Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Describe in brief about retina The retina is a highly complex layer of nervous tissue. The photoreceptors are rods and cones for scotopic and photopic vision respectively. The
how does epigenetic controls transcription?
Describe the general examination of clinical examination? It is always to better to ask the patient to help himself/herself in setting on to the examination table and rename so
Define Historical example of management of renewable resources? There are fundamental and well developed applications of mathematical and quantitative approaches to the managem
Glanders The glanders is caused by Burkholderia mallei (previously known as Malleomyces mallei) and it is a serious contagious disease of equines. Infected equidae are the reservo
Define Vacuum production and Thermal processing - Canning? Vacuum production - This can be obtained by filling the heated product into the can, by heating the can and content
Explain about the Commercial Sterility? It is important to remember that bacterial destruction is a logarithmic function, complete destruction not probable to make food commerc
a) Name two food additives needed to keep food wholesome, and say what they do. b) Name two food additives (or types of additive) which are not necessary for keeping fo
I have an assignment about Pisces in zology can you creat it
Oxidation-reduction Potential (ORP) ORP is related to the concentration of oxidizers or reducers in a solution, and their activity or strength. It provides an indication of th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd