Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What do you mean by Insect control? The insects can breed and hide in garbage and other places where there is availability of waste materials. The cockroach lives and breed
What are the Sources of Vitamin K? As mentioned above, in plants, the only important molecular 'form of vitamin K is phylloquinone. Phylloquinone is distributed ubiquitously th
Carbon paper leaf prints Cover the vein side of a leaf with a very thin layer of lard or vaseline. Place the greased leaf vein side up on various layers of newspaper and cover
Autoradiography is the process to detect radioactively labeled molecules (which commonly have been separated in an SDS-PAGE or agarose gel) based on their ability to develop an im
Q. What is Osmotic Pressure? Ans. Important characteristic of a cell is 'osmosis'. You would recall reading about osmosis in the Applied Physiology Course in Unit 8. I
Concepts and Definitions in Relation to Nutrient Requirements 1) The probability concept describes the relationship between the levels of intake and the probability of risk of
What is the spontaneous generation hypothesis? The impulsive generation abiogenesis or hypothesys asserts that life on earth has come from nonliving material. For instance, t
CONJUNCTI V A - Ectodermal in origin. Formed by epidermis. It is thin, transparent covers cornea. Made up of stratified epithelium. It has 2 parts - (i) Ocular conjunct
Foods with moderate amounts of protein can be eaten in limited amounts. These foods include grains, bread, pasta, rice, potatoes, corn, and peas. Foods with little or no protein ar
Leukaemia Leukaemia is a malignant disease of blood forming organs of the body that results in uncontroled growth of immature white blood cells. The leukaemic process in t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd