Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain temperate deciduous forests-taiga and tundra, Explain Temperate Dec...

Explain Temperate Deciduous Forests-Taiga and tundra? Temperate deciduous forests are typified by the type of forests predominantly found in the eastern and northeastern Unit

Lymphatic drainage of the heart, The heart is drained by vessels that trave...

The heart is drained by vessels that travel in the interventricular and atrioventricular grooves. One set runs in the anterior part of the atrio-ventricular groove. The vessels of

Define fermented baked preparations, Normal 0 false false f...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

State the term - halsted reitan varies, State the term - Halsted Reitan var...

State the term - Halsted Reitan varies with the particular test Scoring for the Halsted Reitan varies with the particular test, such that individual scores may be expressed in

What is machined implant, What is Machined implant Machined implant ha...

What is Machined implant Machined implant has irregular surface roughness from approximately 10μm grooves and ridges in the machining direction. The roughness of implants can

Body fluids, why lymph is called the middel man of the body

why lymph is called the middel man of the body

Explain quantitative methods - therapeutic diets, Quantitative Methods - Th...

Quantitative Methods - Therapeutic diets Quantitative Methods: These are often essential for constructing  Lherapeutic diets.  The  two ways by which  this could be done are as

What is large intestine in human biology, What is Large Intestine in human ...

What is Large Intestine in human biology? Food undigested in the small intestine is passed on by peristalsis into the large intestine, or colon. The intestine is composed of ci

What is pressure support ventilation, What is Pressure Support Ventilation ...

What is Pressure Support Ventilation (PSV)? In a spontaneously breathing patient, each breath may be augmented with a preset level of pressure. The extent of support depends o

02, what is the effect of insuline in body ?

what is the effect of insuline in body ?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd