Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define most probable number (mpn) method, Define Most Probable Number (MPN)...

Define Most Probable Number (MPN) Method? The MPN method is like agar shake tube method where no agar is used. The dilutions of the microbial suspension are made in liquid medi

Endocrine glands, Endocrine glands Endocrine glands have no ducts - ...

Endocrine glands Endocrine glands have no ducts - so these are also called as ductless glands Eg.Pituitary etc., These glands secrete chemical substances called HORMONES

Effects of insulin on carbohydrate metabolism, Insulin promotes muscle gluc...

Insulin promotes muscle glucose uptake and metabolism. In presence of insulin muscle cells take up glucose and use it as a source of energy. Insulin also promotes storage of insuli

Aceolomates, what are phylums included in aceolomates?

what are phylums included in aceolomates?

Phase (different interference) contrast microscopy, Phase (different interf...

Phase (different interference) Contrast microscopy: Living cells are mostly   transparent. For viewing under ordinary light microscope, therefore, live cells must be stained wi

What is pancreas , What is Pancreas ? The pancreas lies in the abdomina...

What is Pancreas ? The pancreas lies in the abdominal cavity in a loop between the stomach and small intestine. The pancreas consists of two major types of cells: those produci

What is predatism, What is predatism? Predatism is the ecological inte...

What is predatism? Predatism is the ecological interaction in which one individual mutilates or kills another to get food. Predatism is an inharmonious (negative) ecological i

Invertebrate, classification of invertebrate

classification of invertebrate

Define absorption, Define Absorption, Storage and Elimination of Riboflavin...

Define Absorption, Storage and Elimination of Riboflavin? Riboflavin is absorbed from the small intestine through the portal vein and is passed to all tissues via general circu

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd