Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is S shaped incision? The S - shaped incision is indicated where a papilla needs to be developed and was first described by Palacci. This type of incision is essentiall
what is the xternal & internal respiration in frog
Explain the types of foods used in Space? The various types of foods are enumerated herewith. Thennostabilized (T): Heat processed foods ("off-the-shelf' items) in aluminium
Precipitation Precipitation literally means falling from a height. In case of water, precipitation includes all forms in which atmospheric moisture descends to earth; rain, sno
what is the function of nucleus
Q. What do you understand by Chromosome Behaviour? When we study meiosis. we not only observe the regularity of pairing which is important' for' the fertility of the plants, we
PERMANEN T METHOD - 1. Vasectomy in male. 2. Tubectomy in female. 3. Leproscopy is used in tubal ligation , to ligate fallopian tubes.
Explain Procedure for the use of Light Microscope? Now carry out the exercise following the steps enumerated herewith. 1. Place the microscopic slide with any specimen on th
How can the enzymes be classified? Explain giving examples. Based on structure, enzymes can be classified into monomeric enzymes and oligomeric compounds. Monomeric enzym
What is Microtubules? Microtubules are the largest intracellular fibers, with a diameter of about 25 nm (2.5 x 10-8 meters). They consist of hollow fibers composed of a protein
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd