Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What are the attribute of amylase inhibitors, What are the attribute of amy...

What are the attribute of amylase inhibitors? This has been attributed to a number of reasons, Let us see how these inhibitors act. The inhibitor forms a complex with amylase,

Phylum collenterata, what are he characteristic of phylum collenterata?

what are he characteristic of phylum collenterata?

What are the plant root hairs, What are the plant root hairs? Where can the...

What are the plant root hairs? Where can they be found and what is their function? The root hairs are external elongated projections of the root epidermis. Their role is to

Littoral and benthic zone, Littoral and Benthic Zone Littoral Zone ...

Littoral and Benthic Zone Littoral Zone This is the shallow water zone, near the shore, where light penetrates to the bottom. Rooted plants can grow only in this region.

What is osmotic pressure, Osmotic pressure is the pressure formed in a aque...

Osmotic pressure is the pressure formed in a aqueous solution by a region of lower solute concentration upon a region of superior solute concentration forcing the passage of water

What is the significance of proteins for living beings, Q. What is the sign...

Q. What is the significance of proteins for living beings? Proteins play an essential role in nearly all biological processes. Due to their variety they can suppose many divers

Explain the disadvantages of tissue punch, Explain the Disadvantages of tis...

Explain the Disadvantages of tissue punch - There is a loss of keratini-ed tissue and this can lead to a compromised soft tissue barrier in cases where there is deficiency of a

Structures in the Dermis, list of the structures you would expect to find i...

list of the structures you would expect to find in the dermis.

THC and testis weight., A study set out to determine whether tetrahydrocan...

A study set out to determine whether tetrahydrocannabinol (THC, the psychoactive component of marijuana) affects fertility in male hamsters. Two different experiments were conducte

Isolation of dna fragments, Isolation of dna fragments bound strongly with ...

Isolation of dna fragments bound strongly with protein 1.     Through pcr Pcr permits isolation of dna fragments from genomic dna through selective amplification of a spe

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd