Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain the Nerve Cell Structure and Function? Before studying the organization of the nervous system, we will look at the relationship between structure and function of nerve
Define a liquid diet A liquid diet is the one which having of foods that can be served in liquid or strained forms at room temperature. These are usually prescribed after certa
a) A cat has just arrived to the veterinary clinic with low blood pressure. The cat weighs 5 kg, and as the on call Vet you want to use a bag of saline to prepare a dopamine drip f
Define the Recommended Dietary Allowance of Vitamin E? The requirements for the vitamin E are expressed in terms of tocopherol equivalents (TE) as mentioned earlier - 8 mg fo
Q. What is the metagenesis? What are the other names of this procedure? Metagenesis is thekind of life cycle in which there are two different forms of individuals of the same s
Phytoplankton Stage - Hydrarch In this initial stage, the pond water is poor in nutrients and is devoid of much life. At this stage, the water is incapable of supporting large
what are the two main pollutants that contribute to acidic rain?
Q. List five advantages of DSME? Following are the advantages of DSME. It enables the patient to 1. Accept the disease. 2. Gain knowledge about disease, its prevention
Evolution of vertebrates and invertebrates nervous system
Factors Affecting Fertilizer Requirements The rapid increase in the use of fertilizers is based on the fact that large profits are obtained from the money invested in them. The
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd