Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain Enzymes Enzymes are the proteins that act as catalysts, speeding the rate at which biochemical reactions proceed but not altering the direction or nature of th
Q. What is the path followed by the energy absorbed by plants to be used in photosynthesis? The energy source of photosynthesis is the sun, the central and unique star of our p
What is the role of heart in human body? The heart is the main pump that circulates the blood and fluid within the body. The heart, beats at 72 times per minute, and pumps abou
Define Dietary Management of Cancer Patients and Feeding Problems Related To Cancer Therapy? We took an overview about the general nutritional requirements of cancer patients.
Determination of Nicotinic acid The chemical methods of assay are based on colour reactions of pyridine. Nicotinic acid and nicotinamide are converted by cyanogen bromide into
how much classification of protozoa
Q. What is cross contamination? Cross contamination is the passage of micro-organisms from one person to another via any route direct or indirect.
Iron deficiency should be treated with supplemental iron. • Osteoporosis should be treated with calcium and vitamin D supplements. • Depending on individual factors, patien
Pollen Tube Structure The pollen tube in the stigma is filled with cytoplasm containing numerous mitochondria and dictyosomes. The number of dictyosome cisternae is reduced i
Heterochromatin: Compact, gene-poor areas of a genome, which are enriched in the simple sequence repeats. As it may be impossible to clone, heterochromatin is generally ignored wh
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd