Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Calculation of Maximum Crop Yield Percent It was pointed out previously that 1 Baule of any growth factor is equal in effect on growth to the effect of 1 Baule of any other fa
UNDERS T ANDIN G LIF E - Presence of protoplasm is the important feature of life which acts the site of metabolism. Maintenance of life by protoplasm requires conti
Ask question #Minimum 150 words accepted#
Define Energy Requirement for Cancer Patients? It must be clear to you that cancer imposes increased energy demands because of the hyper-metabolic state of the disease process
where does kreb cycle takes place
Ground Water Ground water represents a major subterranean reservoir of fresh water. In general. it is not tapped by plants as it is too deep and does not suffer from loss due t
Reaction - Processes in Succession This is the most important stage in succession. The mechanism of modification of environment, through the influence of living organisms on i
Phenylketonuria is a severe form of mental retardation caused by a recessive allele. The condition affects about 1 in 25,000 newborn babies. In a population of 250,000 people, how
The permissible use of the technique amniocentesis is for: 1. detecting sex of the unborn foetus 2. artificial insemination 3. transfer of embryo into the uterus of the su
The systems of your body are capable of performing specialized functions that keep you alive and enable you to reproduce. In a very general kind of way, a cell is also capable of p
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd