Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Oral rehydration for treatment for pem? Since diarrhoea is very common in severe PEM, correction of dehydration is the first step in the treatment. Homemade (salt-sugar
Explain the Nature of fatty acids present in the triglyceride? Nature of fatty acids present in the triglyceride determines the physico-chemical properties and biological signi
Tetrasporic Embryo Sacs In this group neither of the meiotic divisions is accompanied by wall formation so that at the end of meiosis all the four haploid nuclei remain in a
Gluconeogenesis: When diet is deficient incarbohydrates. Glucose or glycogen is formed from noncarbohydrate compounds principally from certain amino acids and the glycerol of
The heart is enclosed in a membranous sac called the pericardium. It has two layers- the fibrous pericardium which is the outer layer and the serous pericardium that lies inside th
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Determine the stages of healing events The healing events are described in 3 stages Stage 1: Wound healing and formation of woven bone (callus) (2 to 6 weeks) Stage 2: La
The Term "Green House" effect was first introduced by j. Fourier in 1827. The green house effects are the rise in temperature of earth because certain gases in the atmosphere (CO2,
Photosynthesis - Responses of Plants to Stress Photosynthesis is also inhibited due to low water potential in the leaves. The leaf water potential is the sum of turgor pressur
what is radula?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd