Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Hormonal control by insulin, Insulin  is  released  into  the  bloodstream ...

Insulin  is  released  into  the  bloodstream by  the  β  cells  of  the  pancreas  when blood glucose stages are high after feeding and stimulates glycogen synthesis to kept exces

Open pulmonary valvotonzy, Open Pulmonary Valvotonzy, I nfundibular Rese...

Open Pulmonary Valvotonzy, I nfundibular Resection and Trans Annular Patch :  The pulmonary annulus may be narrow based on pre-operative investigations and on measurement

Anomalies related to oral cavity, Anomalies Related to Oral Cavity   Un...

Anomalies Related to Oral Cavity   Under these anomalies we will briefly discuss the cleft lip and cleft palate.  You must have seen and/or nursed a baby born with a cut on

Define recommended dietary allowance for riboflavin (rda), Define Recommend...

Define Recommended Dietary Allowance for riboflavin (RDA)? Several nutritional and physiological factors govern riboflavin requirements. Negative nitrogen balance reduces rib

Lysosomes, LYSOSOMES Like mitochondrial lysosomes are also  typical mem...

LYSOSOMES Like mitochondrial lysosomes are also  typical membrane bound and dense  fluid filled sac  like cytoplasmic  organelles  of all eukaryotic cells these  however, diffe

Reproductive disorders, Reproductive health disorders to dairy livestock ac...

Reproductive health disorders to dairy livestock accounts to a loss of about Rs 30,000- 50,000 crore annually to the nation. Better herd management can minimize the occurrence of d

How sugar play a major role in preservation, How sugar play a major role in...

How sugar play a major role in preservation? In so many products, sugars play a major role in preservation. The addition of monosaccharides, like glucose or fructose, to jams a

Define glycogen , A glycogen molecule having entirely of glucose uni...

A glycogen molecule having entirely of glucose units, many of that are linked in long chains through α1-4 bonds.  Furthermore,  every  10  units  or  so,  the  chain  is branched

Explain the superficial minor burns, Explain the Superficial Minor Burns? ...

Explain the Superficial Minor Burns? Superficial minor bums are immersed immediately in cool water if possible. The burn is carefully cleaned to prevent infection. If dirt is d

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd