Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What do you mean by insect control, Q. What do you mean by Insect control? ...

Q. What do you mean by Insect control? The insects can breed and hide in garbage and other places where there is availability of waste materials. The cockroach lives and breed

What are the sources of vitamin k, What are the Sources of Vitamin K? A...

What are the Sources of Vitamin K? As mentioned above, in plants, the only important molecular 'form of vitamin K is phylloquinone. Phylloquinone is distributed ubiquitously th

Carbon paper leaf prints, Carbon paper leaf prints Cover the vein side ...

Carbon paper leaf prints Cover the vein side of a leaf with a very thin layer of lard or vaseline. Place the greased leaf vein side up on various layers of newspaper and cover

Autoradiography, Autoradiography is the process to detect radioactively la...

Autoradiography is the process to detect radioactively labeled molecules (which commonly have been separated in an SDS-PAGE or agarose gel) based on their ability to develop an im

What is osmotic pressure, Q. What is Osmotic Pressure? Ans. Import...

Q. What is Osmotic Pressure? Ans. Important characteristic of a cell is 'osmosis'. You would recall reading about osmosis in the Applied Physiology Course in Unit 8. I

Concepts and definitions in relation to nutrient requirement, Concepts and ...

Concepts and Definitions in Relation to Nutrient Requirements 1) The probability concept describes the relationship between the levels of intake and the probability of risk of

What is the spontaneous generation hypothesis, What is the spontaneous gene...

What is the spontaneous generation hypothesis? The impulsive generation abiogenesis or hypothesys asserts that life on earth has come from nonliving material. For instance, t

Eye - conjuctiva, CONJUNCTI V A - Ectodermal in origin. Formed by epi...

CONJUNCTI V A - Ectodermal in origin. Formed by epidermis. It is thin, transparent covers cornea. Made up of stratified epithelium. It has 2 parts - (i) Ocular conjunct

Low protein products, Foods with moderate amounts of protein can be eaten i...

Foods with moderate amounts of protein can be eaten in limited amounts. These foods include grains, bread, pasta, rice, potatoes, corn, and peas. Foods with little or no protein ar

Leukaemia, Leukaemia Leukaemia is a malignant disease of blood forming...

Leukaemia Leukaemia is a malignant disease of blood forming organs of the body  that results  in uncontroled  growth of  immature white blood cells. The leukaemic process in t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd