Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
In some protozoans, food is always ingested at the same place on cell surface, cytostome (cell mouth). Undigested food is removed at a cytoproct, or cell anus. All of this is simil
CALCIUM It is the most abundant mineral of animal body. Calcium is available in all types of vegetables, grain, milk, cheese, eggs, fish and butter. By its deficiency r
What are chylomicrons? Yes, so you now know that chylomicrons are basically lipoprotein molecules which are water miscible. They are poured into lymphatic vessels through lacte
How do biodiversity, the total number of living beings and the biomass respectively vary during the ecological succession? Biodiversity, the number of living beings and the bio
Explain the term Direct Calorimetry? Calorimetry refers to the measurement of the amount of heat evolved or absorbed in a chemical reaction, change of state, or formation of a
Criteria for Diagnosis of Respiratory Failure PaO 2 , PaCO 2 , > 50 mm Hg. Vital Capacity Respiration > 30/min or below 8/min.
Define the effect of Zinc Deficiency? Zinc deficiency was identified for the first time in 1940 when malnourished Chinese patients were found to have low concentrations of zinc
what is the economic importance of obelia
Reproduction in coelentrata
Post Operative Anticoagulation : Thromboembolism remains a serious complication after valve replacement. Lifelong anticoagulation is requised for all patients with a prosthetic v
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd