Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is the mn blood system, What is the MN blood system? What is the patte...

What is the MN blood system? What is the pattern of genetic inheritance of the MN blood system? A MN blood system is a third (in addition to the ABO and the Rh) system of blood

Control of radio-pollution , (i)        Area uses or perm...

(i)        Area uses or permit exposure to radiation should be Marked' Restricted Area 'or Radiation zone etc. (ii)        Avoid x-rays of chest and lower back in routine physic

Why fish and sea foods are important for human body, Why Fish and Sea Foods...

Why Fish and Sea Foods are important for human Body? They are rich sources of proteins (20-25%) of a high biological value. Dry fishes contain more (60%) proteins since most of

Protozoa., show me the schamatic diagram of chrysomoeba?

show me the schamatic diagram of chrysomoeba?

Induction of antimicrobial substances, Induction of antimicrobial substance...

Induction of antimicrobial substances Phytoalexins are antimicrobial substances produced by plants in response to pathogen. They accumulate at the site of infection. For exam

Medical management of mitral regurgitation, Q. Medical Management of mitral...

Q. Medical Management of mitral regurgitation? Vasodilator therapy to reduce afterload may be beneficial in patients with chronic mitral regurgitation, but there is no evidence

Rk, how many chromosomes in human

how many chromosomes in human

Natural selection of heterogeneous environments, While describing normalisi...

While describing normalising selection it was said that in uniform environments selection limits the variability of populations and evolves a genetic homeostasis. The type of selec

Define the disturbances in fluid balance, Define the Disturbances in Fluid ...

Define the Disturbances in Fluid Balance? The correct functioning of cells and tissues depends on appropriate concentrations of nutrients; so any abnormal loss or accumulation

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd