Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Principles of BCC · BCC should be integrated with program goals from the beginning. BCC is a necessary part of diabetes prevention, care and support programs, and providing li
PHYSIOLOG Y OF DIGESTION Food - omnivorous. Digestion - Intercellular. (i) Mechanical - by chewing, deglutinationm, churnning, peristalais. Under control of medulla oblonge
Nekton - Aquatic Ecosystem This group contains animals which are swimmers. The nektons are relatively large and powerful as they have to overcome the water currents. The anima
An impermeable membrane separates one liter of a 1M KCl solution in the left compartment from one liter of 1M NaCl solution in the right compartment. At 2 AM today the membrane be
True cyst: cyst that is completely lined by epithelial tissues.All the lesions are far away without communication with endodontic access or endodontic cavity or periapical
What is complete transposition of arteries? Complete transposition of the great arteries (dTGA): The atria and ventricles are connected appropriately i.e., the right atrium dra
Draw a diagram of transverse section of mammalian bone and label the following parts in it: (i) Haversian canal (ii) Lacuna containing osteocytes (iii) Canaliculi
Discuss the biological importance of Imidazole. Bring in examples of biomolecules that contain this group. Please be as thorough as possible.
Embryology in relation to taxonomy?
Personal Protective Equipment These equipments are essentially required during working to protect face, eyes, respiratory system hands and clothes. Additionally in various in
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd