Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Why is the Krebs cycle also called the final common pathway of the degradation of organic compounds? The Krebs cycle is known as the final common pathway of the degradation
Explain Mechanism for reduce the absorption of nutrients? The absorption of nutrients is also reduced by mechanisms other than increasing the viscosity of gastrointestinal cont
Lymphatic Vessels The function of lymphatic vessels is to aid in the return of interstitial fluid to intra-vascular volume. They assist with transport of lipids from th
Sickling occurs in deoxyhemoglobin S, but not in oxyhemoglobin S. Oxyhemoglobin has a small hydrophobic \"pocket\" in a ß chain region located in the interior of the protein. In de
Q. How does the universality of the genetic code make the recombinant DNA technology possible? The universality of the genetic code refers to the fact that all living beings ha
Which of the following serves as an actuating signal, or as part of an actuating signal, in a positive feedback system? A. Blood plasma levels of PTH (Parathryroid Hormone).
Goals of Computerization in Nursing Practice Improved Efficiency: Computers can rapidly process, store, and retrieve information, helping the nurse clinician in nursing
Which of the following is true for active hyperemia, a local control mechanism within the circulatory system? A. There will be an increase in force developed by smooth muscles
DNA can be divide into fragments using restriction enzymes. (a) Outline the technique used to separate these fragments. (b) What property of the DNA f
Q. What are the major human diseases caused by virus? Among diseases caused by virus are common cold, variola (considered eradicated nowadays), mumps, measles, rubella, AIDS, t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd