Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain TechnologicaI advances of clinical dietitian TechnologicaI advances in nutritional support for the critically ill have enhanced the clinical dietitian's role. In the
Technique of radiographic template 1. Block any severe interdental undercuts or spaces with wax. Soak the patient's diagnostic cast with wax up in slurry. (Slurry is the super
Pollen Biology Fluorescence microscopy coupled with biochemical analysis has helped resolve the differential activity of the enzyme, β-l, 3- glucanase that catalyses the disso
Diagram the cross and determine which allele is dominant for each of the following Drosophila matings? a. Two red-eyed flies yield 110 red-eyed and 35 brown-eyed offspring.!
Define Tests for the Presence of Exoenzymatic Activity? Microorganisms require various micro- and macro-nutrients for energy production and growth. These are obtained from the
Explain the Protease Inhibitors? These are protein in nature and are abundant in raw cereals and legumes, especially soybeans. It would be interesting to note here that since t
Anatomic variability of long buccal nerve demands caution during surgery. Discuss Long buccal nerve, a branch of the mandibular division of trigeminal nerve emerges deep to the
What is a characteristic feature of a carrier protein in a plasma membrane? Carrier proteins are globular proteins which are particular it their action and therefore regulate t
Determine Water-soluble vitamins needs of school children and adolescents? The suggested requirements are given in Table 15.2 (ICMR 1990). Thiamine is computed as 0.5 mg/1000 K
Factors affects Oxygen Dissociation Curve -Organic Phosphate The presence of organic phosphates in the red blood cells helps to explain many peculiarities of the oxygen dissoc
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd