Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

First type of rheological model, Q. First type of rheological model? Th...

Q. First type of rheological model? This method establishes relation between the pressure gradient and the volume rate of flow. Here, the piston measurement is used to measure

Paratyphoid and other salmonella infections, P a r a typhoid and other ...

P a r a typhoid and other Salmonella infections Paratyphoid salmonellae are non-host-specific. The commonly reported species are S. Typhimurium, S . Enteritidis S . T

Mammalian heart, Mammalian Heart The division of heart and separation ...

Mammalian Heart The division of heart and separation of systemic and pulmonary circulation is complete in birds and mammals. The structure of mammalian heart and also how the

What is st elevation in leads without q-wave, Q. What is ST Elevation in Le...

Q. What is ST Elevation in Leads without Q-Wave? ST elevation in leads without Q-waves can occur in few very different situations, both of which are fairly uncommon. The first

What are the responsibilities of cber, Question 1: Explain how drug app...

Question 1: Explain how drug approval is obtained through various Regulatory Bodies in India using a flow diagram? List out the different regulatory bodies in India L

Biodiversity, composition of aquatic animals what are their groupings

composition of aquatic animals what are their groupings

Which is responsible for the positive/negative part of blood, This problem ...

This problem refers to the MN and ABO loci mentioned in class. It also refers to the Rh locus, which is responsible for the positive/negative part of the blood type. The Rh+ allele

Explain the term antioxidants, Normal 0 false false false ...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd