Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Simple cuboidal epithelium and columnar epithelium, Q. How different is the...

Q. How different is the simple cuboidal epithelium from the columnar epithelium? Where can these epithelia are found in the human body? The simple cuboidal epithelium is made o

Silver point and silver point removal-endodontics principles, Silver point:...

Silver point: -    Uses of silver point: ease of handing and placement, ductility, radiopacity,and have  some antibacterial activity. -    Lack of acceptable 3D seal of the ca

Cell surface junctions, CELL SURFACE JUNCTIONS (1 )      Desmosomes (...

CELL SURFACE JUNCTIONS (1 )      Desmosomes (Maculae adherence) - Thickened circular areas on P.M. of adjacent cells with radiating fibrils in cytoplasm. These fibrils calle

What is mutualism, Q. What is mutualism? The Mutualism is the ecologica...

Q. What is mutualism? The Mutualism is the ecological interaction in which both participants advantage and that is obligatory for their survival. The Mutualism is a harmonio

Passage of pollen tube, Passage of Pollen Tube In cotton, the pollen p...

Passage of Pollen Tube In cotton, the pollen produces a tube within an hour which grows on the surface of the stigmatic hairs, and then between the cells of the stigma at the

Eye colour, what factor''s do i colour depend on?

what factor''s do i colour depend on?

What would happen to a cell, What would happen to a cell if it was placed i...

What would happen to a cell if it was placed into a hypertonic solution? Into a hypotonic solution? What would happen to a cell if the cell itself was hypertonic to the solution?

Explain the inoculating loops and needles, Explain the Inoculating Loops an...

Explain the Inoculating Loops and Needles? These are most commonly used tools for inoculation. The inoculating loop consists of insulating handle at the end of which inoculatin

Define theory for check the presence of rhodamine b, Define Theory for Chec...

Define Theory for Check the Presence of Rhodamine B? Addition of artificial colours to pulses, spices and tea is not permitted by PFA act. But certain colours, which contain le

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd