Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Formation of Vegetative and Generative Cells The division of a pollen grain results in two unequal cells-the vegetative cell and the generative cell. The pollen grain is herea
What raw materials require for the manufacture of margarine Soybean and peanut (or groundnut) oils are of great economic importance. Refined soybean oil contains branched fura
Q. How can denaturation be classified concerning its reversibility? Protein denaturation can be an irreversible or a reversible process, i.e., it may be impossible or possible
Temperature and Concentration of Nutrients Temperature Temperature like salinity remains almost constant in the oceans in contrast to the land or terrestrial ecosystems
Explain the Food Intolerance? What is food intolerance? How does it differ from food allergy? Food intolerance like food allergy is an adverse reaction to food. Food intoleranc
Long-term Follow-up Results : To evaluate the long-term results of surgery, one has to take into consideration the natural history, results of medical treatment and that of PTCA.
Q. What is Insulin Dependent Diabetes Mellitus? Mostly children and adolescents suffer from this type of diabetes however; it may appear in adults and elderly too. In this, the
WHAT IS THE TYPICAL REPRODUCTION CYCLE OF A DNA VIRUS
Amphibian frog embryo
Effect of Metamorphic Hormones on Gene Expression Effect of metamorphic hormones on gene expression in moulting and metamorphosing insects, the first report of a particular ho
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd