Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define about the resistant starch, Define about the Resistant Starch? U...

Define about the Resistant Starch? Until 1980's starch was thought to be completely hydrolyzed and absorbed from the small intestine of man, independent of its source, type and

Control of excretion, CONTRO L OF EXCRETION - 1.      In brain hypoth...

CONTRO L OF EXCRETION - 1.      In brain hypothalamus is osmocentre that controls minerals. 2.      Cells of DCT & arterioles combien to form Juxta glomerular node, it se

Classification of freshwater ecosystems, Classification of Freshwater Ecosy...

Classification of Freshwater Ecosystems Fresh water ecosystems depend on the terrestrial ecosystems for large quantities of organic and inorganic matter which are constantly a

Biomass energy, Biomass energy Energy produced by burning biomass it is...

Biomass energy Energy produced by burning biomass it is known as biomass energy. When biomass is burnt, it releases stored chemical energy, which has accumulated in it through

Which molecules has more direct effect, Which of the following molecules ha...

Which of the following molecules has more direct effect in learning and memory? A) norepinephrine B) epinephrine C) glutamate D) acetylcholine E) glycine Please leave justification

Reasons for growth of population, REASON S FOR GROWTH OF POPULATION - ...

REASON S FOR GROWTH OF POPULATION - The human population explosion is mainly a result of reduced death rate. Main reasons for it are - 1 .       Protection from natura

Explain what is patent ductus arteriosus in details, Explain what is Patent...

Explain what is Patent Ductus Arteriosus in details? Figure : Anatomical location of PDA Patent Ductus Arteriosus (PDA) may be an isolated defect or may co-exist with

Define the factors effect the quantity of human milk, Define the factors ef...

Define the factors effect the Quantity of Human Milk? A large healthy baby who can vigorously suck will induce and obtain much more milk from its mother than a small, sickly or

Interdependance, Give an example of how two organisms are interdependent.

Give an example of how two organisms are interdependent.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd