Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Phosphorus Phosphorus has been known as “master mineral” because it is involved in most metabolic processes. Phosphorus, which is stored in bones and teeth, is often discussed
Transposable elements are able to move around the genome by precise or imprecise excision events. What is meant by imprecise excision? A. Imprecise excision refers to a transpo
I need help with my biology virtual lab. Its due tomorrow
Frequency - Synthetic Characters This term refers to the degree of dispersion of individual species in an area, and is usually expressed in terms of percentage. Frequency can
6. What is the function of the myelin sheath? Do all axons present a myelin sheath?
What is adaptive convergence? The Adaptive convergence is the phenomenon by which living beings facing the same environmental pressure (problems) and undergoing genetic variabi
ROLE OF PSYCHIATRIC NURSE: In Blocks 2 and 3 you have learnt about various therapeutic interventions for mental disorders like anxiety neurotic disorders, psychotic disorder
Enzymes work to speed up a chemical reaction by: a. attaching coenzymes to the substrate b. heating up the substrate c. lowering the activation energy of the reaction d. supplyi
Q. What are the most important structures within the cell nucleus? Within the cell nucleus the most important structures are the nucleolus, an optically dense region, spherical
Q. Describe Postpartum Cardiomyopathy? It is defined as presentation of LV Systolic dysfunction and heart failure in last trimester of pregnancy or within 6 months of delivery.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd