Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Mr. Jones' hypertension has not responded adequately to previous dosage of Lozol. His order is now Lozol 5 mg PO q am. Available is Lozol (indapamide) 1.25 mg scored tablets. How m
Give one example in each case of (a) a fixed joint, (b) a ball and socket joint, (c) a hinge joint. (a) The bones of the skull, the junction of pelvic gi
What is the digestive enzyme that acts within the stomach? Which type of food does it digest? What are the cells that produce that enzyme? The digestive enzyme that acts in the
Pullulan Pullulan is a water soluble edible microbial polysaccharide consisting of Maltotriose units (α 1 → 6), as shown in the figure 2.12. It is produced by yeast Aureobasi
Myasthenia Gravis Myasthenia gravis (severe muscle weakness) is characterised by muscular fatigue in the wake of very little exercise. It may be apparent after a short period o
What is mitosis? What is the importance of mitosis? Mitosis is the process in which one eukaryotic cell separates into two cells identical to the parent cell (generally identic
Seed A seed is a mature ovule enclosing an embryonic plant, stored food material (in endosperm, persistent nucellus or embryo itself) and a seed coat formed by one or two inte
essay on respiratory structures of living organisms
What is Defective Colour Vision Defective colour vision is often called colour blindness. The ability to appreciate one or more of the primary colours is lacking. This can be e
The nucleolus is a small and optically dense region in the interior of the cell nucleus. It is made of ribosomic RNA (rRNA) and proteins. Single nucleus can have one or more nucleo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd