Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Describe in detail about the Psychological Testing Psychological testing is the third source of information about the child, and the source most often equated with neuropsychol
Growth Phase -Stages in spermatogenesis Growth phase is characterized by the acquisition of the structural and functional characteristics of distinct sex cells. Also here is a
What is the significance of Axial skeleton? The bones which make up skeleton of the main body axis of vertebrates. It comprise the cranium, vertebral column, and rib cages, How
what cell organelle does photosynthesis take place in?
Explain the term - Muscle Contraction Headache This is one of the most common headaches. It is also known as tension or nervous headaches. They result from sustained contractio
What is the genetic condition in which the heterozygous individual has different phenotype from the homozygous individual? This situation is called lack of dominance and it can
Q. How do cells of neoplastic tumors obtain oxygen and nutrients and release wastes? In the neoplastic tumors a phenomenon called as angiogenesis occurs. The Angiogenesis is th
Besides the liver which is the other adnexal gland of the digestive system that releases substances in the duodenum participating in extracellular digestion? The other adnexal
Which of the following is a true statement regarding the process of RNA editing? A. RNA editing changes the sequence of the mRNA message thereby permitting for enhance in prote
A diploid cell contains four pairs of homologous chromosomes designated C1 and C2, M1 and M2, S1 and S2, and W1 and W2. Predict the number of different haploid cells that could be
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd