Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Q. Explain Consciousness as inner state? Consciousness as inner state: We are conscious of thoughts, images, emotions and memories within ourselves though they may not have phy
Define Feeding Options for Premature and LBW Babies? Different workers have tried different method and since all methods are successful, it is dependent on the individual infan
Explain Precautions for Detection of Metanil Yellow? 1. One should be careful while using concentrated HCl otherwise it may result in burn. 2. Amount of concentrated HCl in
HOMEOS T ASI S - Homeo = same, Stasis = state Living beings maintain their internal environment by self regulating system, it is called homeostasis. Term coined by
Define Historical example of virulence? The "classical dogma" of epidemiologists was that pathogens all the time evolve in the direction of lower virulence, eventually becoming
Importance of fat synthesis and storage : As is clear from above account, all surplus nutrients, digested and absorbed from above the immediate need of body, are readily
Q. Show Very low level of lactase activity? Very low level of lactase activity: at very low level of lactase activity all milk products must be eliminated, substitutes of milk
Using high temperature carbonization, metallurgical coke (hard coke) can be prepared by two processes. 1. Beehive coke oven process. 2. Otto-hoffmann's by-product
What is the law of limiting factors? How would the rate of photosynthesis be affected if the soil water becomes limiting? Describe.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd