Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define beriefly about the Phytoestrogens? You may be aware of the surging interest in phytoestrogens (PE) especially in connection with osteoporosis. This section briefly discu
Q. How does the heart impel the blood? The heart is a muscular organ that contains chambers right ventricle and right atrium right ventricle and and left atrium through which b
Q. Define the Herbals? During the Middle Ages, following the decline of the Greek and Roman civilisations, little significant botanical progress was made. The early herbals (i.
related words for reproductive isolation.
Q. (a) In droplet infection (i) where do the droplets come from, (ii) what infective agents might they contain? (b) Give two examples of diseases normally spread
How is light from the sun transformed into chemical energy to be used by the living beings on earth? Light from the sun is transmitted into chemical energy contained in organic
E n z y m e - linked immunosorbent assay (ELISA): ELISA in its var io us modifications e.g. plate ELISA, sandwich ELISA, competitive ELISA, ELISA strip or
its characterics
State Cryptobiosis and explain the function of it. A dormant, or suspended, state of animation which allows some animals to survive severe conditions like extremely low tempera
Which are the characteristics and organs of the digestive system of earthworms related to the type of diet of these animals? Earthworms eat decomposing organic material and sma
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd