Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Find the effective spring constant of the molecule, A Molecule of DNA is 2....

A Molecule of DNA is 2.17 um long. The ends of the molecule become strongly ionixed: negative on one end, positive on the other. The helical molecule acts like a spring and compres

Write in 3-4 lines about the term belief, Q. Write in 3-4 lines about the t...

Q. Write in 3-4 lines about the term belief? Beliefs are learned by us when we were young. These include religious beliefs and beliefs about behaviour. Some beliefs lead to hea

Agreed-upon procedures - non-assurance engagements, Agreed-upon Procedures ...

Agreed-upon Procedures - Non-assurance Engagements Within an engagement to present agreed-upon procedures, the auditor is engaged to carry out those procedures of an audit nat

What main idea, What key idea, contained in Malthus's essay on populations,...

What key idea, contained in Malthus's essay on populations, helped Darwin formulates his theory of natural selection?

Explain an open circulatory system, Why, even though they have an open circ...

Why, even though they have an open circulatory system, can flying insects like flies beat their wings with great speed? In insects the circulatory system is open but this syste

Explain positive staining technique, Explain Positive Staining Technique? ...

Explain Positive Staining Technique? Here, a stain has a positively charged chromophore that gets attached to the negatively charged outer surface of the microbial cell and thu

Discuss about smooth muscles, Smooth muscles These muscles are beyond o...

Smooth muscles These muscles are beyond our control. That means these muscles are controlled by autonomic nervous system. They are non-voluntary muscles. They are found in thin

Obelia, Obelia is considered to be of special interest in zoology as an ani...

Obelia is considered to be of special interest in zoology as an animal showing an intermediate grade of organization?

DNA, What is replication fork??

What is replication fork??

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd