Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Can you define p-waves, Q. Can you define P-Waves? Changes in P-wave mo...

Q. Can you define P-Waves? Changes in P-wave morphology have been well described in resting tracings and are very useful in identifying right and left sided hemodynamic alterat

Determine the food-searching activity, The Svalbard ptarmigan (Lagopus mutu...

The Svalbard ptarmigan (Lagopus mutus hyperboreus) is a small herbivorous bird that lives permanently on the island chain of Svalbard. Svalbard is located in the Arctic Circle, app

Define the term prebiotics, Define the term Prebiotics? Dietary Sources...

Define the term Prebiotics? Dietary Sources and their Mode of Action/health Effects We have already seen how prebiotics are defined. Let us go a little in-depth about them. Pre

Proteins requirements for ulcerative colitis, Q. Proteins requirements for ...

Q. Proteins requirements for ulcerative colitis? Proteins: Patients with ulcerative colitis lose about 4-8 g fecal N2 as compared to the normal excretion of 2 g. In severe ulce

Agro industrial-potassium, Potassium Potassium, the third most abundan...

Potassium Potassium, the third most abundant mineral in the body, is the major cation in intracellular fluid. Forages are excellent source of potassium, usually containing 1 t

What are trophic levels, What are trophic levels? How many trophic levels c...

What are trophic levels? How many trophic levels can a food chain have? The Trophic levels correspond to positions on a food chain. thus producers always belong to the first tr

Define about the population dynamics, Define about the Population Dynamics?...

Define about the Population Dynamics? In this unit, we are going to study about human population who eventually suffer from these problems. Why do we want to study about human

Explain dental care delivery system, Explain Dental Care Delivery System ...

Explain Dental Care Delivery System In the dental care delivery system: there are: patients, insurance payers and dentists For patients: Success = function + esthetics

Respiration, how can i calculate the energy released from burnt peanut

how can i calculate the energy released from burnt peanut

Define larval stage of taenia cystcercus, Define Larval Stage of Taenia Cys...

Define Larval Stage of Taenia Cystcercus? The pork tapeworn (T: solium) and beef tapeworn (T : saginata , which are endoparasites of humans who are the final hosts

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd