Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is the coelom? To which structures do coeloms give birth? Are all animals coelomate? Coeloms are cavities delimited by mesoderm. Coeloms create the cavities where the inte
By the technology development, the price of computer has become lower and lower. For this reason, a majority of family can afford this technology. A large amount of applications so
Regulation of Senescence Senescence is a part of a developmental sequence of events and has to be a controlled process. You must have seen that if you cut twigs having leaves
Q. Can Nutrition affecting the growth of microorganism? Ans. Food is food to humans and microbes - be it carbohydrates, proteins or fats. The nutritional requirements of b
What is Atrial Switches Operations (Senning or Mustard Operation) ? In transposition of the great arteries there is ventriculo arterial discordance whereby aorta arises from ri
What is human eye Accommodation The human eye focuses at objects at infinity, without exerting any power. This means that when a person is observing an object at infinity, the
Q. Explain Percutaneous Interventions Over the last two decades, significant strides have been made in the field of Balloon Valvuloplasties both in terms of technique as well a
Define Historical example for Dynamical Network? John Tyson constructed a nonlinear differential equation model representing the majority of the network of biochemical pathways
If you create an F2 generation by mating two of the F1 offspring from your cross of a pure-bred brown pig with a pure-bred heavy spotted red pig. Explain why the pigs in your F2 ge
Q. Show the Regulation of blood pressure? Nervous System control of BP Maintains primarily an adequate systemic BP, and alters blood distribution in body to meet specific fu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd