Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Is water a polar molecule or non-polar, Q. Is water a non-polar or a polar ...

Q. Is water a non-polar or a polar molecule? What is the consequence of that characteristic for the function of water as solvent? Water is made of two atoms of hydrogen attache

Somatoform disorders, SOMATOFORM DISORDERS: The term 'Neurosis'  was f...

SOMATOFORM DISORDERS: The term 'Neurosis'  was first introduced in 1769 by William Cullen (1710-  1790). Till later part of nineteenth century, anxiety disorders were conspicu

Limiting factors, how temperature acts as limiting factor explain?

how temperature acts as limiting factor explain?

Explain electrocardiography, Explain electrocardiography? What is mean...

Explain electrocardiography? What is meant by P-Q interval and S -T interval in electrocardiography? Mention two medical applications of this method.

Explain the factors affecting gi of foods, Explain the Factors Affecting GI...

Explain the Factors Affecting GI of Foods? A variety of factors affect GI of foods. The factors which affect the rate of glucose absorption from starchy foods and therefore the

Function of adenosine in brain, Q. Function of Adenosine in brain? Aden...

Q. Function of Adenosine in brain? Adenosine has four different receptor subtypes (A1, A2A, A2B and A3). Adenosine A2A receptors are concentrated in striatum. Adenosine recepto

Causes of gastro oesophageal reflux disease, Q. Causes of gastro oesophagea...

Q. Causes of gastro oesophageal reflux disease? GERD may develop due to any of the following reasons: • decreased muscle tone or abnormal relaxation of the LES, • reduced st

Coevolution of plant-herbivores, There has been a perfect coevolution betwe...

There has been a perfect coevolution between plants and herbivorous animals. This has often developed into a mutually beneficial relationship. Whereas the plants have proved to be

Define drug effects on lipid metabolism, Define Drug effects on Lipid Metab...

Define Drug effects on Lipid Metabolism? Drugs can affect the metabolism of various essential nutrients in the body. These impairments are highlighted herewith: Lipid metabo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd