Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Types of Embryogeny On the basis of the plane of division of the zygote and of the cells of the 2-celled proembryo, and also taking into account the relative contributions of
What are the uses of microorganisms
Sinus Perforations The maxillary antrum can sometimes be inadvertently penetrated. Through careful pre-operative planning using radiographs, including axial scans, this compli
Why Vegetable and Fruit are important for human body? The vegetables and fruits add colour and variety to our diets in addition to providing a host of essential nutrients and p
Diploidy and Haploidy :: In the chromosomal complement given species not all the chromosomes are different from each other .In fact these are in pairs ,i.e. every two chrom
Q. Enumerate the anatomic consequences of edentulism? The anatomic consequences of edentulism include the effect of edentulism on bone and soft tissues. Basal bone forms the de
Stratification On the basis of the variation in air temperature. the atmosphere has been divided vertically into four layers: (figure shown below) thee troposphere, stratospG,
Which of the following best explains the reason why DNA ligase is needed to complete the replication of internal chromosomal segments? A. DNA ligase is able to delete the last
Explain Deformaties of the Cliest wall should be Noted a) Pectus carinatum (pigeon chest): may be associated with Marfan syndrome. b) Pectus excavatum: commonly seen in Marfan
Q. Explain the types of classification of plants? It is practically impossible for anyone to study all the plants of the world, 'even if one spends whole life. Thus, it is nece
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd