Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What are alleles of a gene, What are alleles of a gene? Diploid individ...

What are alleles of a gene? Diploid individuals have paired chromosomes. For instance in humans there are 23 pairs of chromosomes totalling 46 chromosomes. Each pair comprehend

Whta is restrictions enzymes, A restriction enzyme or restriction endonucle...

A restriction enzyme or restriction endonuclease is an enzyme which cuts DNA at particular recognition nucleotide sequences with Type II restriction enzymes cutting double-stranded

Classification of enzymes, Classification of Enzymes : Enzymes are clas...

Classification of Enzymes : Enzymes are classified  into the following six main categories in according with  the nature of reaction the catalyze: 1.      Oxidoreductases

Biochemistry, help me in writing assignment on racemization,mutarotation.

help me in writing assignment on racemization,mutarotation.

What is fern allies - equisetum, What is Fern Allies - Equisetum ? The ...

What is Fern Allies - Equisetum ? The earliest land plants are thought to have evolved from green algal ancestors, since they share many features. Both green algae and plants h

How is oil droplet different from micelles, How is oil droplet different fr...

How is oil droplet different from micelles? Also describe the chemical make-up of each.

Discovery of insulin, Q. Discovery of insulin? The discovery of insulin...

Q. Discovery of insulin? The discovery of insulin has dramatically changed the lives of people having type 1 diabetes. With this wonder drug diabetics can lead a normal, enjoya

Spermatogenesis, What are the phases of spermatogenesis and how it occurs ?...

What are the phases of spermatogenesis and how it occurs ?

Explain viruses and their classification, Explain Viruses and their classif...

Explain Viruses and their classification? Viruses are living organisms. Viruses are not living organisms. No, the above is not a misprint! In fact, viruses defy the normal c

Isospora, ciclo vital de la isospora belli

ciclo vital de la isospora belli

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd