Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
How does caffeine effect plant growth? Minerals like potassium are often found alongside caffeine when it happens in plant sources like coffee beans, and that could help the pl
State the concept of type locus interaction Some of the major contributions included the concept of type locus interaction, the analysis of quantitative as opposed to qualitati
Oligosaccharides are short chains of monosaccharides linked together by glycosidic bonds. In case of oligosaccharides linked to proteins (glycoproteins) or lipids (glycolipids) o
Determine sequence weights for the sequences ACTA, ACTT, CGTT, and AGAT in problem 1 by using Thompson, Higgins, and Gibson method a) compute pairwise distances between sequences
What in Genetics is hybridization? The Hybridization in Genetics is the crossing of individuals from "pure" and different lineages in relation to a given trait that is the cros
Describe about the Primary Prevention - Food Allergy? Let us further, dwell on measures we could adopt in primary, secondary and tertiary prevention. Current research in primar
The measurement of blood sugar is of prime importance in the diagnosis and monitoring of patients with diabetes. You can refer sub-section 1.5.2 of Unit 1 to review about Glucose T
Reptiles Heart is incomplete 4 chambered, ventricles are not divided completely 2 auricels & 2 ventricles. Sinus venosus present, Truncus artiorsus absent [In lizzard fo
Q. What are the cells that produce the myelin sheath? Of which substance is the myelin sheath formed? In the central nervous system (CNS) the myelin sheath is made by appositio
describe five features of chromosomes used in cytogenetic analysis?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd