Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
You are working with plants that have either hairy (dominant) or 'bald' (recessive) flowers. Hairy flowers have little hairs on them that make the flowers look fuzzy, bald flowers
What is mitosis
While discussing the Darwinian premise of natural selection we observed that the term selection is synonymous with non-random reproduction, and that the success of the survivors is
Q. Describe the Non Direct Approach? The counsellor's participation is minimal; here the counsellee freely expresses. The counsellor pays attention to the emotion and attitudes
Q. Preservation of Tooth Structure? Fixed partial dentures have been considered the standard of treatment prior to advent of implant therapy. However, to obtain optimal esthe
what is the kingdom,phylum,class,age of gastropoda
Homologous Recombination is the exchange of the sequence between two associated but different DNA (or RNA) molecules, with the result that a new "chimeric" molecule is obtained. S
Herbage area or vegetation cover Herbage area or vegetation cover is an important aspect of vegetation study in understanding the nature of a community particularly in evaluat
Describe the regulation of pyruvate dehydrogenase through covalent modification. PDH exists in 2 forms : Inactive, phosphorylated and Active, dephosphorylated. The active form
VACUOLES Some animals cells may have one to a few small fluid filled vacuoles.. Plants cells in general possess one or a few large vacuoles. Vacuoles of animals cells
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd