Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain restricted fragment polymorphism, Q. Explain Restricted fragment po...

Q. Explain Restricted fragment polymorphism? This method makes use of a group of enzymes termed restriction enzymes which recognise particular sequence of DNA and act as "molec

How campylobacteriosis occurs in humans, How CAMPYLOBACTERIOSIS  occurs in...

How CAMPYLOBACTERIOSIS  occurs in humans C. jejuni frequently contaminates raw chicken. Survey shows that 20-100% of retail chickens are contaminated. Many healthy chickens car

What thiamine defiency will result in decreased activity, A thiamine defien...

A thiamine defiency will result in decreased activity of: -G-6 phosphase -transketolase -fructokinase

What is enhancers , While  various  positive  control  components  li...

While  various  positive  control  components  lie  close  to the  gene  they  regulate additional can be situated long distances away (sometimes 10-50 kb) either upstream or downs

Chemical stress, Chemical Stress Survival of cells is dependent on car...

Chemical Stress Survival of cells is dependent on carrying out of a set of chemical reactions (metabolic reactions) in a particular order. This results in a net gain in mass a

What is the utility of fungi for some industries, What is the utility of fu...

What is the utility of fungi for some industries? Fungi are industrially used in the production of fermented beverage, cheese, bread etc. Some fungi are very significant for th

Green glands of crustaceans, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Explain food intolerances, Food Intolerances Food Intolerances:  The in...

Food Intolerances Food Intolerances:  The intolerances of  the patient for specific food  items must be assessed. For example,  milk may lead  to diarrhoea  in some people whil

Which are the more abundant ribosomes in secretory cells, Which are the mor...

Which are the more abundant ribosomes in secretory cells - the free cytoplasmic ribosomes or those associated with the rough endoplasmic reticulum? Free cytoplasmic ribosomes

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd