Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Ask question #Minimum 100 words accepted
What is the difference between essential and natural amino acids? Ans) Significant amino acids are those that the organism is not able to synthesize and that require to be inges
Hypothalamus and Pituitary The most obvious neuroendocrine link is between the hypothalamus and pituitary. The hypothalamus is a part of the brain which is connected to the pi
PHYLUM ARTHROPODA Definition and Introduction Bilateral and protostomial eucoelomate eumetazoa with metamerically segmented and each segment bearing a pair of join
International organization and zoonoses In 1962, the Food and Agriculture Organization and the World Health Organization created the Codex Alimentarius Commission (Codex) to e
What are the main parts of ferns? Ferns are constituted by small roots that come downwards from the rhizome (stem, often orizontalized). The fronds also arise from the rhizome.
The normal flow pattern cross-mitral valve is a tall E wave where is due to early rapid filling and small A-wave which is due to atrial contraction. E/A ratio >1. Pulmonary
Urea molasses mineral block (UMMB) licks Development of urea molasses mineral block licks is another technology being increasingly used in several parts of India and such lick
Explain the Bunsen Burner? It is a type of gas burner that gives very hot flame by allowing air to enter at the base and mix with the gas. It is used - (a) For sterilizing i
State the aim of Neuropsychological assessment Neuropsychological assessments aim at specifying in as much detail as possible the functional deficits that exists in a manner th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd