Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
deatiel
What is Abscess and Gingival Biotype Abscess: Rule out any presence of Periapical or /and Periodontal abscess Gingival Biotype: Thickness of the gingival is an important
Q. Why doesn't the food enter the trachea instead of going to the esophagus? When food is swallowed the swallow reflex is activated and the larynx closes and elevates to avoid
Two adaptation of the skin against attack by micro-organisms
Define Class Turbellaria - Flatworms ? Members of these two Classes are known as the flukes. Flukes are parasitic flatworms that inhabit tropical areas like Southeast Asia and
C dna is made from a mature m rna of eukaryotic cell with the utilization of enzyme called as reverse transcriptase. Steps in c dna creation 1. m rna is made and purified f
Define functions of Organic Phosphorus? It is involved in the following reactions/components: a) Structural component of nucleic acids: It is important component of DNA and
Enumerate the history of neuropsychological The typical neuropsychological exam begins with a careful history taking. Areas of interest include: Medical history of patie
Circulatory Assist Devices : Intra aortic balloon pump (IAUP) was introduced by Kantrowitz (19hX). It is also known as Counter pulsation or Diastolic augmentation.
Dietary Management It must be evident to you that majority of the tuberculosis patients are emancipated and malnourished. Proper dietary management it during and after the inf
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd