Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is the pH inside the stomach? Why is there a need to keep that pH level? How is it maintained? Which are the cells that produce that pH? The normal pH of the gastric ju
What is pollination? What are the main forms of pollination? The process in which pollen grains (the male gametophytes of phanerogamic plants) reach the female gametophyte is k
The Carbohydrate sets are covalently attached to various variant proteins to form glycoproteins. Carbohydrates are a shorter percentage of the weight of glycoproteins than of prote
Q. What are carcinogens? The Carcinogens are factors capable of producing neoplasias and any mutagen, a substance that can induce DNA mutation, is a potential carcinogen. Insta
Categorisation of Neuropsychological Assessment One can divide neuropsychological assessment into two areas: i) Comprehensive and ii) Specialised assessment. Comprehen
Stages of Aerobic Respiration: Glycolysis (cytoplasm) Process 2ATP used for Glucose -> Fructose 1,6 bisphosphate Fructose splits into G3P and DHAP. DHAP
Subsequently many such fossils were known from France, Italy and middle East. All such fossils exhibited reduced brow ridges, steep forehead, high rounded cranial vault, short face
Q. Show the value of embryology? The value of embryology in solving taxonomic problems can be appreciated by studying some specific cases. Amongst the classical examples cited
Effects on Materials - Air pollutants Most air pollutants are reactive chemicals, so they react with most of the substances around. You may recall from your chemistry lessons
Determine Causes of Malnutrition? You may recall studying about the causes of malnutrition earlier. The causes of malnutrition are classified as immediate (individual level), u
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd