Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Does mitosis properly occur before or after the interphase? Is it a mere "point of view" issue? Mitosis must be considered a succeeding phase after interphase since this
Define nutritional needs During Recovery? Here, let us discuss what should be the nutritional goals based on the physiological aspects involved. Goals: The main emphasis mus
Define Vitamin and mineral supplements for treatment for PEM? All cases of severe PEM require multivitamin preparation to meet the increased demands during recovery. Iron (60 m
Define some Essential facts about the Fats? 1) Fats are essential in diets to facilitate satiety, high-energy intakes, and absorption of fat-soluble vitamins and provide essent
Sporotrichosis Sporotrichosis is subacute or chronic infectious disease caused by a dimorphic fungus, Sporothrix schenkii which occurs commonly in soil, wood and vegetation. T
What is an open circulatory system? Open circulatory system is the one in which blood does not circulate only in blood vessels but it also falls in cavities that irrigate tissu
Caryopsis - Development of Fruit In cereals each carpel has one ovule and therefore the mature fruit has, just one seed. During maturation, very little or no cell divisions ar
Categories of Fats and Oils You already know that fatty acids are the lipid-building blocks. It is customary to divide the fatty acids into different groups, e.g., saturated
Explain Class adverse effects of Protease inhibitors Many protease inhibitors can cause gastrointestinal distress, increased bleeding in hemophiliacs, hyperglycemia, insulin r
Biochemical analysis A basic metabolic panel measures sodium, potassium, chloride, bicarbonate, blood urea nitrogen (BUN), magnesium, creatinine, and glucose. It also sometimes
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd