Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. In ancient Greece the father of Medicine, Hypocrates, described a method of diagnosing diabetes mellitus by tasting the patient's urine. What is the physiological explanation fo
Please explain to me why the probability and the likelihood in a hidden Markov model are so different.
BAER' S LAW - It was given by K.E. Von Baer. Von Baer was the first scientist who studied the embryology systematically. According to it, in the embryonic development of an
Q. How execute the two complementary nucleotide chains of the DNA facilitate the replication process of the molecule? The fact that DNA molecule is made of two polynucleotide c
Pesticides - Danger to Wildlife Another recently realised danger to wildlife in many parts of the world has come from the development of more effective pesticides. As agricult
definition of dietary factors. or what are dietary factors?
What are cell kind that form the xylem? What are the major features of those cells? The major cells of the xylem are the tracheids and the vessel elements (these only in angios
Give three ways in which a polar bear is adapted to its environment. A polar bear is adapted to its environment by its high ratio of bulk to surface area, a thick water-repelle
Do fats with one or more 'kinky' tail fatty acids tend to be solid or liquid at room temperature? These are found in triglycerides forming what? Solid fats or oils? Is it opposite
Indications for Surgery: In a mixed lesion, either regurgitation or stenosis may be dominant and decision of surgery depends on the haemodynarnics. At the time of surgery on othe
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd