Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Food processing unit operations? Food processing unit operations are involved in the engineering aspects of food processing, packaging and storage. Heating, cooling, dry
What do biomass pyramids represent? The Biomass pyramids represent the sum of the masses of the individuals that participate in each trophic level of a food chain.
Define protein requirements of Preschoolers? For Preschoolers the protein requirements of children of various age groups are computed by the factorial method as employed by FAO
Are environmental phenotypical changes transmitted to the offspring? Changes caused on the phenotypes by the environment are not transmitted to the offspring unless their prima
Of which type of defense cell do viral infections stimulate the multiplication? The major leukocytes that generally multiply and participate in the defense against viral infect
What is Gingival Inflammation Areas of overt inflammation should be identified and the etiology investigated to initiate proper treatment.
Which type Ribosome occurs exclusivley in Mitocondria?
P o i s on i n g P e sticide toxicity Chemical pesticides were introduced as an important tool for pest control and have been used extensively in human health ope
Q. Why is cannibalism an inharmonious intraspecific ecological interaction? In the cannibalism an individual eats other of the same species (occurs in some arachnids and insect
Q. What are some strategies of the anti-retroviral drugs used in the AIDS treatment? The Anti-retroviral drugs used in AIDS treatment try to approach any of the several steps o
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd