Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Caution for the use of Pipettes - Food Microbiology? (1) Never do pipetting with mouth. (2) For culturing, sterilized pipettes should be used. (3) Never keep pipettes on
Explain the Human Milk Composition and Infant Growth and Development? This sub-section deals with composition of human milk, compares human milk with cow's milk and why human m
Q. Show the Communication process steps? Planning - Set goals. - Make a plan with alternatives. - Allow the counsellee to select a alternative which is feasible.
ARM BONES - Each arm contain 30 bones as : humerus in upper arm, radius ulna in forearm, 8 carples in wrist, 5 metacorples in plam, 14 phalnges in fingers. HUMERU
HACCP Control Point HACCP Control Point : Any step at which biological, chemical or physical factors can be controlled.
Explain the energy flow of ecology? Energy flow: As you can see, energy flow is one way in an ecosystem. Energy is not recycled. The ultimate source of energy that powers eco
How are the three main arthropod classes characterized according to the body division? In crustaceans and arachnids the head is fused with the thorax forming the cephalothorax.
Class of Crustacea - Branchiura Branchiura involves only around 130 species of ectoparasitic crustaceans living mostly on the integument and gill cavities of freshwater and ma
Structural isomers: Select one: a. Have the same molecular weight b. Have the same connectivity c. Are mirror images d. All of the above e. None of the above
Phylum Rhodophyta (Red algae) 1) The photosynthetic pigments include red pigments (phycoerythrin) and blue pigment (phycocyanin) apart from chlorophyll, of which red pigment pr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd