Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Leaf, Which one of the following is an example of a tree having simple leaf...

Which one of the following is an example of a tree having simple leaf ? 1. Neem 2. Rose 3. Mimosa pudica 4, Peepal.

Define maternal nutrition and foetal outcome, Define Maternal Nutrition and...

Define Maternal Nutrition and Foetal Outcome? Maternal malnutrition has deleterious effects on both the mother and the offspring.  Inadequate energy intakes, iron deficiency an

Genetic defect in pyruvate dehydrogenase, Genetic Defect in Pyruvate Dehydr...

Genetic Defect in Pyruvate Dehydrogenase A defed in any of  the protein subunits of PDH can result in decrease or complete loss of  activity. Severe cases are usually fatal. Sy

What is coronary disease, Q. What is coronary disease? The Coronary dis...

Q. What is coronary disease? The Coronary disease, or the coronary insufficiency, is a disease in which there is total or partial obstruction of one or more of the arteries tha

Explain founder effect, Founder effect The difference in gene pools amongs...

Founder effect The difference in gene pools amongs an original population and a new population founded by one or a few individuals randomly separated from the original population,

In which parts of the circulatory system are there valves, In which parts o...

In which parts of the circulatory system are there valves? There are valves in the heart (between each atrium and ventricle, in the aorta and pulmonary artery), in some of the

Viral diseases - avian encephalomyelitis, V i ra l Diseases A v ...

V i ra l Diseases A v ian encephalomyelitis This is enterovirus disease of chicken, pheasants, turkeys and Japanese quails caused by the member of the family Pi

Viral genome, describe the different types of genomes that viruses can have...

describe the different types of genomes that viruses can have

What is polymerase chain reactionin genetics, What is Polymerase Chain Reac...

What is Polymerase Chain Reactionin genetics? A great advance in sequencing and cloning DNA is the polymerase chain reaction, devised by the American biochemist Kary Mullis in

Explain phylogenetically proximal species, Q. Do the phylogenetically proxi...

Q. Do the phylogenetically proximal species have cells with proximal chromosome counts? The number of chromosomes typical of each species is proximal for phylogenetically proxi

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd