Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Enumerate the term - Clinical neuroscience Clinical neuroscience concerns the study of clinical populations both to well understand neuroanatomy and to test psychological theor
Why does the ingestion of vegetable fibers improve the bowel habit in people that suffer from hard stools? Some types of plant fibers are not absorbed by the intestine but play
Explain the Decolourizing Agent - Stain Technique? 95% ethanol is used as a decolourizing agent. It has two functions - (1) It acts as protein - dehydrating agent, and (2
Causes of Air Pollution We known about the composition of atmosphere, its major and minor constituents. The composition of atmosphere has remained the same for thousands of y
How is hydration control by active pump mechanisms responsible in the corneal hydration? Hydration Control by Active Pump Mechanisms: a) Na/K ATPase pump, which is more acti
harmful and beneficial usesa of phylum porifera
NURSING RESPONSIBILITIES WHILE ADMINISTERING IMMUNIZATION Use one sterile syringe and needle for each injection. Use only the diluent supplied along with measles and
What is End-to-End Anastomosis with Subclavian Flap Aortoplasty ? The two operations can be combined as a single procedure. Medially end-to-end anastomosis is done between the
what are peptides and poly peptides hormones
what is the mode of nutrition in Pisces?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd