Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
OBSESSIVE COMPULSIVE DISORDER (OCD): OCD is another common neurotic disorder seen in the hospital. Definition Obsessive Compulsive Disorder is the disorder characte
how does sodium and potassium ions maintain the resting petential of neurons
What are the Abnormalities of gaze Normal gaze is when visual axes both eyes are parallel in primary gaze. when visual axes are not parallel in primary gaze, it is abnormal ga
What is Lysosomes? Lysosomes : Animal and fungal cells contain membrane-bound organelles called lysosomes, which are filled with digestive enzymes. These digestive enzyme
what are the two reactants and the two products of a dehydration reaction/ What are the two reactants and products of a hydrolysis reaction
Ecosystem Balance We take up, another parameter of ecosystem balance. One factor that affects the stability or persistence of some ecosystems under small or moderate environme
Polarity in plants
Life cycle of Filarial worm Filariasis : It is popularly known as elephantiasis. It is caused by a nematode parasite, wuchereria bancrofti, and W.Malayi. Parasite : Wucher
Blood Plasma - Circulation Centrifugation of blood results in its separation into two portions - a packed mass of cells which constitute around 45 per cent of the volume of t
XYY humans are fertile males. XXX humans are fertile females. What do these observations reveal about the mechanisms of sex determination and dosage compensation?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd