Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Causes of Apomixis Apomictic species are generally hybrids or polyploids, as a consequence, there is irregular meiosis. Apomixis appears to be controlled by a set of genes. T
Congenital disorders Poor fertilizing quality of semen could be due to impaired spermatogenesis. When such a condition is due to genetic congenital causes the treatment is not
Define the Requirements of Root-End Filling Materials 1. Seal well 2. Well tolerated by periapical tissues "Biocompatible" 3. Easily inserted "manipulated" 4. Unr
Dosage and cost of micafungin The recommended dosage of micafungin is 50 mg/day for prophylaxis and 150 mg/day for treatment, both given IV as a single dose over 1 hour.
Maxillary sinus : It is a pyramidal shaped large cavity in the body of the maxilla containing many structures of concern during surgery. The sinus is lined by a membrane known
Write a DNA palindrome or inverted repeat of at least 10 nucleotides in length.
Determine the term - Nitrogen Most of nitrogen is available as organic nitrogen which has to be mineralised to inorganic form to become available to plants. Estimation of orga
SOMATOFORM DISORDERS: The term 'Neurosis' was first introduced in 1769 by William Cullen (1710- 1790). Till later part of nineteenth century, anxiety disorders were conspicu
explain the lock and key theory
Explain Complex or Undefined Media? Here, the exact composition of the medium is not known. It contains some complex components of plant and animal extracts whose exact chemica
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd