Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain adverse effects of oseltamivir, Explain Adverse Effects of Oseltami...

Explain Adverse Effects of Oseltamivir  Nausea and vomiting can occur. Taking the drug with food decreases the incidence of nausea. In juvenile rats, very high doses of osel

# FUNGAL NUTRITION, Write on spoilage of food products by fungi,nutrition,c...

Write on spoilage of food products by fungi,nutrition,condition for growth,consequencies and prevention.

Nutrient and storage protein -biological function of protein, Define Nutrie...

Define Nutrient and Storage protein - biological function of protein? These proteins store amino acids. Ovalbumin is the protein of egg white, employed as an amino acid source

Explain the sinus perforations, Sinus Perforations  The maxillary antru...

Sinus Perforations  The maxillary antrum can sometimes be inadvertently penetrated. Through careful pre-operative planning using radiographs, including axial scans, this compli

Structure of golgi body, STRUCTURE Golgi body consists of :- (1 ) ...

STRUCTURE Golgi body consists of :- (1 ) Cisternae These are plate like unbranched structure with dilated ends. One golgi body has 4-8 cisternae. Mono cisternal

Differences of transposable elements in e. coli, Discuss the similarities a...

Discuss the similarities and differences of transposable elements in E. coli, yeast, plants, and Drosophila.

How to investigate aortic stenosis by cardiaccatheterization, Q. How to inv...

Q. How to investigate aortic stenosis by Cardiac Catheterization? The indications are to confirm hemodynamics when the non-invasive tests are not conclusive or there is a disc

Explain about the artificial sweeteners, Explain about the Artificial Sweet...

Explain about the Artificial Sweeteners? As a group, artificial sweeteners are classed as "non-nutritive". Thus, they provide sweet sensation to the tastebuds, with no increasi

Define classification of foods based on ph, Define Classification of foods ...

Define Classification of foods based on pH? Of these, the nature of the food, primarily the pH of food, is the most significant determinant of how severely the food will be pro

Explain the process of degradation of proteins, Q. Explain the process of D...

Q. Explain the process of Degradation of Proteins? Proteins are composed of amino acids combined by peptide linkages. The native proteins are resistant to attack by microo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd