Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Recovery of tar: the coke oven gas coming out from ovens is passed through a tower where liquid ammonia is sprayed. The tar and dust are removed and then recovered. Recover of
What is the tympanum? In which part of the ear is it located and what is its function? The tympanum (or ear drum) is a membrane located in the middle ear just after the auditor
Emulsions You may have eaten Mayonnaise. Some of you may also know how it is made. Mayonnaise is a liquid in liquid dispersion, in fact a true emulsion. A true emulsion re
Wetlands and estuaries are transitional biomes. Land that remains flooded either part of the year or permanently with fresh or salt water is known as wetland. The internationally a
TESTE S (TESTICLES) - 2 in number (Diarchic). Pinkish in colour. Oval shaped. 4-5 cms long, 2.5 cm wide and 3 cm thick. Mesodermal. In embryonic stage attached to kid
Q. What are the classes of lipoproteins in the blood? Blood lipids (cholesterol, triglycerides and phospholipids) being insoluble in blood need a ship to travel in our body; it
How many asymmetric carbons are there in ribose and glucose?
Define Methods for determining pH? There are two general methods for determining pH of a solution. One is the colorimetric method and the other most common method is the use of
What is cellulose? Cellulose is a long-chain polymeric polysaccharide carbohydrate, of beta-glucose. It creates the primary structural component of green plants. The primary ce
Explain the Chemotherapeautic rinses Chemotherapeautic rinses: The use of 0.12 per cent chlorhexidine has been proven to be of therapeutic significance in maintaining period
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd