Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Reparative Regeneration This type of regeneration, as the name suggests, involves repair of a wound or replacement of a body part removed intentionally or because of injury.
Water Absorption and Transpiration The rate of water absorption is controlled by the rate of transpiration. A high water potential in the atmosphere would reduce water loss fr
In the time of Darwin the results of Mendel's research on biological inheritance had not been published, Genetics was not yet developed, neither DNA nor the concept of genetic muta
6
Oligochaetes - Feeding and Digestion in Annelids In between annelids, the oligochaetes which comprise mostly earthworms, feed on dead, decomposing organic vegetation. They as
In Drosophila, these genes occur on chromosome 4. H - wild type (normal) h - hairy F - wild type f - frizzled E - wild type e - vest
What is Crystal twinning Crystal twinning happens when two separate crystals share some of the similar crystal lattice points in a symmetrical manner. The result is an intergro
Complications : IABP can compromise blood flow to the leg at the time of insertion, pumping or after removal of balloon. It may also cause perforation, bleeding, thrombosis, embol
FORM S OF RIBOSOMES (1 ) Bound form - Attached to ER. Protein synthesis for secretion purpose occurs on bound ribosomes. (2 ) Free Ribosomes - Occur freely
Which type of cell came first in evolution - the eukaryotic cell or the prokaryotic cell? This is an interesting problem of biological evolution. The most accepted hypothesis a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd