Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
MANAGEMENT OF PAEDIATRIC EMERGENCIES: Let us first discuss why the children are more prone to come across emergency situations. Young children, because of their inten
define stds give 5 examples of stds give signs, symptoms, treatment and prevention of each example
What is the excretory organ of an agama lizard
CIRCUL A T O R Y SYSTEM IN COCKROACH Type is open or lacunar. i.e. b.v. absent. Organs are dipped in haemolymph. 1 . HAEMOLYMPH - Blood and lymph are mixed.
Explain Re- pera at ions and Other Interventions ? These are required for residual VSD with significant shunt, residual RV obstruction and pulmonary valve regurgitation in a fe
Explain the differance between savanna and desert? Savanna : Savanna is characterized by relatively low rainfall and pronounced dry seasons. This type of climate produces a b
Describe Valvar Aortic Stenosis Murmurs ? Characteristic: Harsh, rasping crescendo-decrescendo murmur best heard anywhere in a straight line from right 2nd ICS to apex ("sash"
Procedure of Hormone Act All plant hormones show extraordinary varied complex effects in controlling plant growth and development, Extrapolation from how an animal hormone wor
Q Under which environments do echinoderms live? Echinoderms are marine animals and they live in salt water.
Explain the Coliforms - Microbiological Study of Water? These are widely used indicators which belongs to the family Enterobacteriaceae and make up about 10% of the intestinal
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd