Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What are pentoses? To what organic group do pentoses belong? Are nucleotides formed of only one type of pentose? Pentoses are carbohydrates made of five carbons. Deoxyribose is
What are the final digestion products of (a) protein, (b) fat, (c) starch? a) Proteins are digested to amino acids, b) fats are digested to fatty acids and glycerol,
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Q. What is the action mechanism of the antiretroviral drugs known protease inhibitors which are used against HIV infection? Protease inhibitors are some of the antiretroviral d
Which are the main positive ions found in living beings? The major cations found in living beings are the sodium cation (Na+), the potassium cation (K+), the calcium cation (Ca
Which of the following results from the elimination of DNA ligase activity in a cell? A. The oligonucleotide primers will not be removed from the genome - as they often contain
What are the advancement of cnidaria over protozoa
Q. What is the difference between spermatid and spermatocyte II? The spermatids (n) are the products of the second division of meiosis (meiosis II) in the male gametogenesis an
difference between mosaic and regulation egg
characteristic of spider that makes it the phylum arthropoda?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd