Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Why does the urinary volume increase when alcoholic beverages are ingested? Alcohol inhibits the ADH (antidiuretic hormone) secretion by the hypophysis. Low ADH decreases the t
What is the respective importance of water, carbon and nitrogen for living beings? Water is the major solvent of living beings and it is essential practically for all biochemic
What are pentoses? To what organic group do pentoses belong? Are nucleotides formed of only one type of pentose? Pentoses are carbohydrates made of five carbons. Deoxyribose is
Define Briefly about the Copper? As early as the times of Hippocrates, copper compounds were used to treat various diseases. However, in the 20" century, it was noticed that an
Select the processes assist in the maintenance of high levels of dissolved solutes in the interstitial spaces of the kidney medulla? A. Net flux of sodium ions from intracellul
Define about the Composition of Body Weight? You might have read in previous units that our body weight is composed of muscle bone and fat. Segregating these components of body
Define the Basic Concepts behind the Spectral Techniques? Energy is transmitted via electromagnetic waves that are characterized by their frequency and wavelength. The physical
Q. What is the evolutionary importance of pteridophytes? As the first pteridophytes, tracheophytes were also the first plants to extensively colonize the terrestrial environmen
What is omnispective classification
The immune response involves the activities of proteins, cells, and the lymphatic system.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd