Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Nutritional effects Of Hemicelluloses Hemicelluloses are classified under the category of soluble dietary fibers. Hemicellulose is an indigestible complex carbohydrate that ab
Osmoregulation in Marine Non-Chordate Metazoans Studies on the osmotic pressure of body fluids of marine organisms have displayed that their internal osmotic pressure is more
HEARIN G - Sound waves struck ear drum, it starts vibrations, these vibrations are carried to MIS → f. ovalis → S. vestibule → Hellicotrema → S. Tympani → f. rotundus → mi
What are the major features of the meristematic cells? And why do these cells need to have a high mitotic rate? The Meristematic cells have very thin cell walls, a well-central
A solid compound was found to contain 42.11% C, 51.46%O and 6.43% H by weight. The molecular weight of the compound was 341. What is the molecular formula of the compound?
Coiling of garden pea tendrils around any support is an example of: 1. Thigmotaxis 2. Thigmonasty 3. Thigmotropism 4. Thermotaxis Thigmotropism
How does circulatory system works in cockroach?
Do moulds grow better where it is warm or cold? This time put single culture dish in a warm dark place and the other in a cold dark place. Study the dishes after a some days.
Q. Of which type of defense cell do worm infections stimulate the multiplication? The main leukocytes that generally participate and multiply in the defense against worm infect
why succession more likely to occur on valley floor than steep slopes
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd