Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
A n a e r o b i c lagoon system This specific system of liquid manure handling is restricted to organized dairy farms, where the flushed manure is directed into an anae
Pediculosis and scabies Phthirus pubis (pubic lice), which can be found on eyelashes, back, axillary and leg hairs as well as pubic areas, and Sarcoptes scabiei infestation (s
Define Maternal Nutrition and Foetal Outcome? Maternal malnutrition has deleterious effects on both the mother and the offspring. Inadequate energy intakes, iron deficiency an
Determine the different types of sensory receptors There are different types of sensory receptors as follows: Visual receptors in the eyes for vision. Auditory receptor
EGG S OF INSECT This eggs is centrolecithal and it is elliptical. It diameter is 2-3 mm. It has two eggs membrane i.e. vitelline membrane and chitinous capsule. The chit
What colors of light are needed in a grow light for strawberry development?
Is it possible for a hermaphrodite species to present cross-fecundation? There are hermaphrodite species of animals and plants that present cross-fecundation mainly because of
What is Stem cell therapy Most defects / diseases treated by stem cell therapy are not genetic in origin so the therapy will have no impact on gene pool in terms of change in f
Q. What are the four major groups into which the study of the plants is divided? In Botany the plant kingdom is divided into pteridophytes, bryophytes, angiosperms and gymnospe
Give an example of how a functional group can affect the elements of an organic compound. The hydroxyl group on alcohols is polar and this produces alcohols polar compounds.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd