Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
assignment on prolactin
Explain the Potential Benefits of micro nutrients? The potential benefits of micro nutrients should also be taken into account when the nutrient allowances are defined for olde
CRP is a marker of systemic inflammation. As the role of inflammation in the initiation and progression of atherosclerosis becomes better understood, CRP has gained prominence as a
Define Formation of healthy food habit - combat from obesity? Discarding faulty habits as early as possible. Most food habits formed at this age are for a life time. Special c
Q. What is Angina Pectoris? Chest discomfort is often reported by most patients especially those which are chronic cases of dyslipidemia and/or hypertension. Like diarrhoea and
Circulatory Systems in Animals In animals that have efficient circulatory systems and readily permeable vascular skins, gas exchange occurs through the integument. Thus we fin
Q. How to investigate mitral regurgitation by Chest Radiogram? Enlarged left atrium is obvious on chest X-ray and it may occupy most of the cardiac silhouette in patients with
To show the direction of sprout growth in seeds Soak pumpkin or other large seeds overnight and fasten three of them on needles as shown in the diagram. Fasten single with the
Why do ecological models commonly have limited applications? The applications of ecological models are limited due to the models are normally very simple and do not accurately
The scientist who described cells as “many little boxes” was
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd