Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Animal studies Most toxicological data for risk assessment are derived from the animal studies and it is, therefore, essential that these studies be conducted following widel
Role of Biotic Factors Inducing Senescence Besides environmental and endogenous factors, biotic factors also play a role in inducing senescence. For example, due to an attack
Define Hormonal Responses to Injury? A number of hormonal changes take place in patients following injury. There is a marked rise in the counter regulatory hormones, viz., glu
Procedure for Morphological Characteristics of Yeast Cells? Now carry out the exercise following the steps enumerated herewith: (1) Label the clean, non-greasy slide. Put fe
For an individual having a genotype formed of two different alleles that condition different varieties of the same phenotypical trait, upon what will the phenotypical feature actua
Respiration - Metabolism of Pollen Tubes In the unpollinated pistils of Hippeastrum hybridum very high O 2 , tension exists from stigma down through most of the style. During
What is the main theory opposed to evolution? The major theory that opposes the evolution theory on the explanation of how species emerged (phylogenesis) is fixism.
how nematodes adapt to their mode of feeding
Mitral Valve Repair : Whenever possible, the valve has to be repaired rather than replaced. Preoperative investigations and a TEE done on the operating table will help the surg
What is the MN blood system? What is the pattern of genetic inheritance of the MN blood system? A MN blood system is a third (in addition to the ABO and the Rh) system of blood
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd