Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Biological diversity is the new buzzword, the magic door to international funding and global travelling. We share the earth with million of other living beings. Just as we humans m
Define Sample Titration - estimation of vitamin c in a solution? Take the given unknown solution provided to you in a 100 ml volumetric flask. Dilute the sample ascorbic acid s
what is photosynthesis
What is Implant Failure The total failure of the implant to fulfill its purpose which are functional, esthetic and phonetic because of mechanical or biologic reasons.
Agreed-upon Procedures - Non-assurance Engagements Within an engagement to present agreed-upon procedures, the auditor is engaged to carry out those procedures of an audit nat
What is monohybridism? Monohybridism is the study of only one feature in the crossing of two pure individuals (hybridization) for that characteristic.
Q. Describe about Collective or Universal consciousness? Neurochemicals and associated brain processes are simply channel selectors for various states of consciousness. All sta
Interactions between minerals Copper deficiency has been identified as a serious problem for grazing ruminants. A deficiency may be due to low concentrations of Cu in forage a
Explain about the Food Spoilage? Foods gradually undergo deterioration or spoilage from the time they are harvested, caught, slaughtered or manufactured. Therefore, delay in th
What is mitosis
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd