Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Effects on plants of air pollutants, Effects on plants of Air pollutants ...

Effects on plants of Air pollutants SO 2 , O 3 and NO 2 are strong oxidants and can bring about significant changes in plant cell chemistry. The general effects of pollutant

Define pectin, Pectin The word pectin is derived from a Greek word whic...

Pectin The word pectin is derived from a Greek word which means to "congeal or solidify". Pectin is an acidic structural polysaccharide, found in fruit and vegetables and mainl

Oxidation of succinate to fimarate, Oxidation of  succinate  to  fimarat...

Oxidation of  succinate  to  fimarate:  This reaction is catalyzed  by succinate dehydrogenase and FAD'  is needed as a cofactor. Malonate, structural of succinate, competitively

What is the digestive enzyme that acts within the stomach, What is the dige...

What is the digestive enzyme that acts within the stomach? Which type of food does it digest? What are the cells that produce that enzyme? The digestive enzyme that acts in the

Haccp plan, HACCP  Plan  :  The written document which  is  based upon the...

HACCP  Plan  :  The written document which  is  based upon the principles  of  HACCP  and which delineates  the procedures  to  be  followed.

Protozoa, what are the disadvantages of protozoa

what are the disadvantages of protozoa

Explain changes in mental development of infants, Explain Changes in Mental...

Explain Changes in Mental Development of Infants? There is evidently an increase in the brain size. There is a rapid increase in the number of brain cells in the first 5-6 mont

Water soluble vitamins - b complex vitamins and vitamin c, Define Water sol...

Define Water soluble Vitamins - B complex Vitamins and Vitamin C? Vitamins are essential nutrients found in foods. The requirements are small but they perform specific and vit

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd