Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is Fenugreek seeds? Fenugreek seeds: 'Commonly known as methi seeds in Hindi. They are commonly used in Indian cuisine in chutney and even in pickles and several dishes
sample assignment on tagmatizatio
Accidents Resulting in Death Accidents that cause death are dealt with in a different way. The law requires full compensation to the widow for complete life or until remarriag
wine turns sour beause of the action of which bacteria? aerobic or anerobic?
Neurosecretory Systems Almost all groups of multicellular animals have been investigated to find out if neurosecretory cells are present in them. Such investigations have sho
Functions of Gluconeogenesis The significance of gluconeogenesis include: 1) During starvation or during periods of limited carbohydrate intake, when the levels of liv
chimolithotrophy
If a color blind man marries a woman pure for normal color vision, it's probable that one of the below situations may result. Is it possible that a) All the children would be
Define Criteria for Assessment of Vitamin D Status? You may recall the events involved in calcium homeostasis described earlier in this section. We studied that sufficient 25-O
1) What are some characteristics that define the lifestyle of a parasitic nematode? 2) What are beneficial nematodes? Discuss their significance
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd