Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define About the Sterols - Non Glyceride Fractions? These constitule a major proportion of the non-glyceride component while tocopherols, carotene pigments and flavour compound
Define the Microbiological Study of Water? Water is a common carrier of infectious diseases. Even clean and clear water which looks pure may be contaminated with pathogenic mic
The permissible use of the technique amniocentesis is for: 1. detecting sex of the unborn foetus 2. artificial insemination 3. transfer of embryo into the uterus of the su
Social Status and Support Network Income and Social Status: Higher income and social status lead to better health.Employed persons, having more control over their workin
wHAT IS 10um?
To study if bacteria grow better where it is dark or light Inoculate two sterile dishes as before. Label one 'dark' and the other 'light'. Place the 1st dish in a darkwarm plac
Explain how the uterus supports the development of a baby during gestation
define histon protein?
Give ditail account on regernation in invertebrates and vertabrites
Explain Physical properties of an oil Physical properties of an oil or fat are of critical importance in determining its functional characteristics or use in food products. One
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd