Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Ask questionLIMITATION OF ECOLOGICAL PYRAMIDS #Minimum 100 words accepted#
What is the meaning of term - Plasticity The notion of brain plasticity has been of interest to researchers and clinicians alike for decades. The outcome of injury is the resul
What is the virus that causes flu? Why doesn't the body create permanent immunity against that virus? How does the vaccine against flu work? Flu is a disease caused by the inf
Method for Radiographic evaluation of the outcome or RCT Ørstavik and associates suggest the use of the periapical index (PAI) for radiographic evaluation of the outcome of roo
EYELID S - 3 in number. Dermis is thinnest in it. Upper and lower eye lid with eye lashes. Upper eye lid is more motile In reptiles lower eye lid is more motile. In cycl
Explain the Management Strategies for Adults with Congenital Heart Disease ? The goals for management of congenital heal disease in adults are improving upon the natural histo
Explain Genital herpes Acyclovir (Zovirax, and others), famciclovir (Famvir) or valacyclovir (Valtrex) taken orally for 7-10 days shortens the duration of pain, viral sheddi
Pectin The word pectin is derived from a Greek word which means to "congeal or solidify". Pectin is an acidic structural polysaccharide, found in fruit and vegetables and mainl
definition and explanation of fats
Fish actomyosin Fish actomyosin has been found to be quite labile and easily changed during processing and storage. During frozen storage, the actomyosin becomes progressively
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd