Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain about pentoses, What are pentoses? To what organic group do pentose...

What are pentoses? To what organic group do pentoses belong? Are nucleotides formed of only one type of pentose? Pentoses are carbohydrates made of five carbons. Deoxyribose is

What are the final digestion products of protein, What are the final diges...

What are the final digestion products of (a) protein, (b) fat, (c) starch?   a) Proteins are digested to amino acids, b) fats are digested to fatty acids and glycerol,

Female accessory sex organs, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

What is the action mechanism of the antiretroviral drugs, Q. What is the ac...

Q. What is the action mechanism of the antiretroviral drugs known protease inhibitors which are used against HIV infection? Protease inhibitors are some of the antiretroviral d

Which are the main positive ions found in living beings, Which are the main...

Which are the main positive ions found in living beings? The major cations found in living beings are the sodium cation (Na+), the potassium cation (K+), the calcium cation (Ca

Define the elimination of dna ligase activity in a cell, Which of the follo...

Which of the following results from the elimination of DNA ligase activity in a cell? A. The oligonucleotide primers will not be removed from the genome - as they often contain

Cnidaria and protozoan, What are the advancement of cnidaria over protozoa

What are the advancement of cnidaria over protozoa

Difference between spermatid and spermatocyte ii, Q. What is the difference...

Q. What is the difference between spermatid and spermatocyte II? The spermatids (n) are the products of the second division of meiosis (meiosis II) in the male gametogenesis an

Regulation of egg, difference between mosaic and regulation egg

difference between mosaic and regulation egg

Arthropoda phylum, characteristic of spider that makes it the phylum arthro...

characteristic of spider that makes it the phylum arthropoda?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd