Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Decomposers - Biotic Components Also known as saprotrophs. Mostly, these are microscopic and are heterotrophic in nature. Decomposer organisms obtain their energy and nutrient
A large number of plants are used for bio-pesticides and bio-fertilizers. Several plant species are used as insecticides against aphids and larvae of insect pests: for insects like
Q. What are Dopaminergic neurons? Dopamine Dopaminergic neurons occur in two closely connected groups: Ventral tegmental area (VTA) of the midbrain and Substantia nigra,(i
sir i''m not understanding cell division rightly. in case of meiosis both paternal and maternal chromosome goes in two cell separately while in case of mitosis they go alongwit
Biochemical Changes Many workers have tried to follow the biochemical changes that precede flowering and result in meristems which give rise to flowers instead of vegetative s
What is sustainability? Sustainability is the ability to meet human needsin a way that will allow a human population to survive indefinitely.
What are the three main types of trophic pyramids studied in Ecology? The three kinds of trophic pyramids studied in Ecology are the numeric pyramid, the biomass pyramid and th
Explain the Criteria for Assessment of Vitamin Status? Vitamin E is assessed by determining the plasma lipid fraction levels. 0.8 mg of total tocopherol/g total plasma lipids i
Advances in Mineral and Vitamin Nutrition of Livestock Even though, minerals and vitamins as nutrients are as essential as energy and protein, general negligence occurs primari
How many grams of sodium dodecyl sulfate (mw = 288.37) would you dissolve in 80 mLs of water to make a 20% solution of SDS?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd