Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Specific considerations and applied aspects in dentistry The dental chair and delivery system. The chair should be smooth and seamless. The greatest potential for cross contami
Ecology is a interdisciplinary branch of science that deals with inter relationship between living organism and their environment. The term ecology (from greek, oikos-meaning ho
Determine the prosthetic planning Complete prosthetic planning has to be done and the implants planned accordingly. Thereafter the surgical phase should be carried out. Once th
Explain the PS In VCD in Cyanotic Heart Disease ? These are peculiar to this group only. It occurs in young infants (usually after two months and rarely after two years), It co
Mr. Smith is a 72 year male diagnosed with hypertension. Along with hypertension, Mr. Smith has been diagnosed with right-sided heart failure. The following are his list of medic
Q. Why is the proximity between amino and ribosomes acids important for the protein formation? What is the enzyme that catalyzes that reaction? The proximity between amino and
Explain about the Protein-Energy Ratio (NDP Cal%)? Platt and his colleagues (1961) are largely responsible for the introduction of the ratio of protein energy to total energy (
general charecter
A field trip to observe flowers:- Plan a field trip to view flowers in bloom. If no interesting wildflowers can be found growing near the school, the trip can be planned to a p
what are inorganic species
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd