Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Role of diet - diabetes mellitus, To be in good health, we need to take foo...

To be in good health, we need to take food. Energy is provided by food to carry out activities in day to day life. In the same way, a diabetic patient also needs healthy food for e

Treatment of water for industrial use, Water is widely used in various proc...

Water is widely used in various process applications in industry. Other major industrial uses are boiler feed water and cooling water. The king and degree of treatment of water in

What is black mold, What is black mold? Mold is a fungus. Black mold is...

What is black mold? Mold is a fungus. Black mold is not an official term, since it is not possible to tell with the naked eye what type of mold is present, and many of them app

Define the high blood plasma lh levels and ovulation, Which of the followin...

Which of the following pairs of events in a human female occur at, or nearly at, the similar time during the menstrual cycle? A. High blood plasma LH levels and ovulation. B

Cost due to damage to equipment, Cost due to Damage to Equipment Cost ...

Cost due to Damage to Equipment Cost due to Damage to Equipment, Property etc. Tooling may have to be redesigned, adding cost. Cost due to reduced output and delay

Lead to protein denaturation, Q. What are some factors that can lead to pro...

Q. What are some factors that can lead to protein denaturation? Protein denaturation can be caused by temperature variation, pH change, changes in the concentration of surround

Ruminal tympany (bloat), R uminal tympany (Bloat) It is the over-diste...

R uminal tympany (Bloat) It is the over-distension of the rumen with gases which may be either frothy or free gas. The disease is characterized by change in silhouette of the

Discuss eukaryotic replication, Question 1 Discuss eukaryotic replication ...

Question 1 Discuss eukaryotic replication Question 2 Write an account on eukaryotic transcription factors Question 3 Write a detailed account on eukaryotic translation e

What is the functional unity of the kidneys, What is the functional unity o...

What is the functional unity of the kidneys? The functional (filtering) unity of the kidneys is the nephron. A nephron is made of afferent arteriole, efferent arteriole, glomer

Unconventional oilseed cakes/meal, Unconventional oilseed cakes/meal ...

Unconventional oilseed cakes/meal Deoiled sal (Shorea robusta) seed meal: It is a byproduct obtained after the extraction of oil from sal seeds. It is found to be high in NF

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd