Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain the working of skeletal muscle, Explain the working of Skeletal Mus...

Explain the working of Skeletal Muscle? Skeletal muscle is under voluntary control and is responsible for voluntary movements of body parts. Skeletal muscle is also called stri

Explain the metabolic alterations during cancer, Explain the Metabolic Alte...

Explain the Metabolic Alterations during Cancer? As we have studied earlier, patients with advanced cancer experience profound anorexia, early satiety, changes in the structure

Vasa gene, Vasa are a maternal-effect gene whose product functions in devel...

Vasa are a maternal-effect gene whose product functions in development of the posterior end of the Drosophila embryo.  runt is a non-maternal-effect gene whose product functions in

What is the significance of magnesium for plants, Q. What is the significan...

Q. What is the significance of magnesium for plants? What are the other major biological functions of magnesium? Magnesium is basically vital for plants because it is part of t

Orbital shaker, How I can optimize shake flask culture?

How I can optimize shake flask culture?

What is mendels second law, What is Mendel's second law? Mendel's seco...

What is Mendel's second law? Mendel's second law postulates that two or more different traits are also conditioned by two or more pair of dissimilar factors and that each inhe

Define efficiency - terminologies used in chromatography, Define Efficiency...

Define Efficiency - terminologies used in chromatography? Efficiency in chromatography is expressed as number of theoretical plates.           H =   L/N Where, H is heigh

Nephridia of worms, Normal 0 false false false EN-IN ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

What are organic chemical groups that divide carbohydrates, What are the or...

What are the organic chemical groups that characterize carbohydrates? How are carbohydrates classified according to the presence of those groups? Carbohydrates are also called

Determine energy density of human milk, Determine Energy Density of Human M...

Determine Energy Density of Human Milk? The energy density of human milk depends on the relative proportions of protein, fat and the principal carbohydrate, lactose. Lactose co

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd