Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Patient after cardiac transplant The major focus of medical and nursing care after transplantation is to prevent early identification of rejection so that appropriate
Q. How is reproduction done in beings of the class Reptilia? These beings reproduce sexually through internal fecundation by means of copulation between female and male individ
#question.why obelia is considered of special interest in zoology.
Describe the term - Near-far problem Signals closer to the receiver are received with less attenuation than signals farther away. Given the lack of complete orthogonality, the
Q. List some points to keep in mind while counselling? 1. Judgment Do not be judgemental. Be a patient listener. Assess and make decision. 2. Patience and Acceptance
What is the life cycle of the hookworms? Adult hookworms within the human intestine release eggs that are eliminated with the human feces. Under adequate conditions of moisture
Q. Explain about types of Insulin? Three types of Insulin is available. The type varies in how quickly it starts working (lowering blood glucose), time of peak activity (when t
ORGA N TRANSPLANT REJECTION - Major histocompatibility complex is responsible for stimulating the rejection of tissue MHC is set of genes that code for cell surface glycopr
Implant insertion The technique for insertion of the implant depends largely upon the system being used. In general, the final bone preparation site diameter is slightly smalle
Define Carbohydrates needs in Postoperative Nutritional Care? Carbohydrates ensure the use of protein for tissue synthesis and energy required for increased metabolic demands.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd