Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Fast Response - Biological Responses Some of the fast responses are discussed below: It was found that when mung bean root tips were kept in a specific solution (contain
Food Which can be Taken in Plenty and Food to be Avoided Lastly, in the context of changing the diet, we should know the foods to be avoided and the food to be taken in plenty
The initial evaluation of new onset heart failure should include an electrocardiogram, chest radiograph, and B-type natriuretic peptide assay. The cardiac rhythm may be normal sinu
Conservative Substitution: The nucleotide mutation that alters the amino acid sequence of protein, but which causes substitution of one amino acid with another which has a side ch
Types of leaves Collect leaves from such plants as lilies, bamboo, corn, willow and geraniums. View that the monocots (lily, bamboo, corn, sugar cane) have the veins running pa
How are the proteins important in metabolism of lens? Proteins Physical slate of protein is important for transparency of lens. Morner first time classified protein of l
Consider an axon of a neuron. At time=t1, its voltage is at threshold for an action potential; at time=t2, its voltage is at 0 millivolts prior to the peak of that action potential
Define the Energy Cost of Growth? The energy cost of growth has two components: 1) The energy needed to synthesize growing tissues; and 2) The energy deposited in these tis
Define in brief about the term - MRI MRI is a more recent development that was initially introduced as a rival to CT. The technique itself is complex, relying on measurement o
TB in pregnancy Treatment of TB should be initiated in pregnancy when there is moderate to high suspicion of disease because active infection during pregnancy poses a risk to t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd