Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
All plants and animals have a natural microflora associated with them. For example, the plants have a natural microflora associated with the surface of roots, stems, leaves e
Explain about Posterior wall Posterior wall separates the antrum from the infra-temporal fossa and contains two important structures. Posterior superior alveolar nerve and
Intracellular sodium concentration of the motor neuron A complete motor neuron is removed from a frog and placed in normal physiological saline at 1 AM. The neuron is healthy.
In holly, serrated leaves are dominant to smooth-edged leaves, and red berries are dominant to green berries. Two holly plants heterozygous for leaf edge shape and berry color are
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Why is VeggieTales such a consistently high-quality program?
Explain about the Sucralose - artificial sweeteners? Sucralose (1, 6-dichloro-1, 6-dideoxy-β-D-fructofuranosyl-4-chloro-4-deoxy-α-D- galactopyranoside) is the only non-nutritiv
ADOLESCENC E - It is the period of growth from the onset of puberty to the completion of growth & maturity. It extends between 12- 20 yrs. It is a period of rapid physical
Define osseointegration and its theories. Osseointegration implies that "it is a contact established without interposition of non bony tissue between normal remodeled bone and
Prophylaxis Medical Letter consultants generally do not prescribe antibiotic prophylaxis for travelers' diarrhea, but rather instruct thec patient to begin self-treatment when
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd