Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
write short notes on sex limited traits.
Q. What is packaging? What is packaging? Packaging means a coordinated system of preparation of goods (in this case, foods) for shipment, distribution, storage and
Protection of Plants against Toxic Substances Plants produce several toxic substances themselves and may also encounter the ones produced by other plants or present in the env
Explain the use of Enzyme assay Enzyme assay is also used for research into such processes as the browning of plant products which poses problems during value addition. The br
what is the model of tolerence mpdel of sucession
A saline drip is to be prepared for a lab experiment that is looking at hydration in lab rats. Calculate the amount of NaCl need to make 4 liters of a 0.9% solution.
What is the cost-benefit relationship regarding sewage treatment as a method to fight water pollution? To treat sewage is much cheaper for society. The non treated sewage pollu
Q. Complications of short bowel syndrome? Complications of short bowel syndrome are generally related to malnutrition. What are the complications of malnutrition? A person with
How recombinant DNA Technology can help sustain growing human population?
What is Ridge morphology The implant-supported prosthesis is affected by the ridge morphology especially implant-supported overdentures which gain dual support from implants an
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd