Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
N e c r otic enteritis It can be designated as enterotoxaemia of chickens, turkeys and ducks caused by Clostridium perfringens. The toxin released by this spore-bearing a
Q. What is the difference between spermatid and spermatocyte II? The spermatids (n) are the products of the second division of meiosis (meiosis II) in the male gametogenesis an
Q What are the two major classes into which fishes are divided? Ans. Fishes are divided into two major classes: osteichthyes, bony fishes (tuna, sardines, salmons) , and chondr
explain industrial melanism and genetic repatterning during isolation with example
What is the importance of water for enzymatic activity? Enzymes, biological catalysts, rely on water to reach their substrates and bind to them. There is no enzymatic activity
Important Modern viral diseases By extensive use of vaccination and chemotherapy. Certain serious viral diseases of the past. Like smallpox. Have been completely or largely e
Explain about Phytopinax written by Caspar Bauhin? A significant contribution to taxonomy was made at this time by Caspar Bauhin. His 'Phytopinax' (1596) described 2700 species
wHAT IS 10um?
What is the Mode of Nutrition in mosquito?
Cryptophytes - Classes of Life Form Perennating buds or shoot apices are buried in the ground at a distance from the soil surface that varies in different species. The buds ar
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd