Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Thermodynamics and Cell Shapes Why are protoplasts (cells devoid of cell wall) spherical? Why are most of the unicellular organisms (prokaryotes and eukaryotes) spherical? A s
The conduction of impulse in a nerve fibre is. a electrochemical process. Maximum speed of transmission of nerve impulse can be 13 metre/second due to axoplasm is much resistant to
Q. How Biocompatibility of materials affect osseointegration? Materials available of present are cpTi (commercially pure Titanium) Ti - 6AI - 4V (Titanium - 6 Aluminum - 4 Vana
Assume that your yard has many tall trees that result in about fifty percent of the yard being shaded and fifty percent of the yard being exposed to full sun. The shaded areas and
ATP is DIRECTLY required in which of the following processes in muscle? A. Net flux of sodium ions from intracellular space to extracellular space. B. Detachment of myosin h
functions of liver in frog?
all things in this topic
Biologists established that new cells Consequent to this doctrine, biologists established that new cells are formed by cell division and by the end of the nineteenth century, t
Excluding the effects of cardiac output and hormones, describe the other factors that may affect blood pressure and blood flow in a middle-aged man who is exercising in an aerobics
Determine what the abnormal levels of AFP signal Abnormal levels of AFP may signal the following: Open neural tube Defect (ONTD) Down syndrome Other chromosoma1
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd