Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Contraceptive methods The safe and easy methods to prevent pregnancy are called contraceptive methods. i) Contraceptive methods followed by females are : 1) Use of harmon
Morphallaxis - Regeneration This kind of regeneration takes place in plants, sponges and coelenterates such as jelly fishes and hydra. The missing parts are replaced via reorg
Explain Nevirapine and its adverse effects Nevirapine (NVP,Viramune) - Nevirapine is most effective at raising CD4 cell counts and lowering viral load when combined with 2 NRTI
State the Preparation of Patient for GTT 1. You should explain to the patient about the purpose and procedure of the test to be carried out and advise that: a) the patient s
Q. Can Serotonin used in consciousness? Serotonin complements the action of noradrenalin and acetylcholine in promoting wakefulness and cortical responsiveness. Experiments pro
What is the function of the collagen fibers of the connective tissue? There are dissimilar collagen types. The major function of these proteins is to keep the shape and the str
Person X is a healthy human who has volunteered to take experimental drug Y. Person X has a normal dinner at 6 PM on April 1 and then does not eat for 12 hours. At 5 PM on A
Define the term -Aqueous Movement and Outflow There are two movements of the aqueous humour that occur-thermal flow and bulk flow. Thermal flow is, an internal circulation of
Q. Define Thrombospondin Polymorphisms Thrombospondin polymorphisms may present an initial insight into our understanding of the genetic contribution to coronary atherosclerosi
Only during recent years, due to commercialization of agriculture, more emphasis has been given on cash crops, which contribute very little to the animal food. As a result, the liv
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd