Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Describe Sampling of grains? The quality of the food grains is assessed starting with the process called sampling. A sample of the product to be evaluated is taken and the
Q. Show the list of symptoms? The list of symptoms includes: • Bulky, pale, loose, greasy and foul smelling stools. • Anorexia, feeling of fullness, pain abdomen. The
COMMUNITY If you look around yourself you will notice that populations of plants and animals seldom occur by themselves. The reason for this is quite obvious. In order to survive
Deoxyribonucleic acid (DNA) is the nucleic acid composed of two polynucleotide strands wound around the central axis to form a double helix; the repository of genetic information.
Q. What is the difference between the concepts of genome and karyotype? Genome is the set of DNA molecules that characterizes each species or each living being. The concept the
#q1. If offspring exhibit a 3:1 phenotypic ratio, what are the genotypes of a parent?uestion..
Q. What are the main divisions of white light according to the electromagnetic spectrum? Which are the two mainly efficient colors for photosynthesis? The color divisions of th
Are the phloem and the xylem made of living cells? The cells of phloem are living cells and the cells that constitute the xylem ducts are dead cells killed by the lignin deposi
Is nitrogen is important plant nutrients Nitrogen is an important plant nutrient which is assimilated by most of the plants as nitrate and ammonium ions. Organic matter is the
Q. What are the Classification of Diabetes? Several forms of diabetes have been identified as a result of research and survey conducted world-wide. These forms of diabetes incl
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd