Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Give Choice of Catheters for Ventriculography? 1) Pigtail Catheter: This catheter developed by Judkins has end hole and side holes. The end hole permits insertion of the c
Define Fats requirements of school children and adolescents? The linoleic acid requirements for school children and adolescents have been set at 3 en%. In terms of visible fats
Define Tests to Measure Flexibility Component in the Humans? The flexibility component measures the elasticity or range of motion around a joint. This component of physical fi
Take the prepared slide of Euglena and focus it first under low power and next under the high power of tlie microscope. Observe tlie following characteristics: i) Euglena is an
How are the three main arthropod classes characterized according to the body division? In crustaceans and arachnids the head is fused with the thorax forming the cephalothorax.
Haem Group A group of compounds called porphyrins are widely distributed in plants, animals and bacteria. Porphyrins associate with metals to form metalloporphyrins which form
Define the role of riboflavin in Drug and lipid metabolism? Flavoproteins catalyze dehydrogenation reactions, as well as, hydroxylations, oxidative decarobxylations, deoxygenat
The heart is supplied exclusively by the right and left coronary arteries. The coronary arteries are functional end arteries. There is no effective anastamosis between right and le
What is the main transformation presented by the glomerular filtrate in comparison to the blood? Glomerular filtrate is the name given to the plasma after it has passed the glo
DNA sequencing is the process of reading the nucleotide bases in a DNA molecule. It includes any technology or method which is used to verify the order of the four bases- guanine,
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd