Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Irritability, Irritability If a bright torch of light is flashed acros...

Irritability If a bright torch of light is flashed across your eyes, you close your eyes instinctively. The bright light acts as a stimulus (pl, stimuli) and closing your eyes

Explain biological function, Q. Concerning their biological function what i...

Q. Concerning their biological function what is the difference between meiosis and mitosis? The main biological function of mitosis is cellular multiplication a fundamental pro

The blood go after leaving the left atrium, To which heart chamber does the...

To which heart chamber does the blood go after leaving the left atrium? What is the valve that separates these compartments? The arterial blood that has come from the lungs to

Habitat for the worlds species, Q. Habitat for the worlds species? Natu...

Q. Habitat for the worlds species? Natural ecosystems provide habitat for the world's species. Forests, coral reefs and deep ocean bottoms house many species. Wetlands, through

Significance of the uterine glycogen- producing glands, Q. What is the sign...

Q. What is the significance of the uterine glycogen- producing glands? The uterine glands produce glycogen that able to degrade into glucose to nourish the embryo before the co

Dietary management for short bowel syndrome, Q. Dietary Management for shor...

Q. Dietary Management for short bowel syndrome? It must be evident from the symptoms listed above that the disease results in reduced food intake, impaired absorption and hence

Respiration, what are the organs of respiration in lower forms of animals?

what are the organs of respiration in lower forms of animals?

What is the role of primary consumers, What is the role of primary consumer...

What is the role of primary consumers in a food chain? Give an example of a primary consumer in a terrestrial and an aquatic ecosystem.

Show the peptide found in the brain, Q. Show the Peptide found in the brain...

Q. Show the Peptide found in the brain? There are as many as 300 peptide neurotransmitters found in the brain. Peptide is a short protein consisting of fewer than 100 amino aci

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd