Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain systemic circulation in human biology, Explain Systemic Circulation...

Explain Systemic Circulation in human biology? In systemic circulation, oxygenated blood is pumped from the left atrium through the bicuspid valve, into the left ventricle, and

Determine about the prokaryotes and eukaryote cell, Determine about the pr...

Determine about the prokaryotes and eukaryote cell The eukaryotic cells, on the other hand, have a true nucleus wherein the genetic material, DNA is enclosed within a well-def

Define body mass index (bmi), Define Body Mass Index (BMI)? Weight for ...

Define Body Mass Index (BMI)? Weight for height as a marker of nutritional status has the advantage that it is independent of other factors that affect foetal outcome such as m

How can bacteria produce human insulin, Q. How can bacteria produce human i...

Q. How can bacteria produce human insulin on an industrial scale? What are the other forms of insulin made available by the pharmaceutical industry? Bacteria don't naturally sy

Starch, S T ARC H - Polymer of a-D-glucose. Starch is glucosan...

S T ARC H - Polymer of a-D-glucose. Starch is glucosan homopolysaccharide which is the major reserve food of plants. Starch is formed as an end product of photosynt

What is invertebrates, What is Invertebrates? Invertebrates: About 99...

What is Invertebrates? Invertebrates: About 99% of all the animals lack backbones, and are invertebrates! Invertebrates include the phylum Arthropoda, or the animals with joi

What is a photosynthesis, Photosynthesis is a process used by plants and ot...

Photosynthesis is a process used by plants and other organisms to change the light energy captured from the sun into chemical energy which can be beneficial to fuel the organism's

Structure of the urinary system, It consists of: - Two kidneys that prod...

It consists of: - Two kidneys that produce urine. - The left and right ureters that the urine travels through on leaving the kidneys. - The muscular urinary bladder, which

Life, How life exist in earth?

How life exist in earth?

Explain the four initial stages of the embryonic development, What are the ...

What are the four initial stages of the embryonic development? The four initial parts of the embryonic development are the morula stage, the blastula stage, the gastrula stage

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd