Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. How different is the simple cuboidal epithelium from the columnar epithelium? Where can these epithelia are found in the human body? The simple cuboidal epithelium is made o
Silver point: - Uses of silver point: ease of handing and placement, ductility, radiopacity,and have some antibacterial activity. - Lack of acceptable 3D seal of the ca
CELL SURFACE JUNCTIONS (1 ) Desmosomes (Maculae adherence) - Thickened circular areas on P.M. of adjacent cells with radiating fibrils in cytoplasm. These fibrils calle
Q. What is mutualism? The Mutualism is the ecological interaction in which both participants advantage and that is obligatory for their survival. The Mutualism is a harmonio
Passage of Pollen Tube In cotton, the pollen produces a tube within an hour which grows on the surface of the stigmatic hairs, and then between the cells of the stigma at the
what factor''s do i colour depend on?
What would happen to a cell if it was placed into a hypertonic solution? Into a hypotonic solution? What would happen to a cell if the cell itself was hypertonic to the solution?
Explain the Inoculating Loops and Needles? These are most commonly used tools for inoculation. The inoculating loop consists of insulating handle at the end of which inoculatin
Define Theory for Check the Presence of Rhodamine B? Addition of artificial colours to pulses, spices and tea is not permitted by PFA act. But certain colours, which contain le
classifying them
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd