Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What are the Benefits of migration Eg: Need to leave Alaska due to harsh weather conditions (statement that birds are escaping NZ winter not acceptable). Longer day
COMMON RESPIRATORY DISORDERS: Respiration is one of the most vital functions of the body. The purpose of respiration is to provide oxygen ta the body cells and to remove exc
What are the kinds of plant geotropisms? Why do the root and the stem present opposite geotropisms? The kinds of geotropisms are the positive geotropism, that in which the plan
Q. Explain about Rheumatic Heart Disease? Rheumatic Heart Disease (RHD) is a very common cause of cardiovascular disorder in children and adolescents in India. This disease inv
Pressure calculation made using the Bernoulli equation may be used in conjunction with pressure measurements made by other modalities to determine various intracardiac pressure.
Explain the Nature of fatty acids present in the triglyceride? Nature of fatty acids present in the triglyceride determines the physico-chemical properties and biological signi
Coiling of garden pea tendrils around any support is an example of: 1. Thigmotaxis 2. Thigmonasty 3. Thigmotropism 4. Thermotaxis Thigmotropism
Describe the respiratory organ in pila
Define the Calcium Toxicity? Elevated blood calcium can occur in association with high parathyroid hormone, hyper- or hypothyroid conditions, bone metastasis, vitamin D toxicit
Define Trauma - Nutrition During Stress? The term "trauma" conies from a Greek word which means "a wound" (and or damage or defect). Trauma is a form of shock to the human body
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd