Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Can you explain deoxynivalenol mycotoxicosis, Q. Can you explain Deoxynival...

Q. Can you explain Deoxynivalenol Mycotoxicosis? During 1987, an outbreak estimated to have affected over 50,000 people in the State of Jammu and Kashmir, was traced to the c

Can you illustrate chylomicrons, Q. What is the special route that lipids f...

Q. What is the special route that lipids follow during digestion? What are chylomicrons? Triglycerides emulsified by the bile within micelles suffer the action of lipases that

Can you explain bauhin binomial system, Q. Can you explain Bauhin? We g...

Q. Can you explain Bauhin? We got the first reference of binary use of species name in Pinax (1623), a publication of a Swiss physician and botanist Casper Bauhin (1560-1624).

Explain the appearance of the pupil, Explain the Appearance of the Pupil ...

Explain the Appearance of the Pupil The pupil should appear round and regular. The normal diameter  is  2-4 mm. On stimulation by  light,  the pupil  constricts, so as  to redu

How did the industrial revolution in england, How did the industrial revolu...

How did the industrial revolution in England offer an example of natural selection? One of the classic instances of natural selection is regarding the moths of industrial zones

AUTOCHORY, ALL ABOUT AUTOCHORY?HOW IT WORKS

ALL ABOUT AUTOCHORY?HOW IT WORKS

What is the significance of protein for the cell, Q. How does the sodium-po...

Q. How does the sodium-potassium pump present in the cell membrane work? What is the significance of this protein for the cell? The sodium-potassium pump is the transport prote

Importance of the fruits for the angiosperms, What is the evolutionary impo...

What is the evolutionary importance of the fruits for the angiosperms? The fruits have seeds and they can detach from the plant falling on the ground or can serve as food for a

Define typical structures of the seed and define endosperm, What are typica...

What are typical structures of the seed? What is the endosperm? A typical seed is the composed of the embryo, endosperm and shell. Inside seeds of angiosperms there are one or

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd