Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is fixism? Fixism is the theory about the diversity of life on earth that affirms that the current existent species were identical to species of the past and came out alre
What might happen to membranes if many -OH groups were added to the tails of phospholipids?
A group working at the University of California, Berkeley has developed "nanothermometers," little nanoparticles that can be injected into cells to measure the temperature in vario
Q. What are the five kingdoms into which living beings are divided? And which group of living being is out of this classification? The five kingdoms of living beings are the ki
ATP-sensitive potassium channel? A. In smooth muscle cells surrounding an arteriole serving a region of the body that has just recently had very high levels of cellular acti
why sporophyte of psilopsida is rootless
Nutrients and the Soil Early experiments on mineral uptake were performed by Hoagland, Stout and Amon in 1923. They showed that minerals were taken up from the soil primarily
Metestrus - Estrous cycle This occurs shortly after ovulation and is intermediate between estrus and diestrus. The period lasts for 10 to 14 hours and mating is usually not perm
Altered Fat Metabolism - Metabolic Response to Injury? The stored fat deposiis are mobilized and oxidized at a high rate in order to support hyper metabolism and increased gluc
What are the Techniques of rastelli operations ? After median sternotomy pericardial patch is harvested and then cardiopulmonary bypass instituted using aortic and bicaval cann
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd