Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

External factor - factor controlling metamorphosis in insect, External fact...

External factors - Factors Controlling Metamorphosis in Insects In few cases an external factor may be accountable for initiating moulting, as for instance in the blood su

Types of eggs, TYPES OF EGGS Different species of animal has different ...

TYPES OF EGGS Different species of animal has different type of eggs. They are classified on the following basis - 1 .         ON THE BASIS OF AMOUNT OF YOLK On the ba

Carbohydrates requirement in dyslipidemia, Q. Carbohydrates requirement in ...

Q. Carbohydrates requirement in dyslipidemia? As you have already read that carbohydrates provide 4 Kcal/g of energy in our diets. Since we take large amounts of carbohydrates,

Agro industrial-by-products from sugar industry, By-Products from Sugar Ind...

By-Products from Sugar Industry India is one of the important sugarcane (Saccharum officinarum) growing countries of the world. Five main by-products are available from the su

Prevention and cure of botulism involves, Q. Prevention and cure of botulis...

Q. Prevention and cure of botulism involves? The prevention and cure of botulism involves: 1. Strict adherence to safe food-processing practices by the food industry 2.

Explain in brief about the cell membrane, Explain in brief about the Cell M...

Explain in brief about the Cell Membrane All cells, whether prokaryotic or eukaryotic, are bound by a limiting membrane called the cell membrane or the plasma membrane. The ce

Zoology, How does classifying animals based on similarities and traits help...

How does classifying animals based on similarities and traits help future scientists

Protonephridia and metanephridia, Protonephridia and Metanephridia Ne...

Protonephridia and Metanephridia Nephridia take place in two major forms - the protonephridium and metanephridium. Protonephridia are found in flat worms. The protonephridial

What changes is most likely to occur, A 42 year old woman decides to lose w...

A 42 year old woman decides to lose weight on a diet prescribed by an anorexic friend. She loses about 30 pounds in 45 days, but her serum potassium level falls to 2.1 mmol/L (norm

Explain human fetal circulation and the adult circulation, Concerning the m...

Concerning the mixture of arterial with venous blood what is the difference between the human fetal circulation and the adult circulation? In the human fetal circulation there

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd