Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is packaging, Q. What is packaging? What is packaging? Packaging...

Q. What is packaging? What is packaging? Packaging means a coordinated system of preparation of goods (in this case, foods) for shipment, distribution, storage and

Protection of plants against toxic substances, Protection of Plants against...

Protection of Plants against Toxic Substances Plants produce several toxic substances themselves and may also encounter the ones produced by other plants or present in the env

Explain the use of enzyme assay, Explain the use of Enzyme assay Enzym...

Explain the use of Enzyme assay Enzyme assay is also used for research into such processes as the browning of plant products which poses problems during value addition. The br

Sucession, what is the model of tolerence mpdel of sucession

what is the model of tolerence mpdel of sucession

Compute the amount of nacl need, A saline drip is to be prepared for a lab ...

A saline drip is to be prepared for a lab experiment that is looking at hydration in lab rats. Calculate the amount of NaCl need to make 4 liters of a 0.9% solution.

What is the cost-benefit relationship, What is the cost-benefit relationshi...

What is the cost-benefit relationship regarding sewage treatment as a method to fight water pollution? To treat sewage is much cheaper for society. The non treated sewage pollu

Complications of short bowel syndrome, Q. Complications of short bowel synd...

Q. Complications of short bowel syndrome? Complications of short bowel syndrome are generally related to malnutrition. What are the complications of malnutrition? A person with

How dna helps growing human population, How recombinant DNA Technology can ...

How recombinant DNA Technology can help sustain growing human population?

What is ridge morphology, What is Ridge morphology The implant-supporte...

What is Ridge morphology The implant-supported prosthesis is affected by the ridge morphology especially implant-supported overdentures which gain dual support from implants an

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd