Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

The right side of the container, A solute passes from higher concentration ...

A solute passes from higher concentration on the left of a container to the right side of container thru a membrane. What would happen if a second solute of lower concentration was

Explain about pantothenic acid, Pantothenic acid (Calcium pantothenate) ...

Pantothenic acid (Calcium pantothenate) Calcium pantothenate is a white, loose, faintly hygroscopic powder without odour and of bitter taste. It is easily soluble in water, gly

What causes acid precipitation, What causes acid precipitation? Acid pr...

What causes acid precipitation? Acid precipitation is the result of air pollutants that combine with water vapor in the atmosphereto form acids, causing precipitation that is m

Explain the management of middle - third perforation, Explain the Managemen...

Explain the Management of Middle - Third Perforation Same to coronal one-third perforation, except defects located more deeper from the access cavity. For successfully

Define the goals of treatment of obesity, Define the Goals of treatment of ...

Define the Goals of treatment of Obesity? As said in the beginning, the goal of treatment of obesity today has shifted from mere 'weight loss' to 'weight management'. Each weig

Define voriconazole, Define Voriconazole It is metabolized in the liver...

Define Voriconazole It is metabolized in the liver by CYP2C19, CYP2C9 and CYP3A4. CYP2C19 is genetically variant (about 3% to 5% of Caucasians and African-Americans and about 1

Indifferences in ionic composition, Indifferences in ionic composition Answ...

Indifferences in ionic composition Answer A. across membranes can be created through the action of ATP driven pumps as long as number of negative and positive ions on remain equal

Management for poisoning and overdose, Management  for Poisoning  and Ove...

Management  for Poisoning  and Overdose: The following data should be obtained at the time of initial contact.  Phone Number:  getting the caller's telephone number  is n

Define categories of indicators of malnutrition, Define Categories of Indic...

Define Categories of Indicators of Malnutrition? The indicators may fall under the following categories: 1. Macro indicators for sector-wide monitoring and evolution, 2.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd