Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Explain about Food Exchange System? In a diabetic's day to day diet, the calorie intake and the quantity of food consumed should not have wide fluctuations. Also the diet sh
Question 1 Write a short note on the following- Fermenter Batch culture Viral pesticides Brewing Question 2 Define sterilization. Discuss different ty
Define Distribution of Food Products - Public Nutrition? We learnt earlier that we have buffer stocks of food grains in our country. These stocks do help to combat acute transi
claasification of phylum porifera
Define Resolution - terminologies used in chromatography? Resolution is the effectiveness of the separation and is determined by two factors. These include: Distance
Rejection Reaction For rejection reaction the physiological and biochemical processes are set in the pistil by the recognition reaction specific to the type of pollen that lan
Clinical Manifestations Early Symptoms Symptoms are episodic in nature or continuous with very little response to bronchodialators. Productive cough especially on awake
a) Name two food additives needed to keep food wholesome, and say what they do. b) Name two food additives (or types of additive) which are not necessary for keeping fo
Define the Ascorbic Acid - Basic Concepts? Ascorbic acid is a water-soluble vitamin, whose structure is shown in Figure. You would have noticed that its structure resembles glu
Hydrochory - Dispersal of Seeds Plants that grow in or along the bank of water bodies often utilize water as an agency for dissemination of fruits and seeds. Coconut, Cocos nu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd