Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Illustrate Dilated cardiomyopathy? It is a disease of unknown etiology, affecting myocardium. Its diagnosis is established by presence of left ventricular dilatation and sys
Gills - Respiratory Organs Gills are the specialised respiratory organs of several aquatic animals. They are found in mollusis and as well in many crustaceans. Typically gills
The calorific value of a fuel can be theoretically determined by using dulong's formula. It is assumed that heat evolved comes from the combustion of carbon, hydrogen, and sulphur
What are the problems that vertebrates required to solve to adapt to the terrestrial environment as they came from the aquatic habitat? How evolution does solve those problems?
how trematodes/nematodes adapt to their parasitic mode of feeding
he recombinant plasmid extracted from the surviving colonies contains a gene called SUC2 that codes for convertase, an enzyme needed to metabolize sucrose. Mutations in the SNF gen
OBJECTION OF CELL THEORY (REASONS OF DISCARTION) (i) Living organism are composed of various types of cells and their product but members of monera & protista don't have
In the previous section we discussed the concept of species in detail and concluded that the concept of biological species and Mayr's definition of species have a wide acceptance a
Explain Red anthocyanin pigments Red anthocyanin pigments from miracle fruit were isolated and tested in carbonated beverages, in combination with the organic acids. Pigments d
Coding sequence is the portion of the gene or the mRNA which actually codes for a protein. Introns are not coding for the sequences; nor are the 5' or 3' untranslated regions (or
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd