Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

List a few applications of starches in the food industry, List a few applic...

List a few applications of starches in the food industry. A few applications of starches in the foods industry include thickener, a fat sparing agent, adhesive, binder,

Determine the principle of brain and behaviour, Determine the Principle of ...

Determine the Principle of Brain and Behaviour A second principle is that insight into children's adaptation can be gained through an analysis of brain behaviour relationships.

Described microbiology of air, Q. Described Microbiology of Air? Ans. ...

Q. Described Microbiology of Air? Ans. You would realize that air, by nature, does not contain a natural flora of microorganisms. All that comes into air is by accident and i

What is crossing over, What is crossing over? In which period of meiosis do...

What is crossing over? In which period of meiosis does this event occur? Crossing over is the eventual exchange of chromosomal fragments among homologous chromosomes. The pheno

Define sterol regulatory element binding proteins (srebps), Define Sterol R...

Define Sterol Regulatory Element Binding Proteins (SREBPS)? These belong to a general family of transcription factors. They are synthesized as membrane embedded proteins in res

ANIMAL RESPIRATION, WHAT IS THERE BETWEEN THE TRACHEA OF COCKROACH AND RABB...

WHAT IS THERE BETWEEN THE TRACHEA OF COCKROACH AND RABBIT

What do you meant by medical writing, Question 1 : What do you meant by ...

Question 1 : What do you meant by medical writing? Show various types of medical writing. Define and explain briefly medical writing Discuss various types of medical w

How successful are you at synthesizing genes, How successful are you at syn...

How successful are you at synthesizing genes with really high G/C content? A: We have an extremely low failure rate, which is about one out of five thousand or ten thousand gen

Explain about harvesting autogenous bone grafts, What are the precautions t...

What are the precautions to be taken when harvesting autogenous bone grafts from mandibular symphysis and ramus? When harvesting grafts from the mandibular symphysis region, fo

Excretory system - urinary bladder, URINARY BLADDER - Pear shaped sac l...

URINARY BLADDER - Pear shaped sac like. Situated in pelvic region of abdominal cavity. Ventrally placed. Lined by transitional epithelum. Detrusor muscle i.e. to expell out

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd