Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
diseases of the kidney and their remedies
Estimation of protein by Availability of amino acids include? Regeneration of blood and liver constituents includes Liver protein regeneration Blood protein regener
Define about the Metabolism of Copper? In food, most copper is present as Cu 2+ and some as Cu 1+ . This copper is bound to organic compounds especially protein. Gastric HCI p
What is the most accepted hypothesis about the origin of life on earth? How does it compare to the other main hypotheses? The heterotrophic hypothesis is the strongest and most
Explain the Pregnancy and Obesity? Obesity is associated with increased risk for gestational diabetes, hypertension, pre- eclampsia, perinatal mortality and the need for induce
Results of CABG: In most centres where this operation is routinely conducted the mortality is 1-2 per cent. In high-risk group of patients this may go up to 5 to 10 per cent.
Q. What is signifying when it is said that a virus is in an inactive state? Viruses considered in inactive state are those whose genetic material is within host cells without a
The molecular weight of "Y" is 200. I use 10g of "Y" in 10mL of water. What is the molarity of this solution of "Y"? What percentage solution of "Y" is it?
How is energy used to facilitate information transfer during transcription?
Which of the following are eukaryotic? Bacteria protists fungi animals' archaea plants and animals only all of the choices are eukaryotic.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd