Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Determine the bone density, Bone Density The compact bone surrounding d...

Bone Density The compact bone surrounding dense evenly spaced trabeculae with small cancellous spaces is ideal/suitable for implant placement. Dense or porous cortical bone is

Explain vanishing points., A vanishing point is where parallel lines that m...

A vanishing point is where parallel lines that move off into the distance seem to converge. It's an artifact of perspective. The vanishing point for any set of lines that are paral

Consumptive use values, This means the non-market value of natural products...

This means the non-market value of natural products such as firewood, game and fodder that do not pass through a market or product preparation. Indigenous people in developing cou

What is the echocardiogram, What is the Echocardiogram ? When doubts pe...

What is the Echocardiogram ? When doubts persist whether a patient has CHD or not despite a thorough clinical exam and chest X-ray, ECG, and hyperoxia test, an echocardiogram s

.rRNA , rRNA structure and synthesis assignment

rRNA structure and synthesis assignment

Explain the term kwashiorkor, Explain the term Kwashiorkor? The term Kw...

Explain the term Kwashiorkor? The term Kwashiorkor means the 'disease the first child gets when the second baby is born', that is, 'the sickness of the deposed child'. Thus, th

What is vdrl test & rpr test, Question 1 List the cells and organs involve...

Question 1 List the cells and organs involved in immune system. Explain the role of thymus in development of T cells. Add a note on recognition of self antigens by immune system

Adrenal gland, ADRENAL OR SUPRARENAL GLANDS (GLANDS OF EMERGENCY) - ...

ADRENAL OR SUPRARENAL GLANDS (GLANDS OF EMERGENCY) - These are paired structures located on the top of the kidneys. Each adrenal gland has two parts external adrenal cort

Exceptions to the cell theory, Exceptions to the Cell Theory Viruses, ...

Exceptions to the Cell Theory Viruses, however, are not the only exception to the Cell Theory as formulated earlier. This has led scientists to take a much broader view of the

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd