Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define the term - Functional magnetic resonance imaging Functional magnetic resonance imaging (fMRI) is a recent development that permits simultaneous measurements of the brain
What is Microtubules? Microtubules are the largest intracellular fibers, with a diameter of about 25 nm (2.5 x 10-8 meters). They consist of hollow fibers composed of a protein
According to the Mendel's law the phenotypical characteristics would be determined by pair of factors (alleles) that separate independently in gametes. What are the major types of
What is the autotrophic hypothesis on the origin of life? An autotrophic hypothesis on the origin of life asserts that the first living beings on earth were producers of their
You are studying how proteins are targeted to the mitochondria. MIP1 is in the mitochondrial inner membrane, whereas MIP2 is targeted to the matrix. You are most interested in how
What is dry mass? When the biomasses are compared often the concept of dry mass is used. The dry mass is the entire (total) mass less the water mass of an individual. The total
Explain the Postoperative Nutritional Care? The therapeutic goal for the post-operative patient is rapid recovery to normal function and well being, minimum complications and e
Q. Use of Neurotensin in consciousness? Although little is known about the role of this peptide during the sleep-wake cycle, it has recently been shown that neurotensin injecti
What is the difference between embryo and endosperm?
What are some factors that can lead to protein denaturation? Protein denaturation can be caused by temperature variation, pH change, alters in the concentration of surrounding
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd