Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
The most recent blood work of a patient with a diagnosis of acute myelogenous leukemia (AML) reveals thrombocytopenia. Where is the patient most likely to experience abnormal bleed
Which of the following is true for the epithelial cells of the kidney proximal tubule? A. The sodium-glucose co-transporter in the luminal membrane is responsible for the net f
The human eye is an organ which reacts to light for various purposes. As a conscious sense organ, the mammalian eye permits vision. Cone and Rod cells in the retina allow conscious
Define the Maintenance of Weight Loss? Once an individual has managed to lose weight to a desirable level, it must not be assumed that the weight loss will be maintained automa
which type of cleavage takes place in centrolecithal egg
List a few applications of starches in the food industry. A few applications of starches in the foods industry include thickener, a fat sparing agent, adhesive, binder,
TYPES OF FERTILIZATION - On the basis of site of fertilization, it is of two types - 1. External fertilization 2. Internal fertilization 1 . EXTERNAL FERTILIZ
respiration in animals?
family ,genus, class order , species of mollusca
Stability studies are req. for the product stable at their desire time as per specification , which give the expiry date and quality as per the manner.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd