Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain Microbiological Apparatus and Equipments? It provides an orientation to the various basic equipments, i.e., instruments, tools, glassware and miscellaneous items used i
What is the binding between two amino acids called? The chemical bond among two amino acids is called a peptide bond. Protein Structure Review - Image Diversity: peptide bo
Illustrate about the Principle of Context A third principle guiding the neuropsychological assessment of children is that environment contexts help to constraint and determine
Q. What are the three major renal processes that combined produce urine? Urine is made by the occurrence of three processes in the nephron that are tubular resorption, glomerul
Define Future challenges of management of renewable resources? In response to past shortcomings in a few fisheries management, and to dealing with other conservation goals
Determine the nutritional needs of humans? In the previous unit, we saw how involvement in sport or vigorous activities can affect the body's nutrient needs. In this unit, we w
Impact of changes in diet in the management of diabetes mellitus Changes in diet are an essential component of comprehensive diabetes care and treatment. In this section you w
State the Classification of nervous system Neurological disorders can be categorised according to the primary location affected, the primary type of dysfunction involved, or th
Define the Enzyme deficiency or defects? A food sensitivity or intolerance can occur when the body has difficulty in digesting a particular food and therefore reacts against it
How to reproduction in human.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd