Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
why obelia is considered to be of special interest in zoology ass an animal showing intermediate grade of organisation
What are the structures that form the external ear? What is its function? The internal ear comprises the pinna, or auricle, and the auditory canal. Its function is to conduct t
Is herbivorism a form of predatism? Herbivorism is a type of predatism in which first order consumers feed from producers (plants or algae). For instance, birds and fruits, hum
Q. How do zygote and fecundation formation occur in these plants? Do these processes depend on water? The microsporangia in the male strobile rupture at the right time of the y
Species could be divided into which categories?
Q. Fibre requirements for ulcerative colitis? Fibre: Eliminating roughage seems to have a better effect on preventing relapses of the disease. A low residue diet may be given d
Determine the term Anapsid ? The type of skull found in reptiles and seen today only in turtles. Behind the opening of the orbits the skull is solid and lacks temporal openings
Q. What are the conditions favouring the outbreak of Staphylococcal food poisoning? • Botulism is caused by the bacteria Clostridium botulinum. • All low acid foods can s
Explain Fossn Ovalis Defect (Ostium Secundum Defect) ? This is the most common type of atrial septal defect. The usual approach is through a midline incision and median sterno
Style of Stigma Interaction The style has been distinguished into two types: In open styles a stylar canal is present which is lined with a well-developed glandul
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd