain the Procedure of Ta...

Explain the Procedure of Taking Blood Pressure - Explain the procedure to the patient. In case patient is coming for first time to check the blood pressure explain to the patie

Excreation, What is the excreatory organ in agama lizard

What is the excreatory organ in agama lizard

Divergence - mechanism of gastrulation, DIVERGENC E - In it blastom...

DIVERGENC E - In it blastomeres move in different directions i.e. inside the blastocoel the blastomeres move in different directions. The blastomeres which move inside i

Involution - internalization of mesoderm, Involution - Internalization of M...

Involution - Internalization of Mesoderm As by now mentioned, in the frog Xenopus (and probably in other amphibian species as well) the cells of presumptive mesoderm are in t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd