Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is the life cycle type of bryophytes, What is the life cycle type of b...

What is the life cycle type of bryophytes? As in all plants the life cycle of bryophytes is diplobiontic (alternation of generations). In bryophytes the lasting form is the hap

Systems theory - accident causation, Systems Theory - Accident Causation ...

Systems Theory - Accident Causation The systems theory established extremely strong relationship between system and accident. A properly functioning system may avoid accidents

Neural circuits, Neural Circuits The simple all are none activities of...

Neural Circuits The simple all are none activities of a single neuron can hardly provide the adaptability needed for the constant changes faced by the organism in its internal

Management and nutritional intervention using mna, Define Management and Nu...

Define Management and Nutritional Intervention using MNA - Undernutrition? A. For those categorized as well-nourished They need only be reminded of the importance

Explain in details aerobic respiration, Explain in details Aerobic Respirat...

Explain in details Aerobic Respiration? The pyruvate produced in glycolysis is further broken down in most organisms. This process, called aerobic respiration, requires gaseou

Explain unacceptable aesthetics, Unacceptable Aesthetics The implant wh...

Unacceptable Aesthetics The implant which has successfully integrated with bone may still be a failure if the Prosthesis which it is designed to support does not meet with the

What is the importance of iron in diet, Q. What is the importance of iron i...

Q. What is the importance of iron in diet? What is the disease caused by iron deficiency? Iron acts as a constituent of the hemoglobin molecule and of enzymes of the energetic

Explain the effect of non nutritional factors pregnancy, Explain the effect...

Explain the effect of Non Nutritional Factors pregnancy? The incidence of LBW is lowest and mean birth weight is highest in the state of Kerala, which is attributed to better

Kuch, how vagina is inserted in cock

how vagina is inserted in cock

Determine the high blood plasma levels of insulin, A patient has total dest...

A patient has total destruction of all of the beta-islet cells of the pancreas.  Prior to receiving treatment, this patient will have A. high blood plasma levels of glucose.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd