Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
HOMEOS T ASI S - Homeo = same, Stasis = state Living beings maintain their internal environment by self regulating system, it is called homeostasis. Term coined by
Explain the The Lysogenic Cycle in diversity of life? The Lysogenic Life History of Bacteriophage Viruses. Even though viruses are structurally simple, consisting of merely a n
Captive Breeding - Measures for Species Conservation Species which are reduced to dangerous levels need more intensive management, and one strategy is their captive breeding.
What are the chemical substances formed by water photolysis? What is the destination of each of those substances? Free electrons, hydrogen ions and molecular oxygen are liberat
Ask question #Mcharacteristics of xerophytesinimum 100 words accepted#
An ideal EIA system would: (i) Apply to all projects that are expected to have significant environmental effects and address all impacts that are expected to occur due to t
classification mollusca
Blood Pressure Blood pressure may be defined as the force or pressure which the blood exerts on the walls of the artery. Blood pressure varies with the age of the individual. B
Explain assessment of iron status - Serum Ferritin? Serum Ferritin: This method is indicative of iron stores. As we know, a long term negative iron balance first results in dep
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd