Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Graphs are a way to convey information and trends in a convenient fashion. For this week's Discussion Board you should search the internet for a graph related to biology. Provide u
Describe about the Halstead's discriminating tests Halstead's discriminating tests are viewed as a measure of adaptive abilities, of skills that ensured man's survival on the p
Are there chloroplasts in cyanobacteria? In cyanobacteria there are no chloroplasts and the chlorophyll layers are dispersed in cytosol. Which chemical element is central in
Diagnosis X-ray chest shows cardiomegaly. ECG shows conduction defect, low voltage QRS, atrial and ventricular disrhythrnias. Echocardiogram - decreased LV cont
Q. Explain Diseases of pericardium? Pericardium is the sac covering the heart. Pericardium consists of two layers-the visceral pericardium (epicardium) and the parietal pericar
When the work sheet is finished all the essential information to prepare the statement of retained earnings, income statement and balance sheet is readily available. Currently you
Define Theophrastus of Eresus - Taxonomy The Father of Botany (370-285 B.C.); of all the men who ever lived upon the earth certainly one of the most remarkable was Theophrastu
Wind energy Wind power is one of most cheapest renewable energy sources today. Wind turbines convert the power of wind into electrical energy. Wind occurs due to t
What is the genetic condition in which the heterozygous individual has different phenotype from the homozygous individual? This condition is called lack of dominance and it can
Q. What are the intermediate and the definitive hosts of the plasmodium? In the life-cycle of the plasmodium humans are the intermediate hosts (where asexual reproduction takes
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd