Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What are the causes of constipation, Q. What are the Causes of constipation...

Q. What are the Causes of constipation? The most common causes of constipation are poor elimination habits, a lack of fibre in the diet, insufficient fluid intake, lack of exer

How does the hypophysis-corpus luteum negative feedback work, How does the ...

How does the hypophysis-corpus luteum negative feedback work? What is the name given to the atrophied corpus luteum after this feedback process? After ovulation the estrogen an

Name the proteins used in oteoblast, Name the proteins used in oteoblast ...

Name the proteins used in oteoblast Some of these proteins include fibronectin, thrombospondin, osteopontin and osteoadherin (most of them have RGD cell binding peptide for bin

Explain the pseudomonas - characteristics of bacteria, Explain the Pseudomo...

Explain the Pseudomonas - Characteristics of Bacteria? Pseudomonas are aerobic, gram negative, straight or slightly curved rods that are motile by polar flagella. Many species

Digestive system of an arthropod, how does the digestive system of an arthr...

how does the digestive system of an arthropod operate

The principal nitrogenous excretory in humans, The principal nitrogenous ex...

The principal nitrogenous excretory compound in humans is synthesised: 1. in kidneys but eliminated mostly through liver 2. in kidneys as well as eliminated by kidneys 3.

Blood plasma - circulation, Blood Plasma - Circulation Centrifugation...

Blood Plasma - Circulation Centrifugation of blood results in its separation into two portions - a packed mass of cells which constitute around 45 per cent of the volume of t

Genetic defect in pyruvate dehydrogenase, Genetic Defect in Pyruvate Dehydr...

Genetic Defect in Pyruvate Dehydrogenase A defed in any of  the protein subunits of PDH can result in decrease or complete loss of  activity. Severe cases are usually fatal. Sy

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd