Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Heat Loss Temperature regulation is extremely uneconomical if it depends only on variations in metabolism. Therefore, mechanisms for losing excess heat have been developed by
difference between axon and cyton
What is the role of Stomach in human body? The stomach serves both to digest food and to hold it so that it can be gradually released into the small intestine. Food stays in th
Differential reinforcement (Training of incompatible behaviour)- Differential reinforcement of incompatible behaviour (DRI) is used to decrease a frequent behaviour without pun
Pericardiocentesis It is removal of fluid form the pericardial sac. It is a specialized procedure done n ICU or cardiac cath lab or OT. A 16 or 18 gauge needle is inserted
Define about the Column chromatography? In column chromatography, a tube is filled with the material constituting the stationary phase, plus a solvent (mobile phase). The gener
Aim: To prove that oxygen is evolved during photosynthesis. Apparatus: Beaker, funnel, test tube, water, Hydrilla plants. Procedure: Take a few pieces of Hydrilla plant. Keep a
A pure phospholipid bilayer with its hydrophobic interior, is permeable to water and gases such as O2, CO2, N2 and small uncharged polar molecules such as urea, ethanol, bu
Coronal Disassembly - If the existing restoration with marginal defect: - The crown was sectioned through the bucco-occlusaly , Christensen crown remover elevate and remove
What are Cytokines? Cytokines are polypeptides, which influence the proliferation, differentiation, metabolism and activation of cells. There are three areas in cancer that hav
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd