Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

How does biological diversity relate to the characteristics, How does biolo...

How does biological diversity relate to the characteristics of the abiotic factors of an ecosystem? The availability of abiotic factors as light, moisture, mineral salts, heat

Describe polio, In 1954, Public Health Service organized an experiment in t...

In 1954, Public Health Service organized an experiment in that nearly 2 million children in grades 1, 2 and 3 participated. Experiment was to test a vaccine. Name the disease c

Human eye, Who first discovered eye anatomy?

Who first discovered eye anatomy?

Define about the ultraviolet rays - carcinogenic, Define about the Ultravio...

Define about the Ultraviolet rays - carcinogenic? Ultraviolet rays: There is ample evidence from epidemiological studies that ultra violet rays derived from the sun induce an i

Condition type of change to be transmitted to the offspring, What are the s...

What are the situations in which the environment can alter the genotype of an individual? What is the condition for this type of change to be transmitted to the offspring? The

What will be the final volume, Suppose a sample of 200 microliters of blood...

Suppose a sample of 200 microliters of blood needs to be diluted 1/50. How much diluents should be added and what will be the final volume? Show all steps.

Respiration in annelids, Describe the different types of respiratory organs...

Describe the different types of respiratory organs found in annelids.

How to suppose the resistance across the chest, The human body can exhibit ...

The human body can exhibit a wide range of resistances to current depending on the path of the current, contact area, and sweatiness of the skin. Suppose the resistance across the

Enumerate the anatomic consequences of edentulism, Q. Enumerate the anatomi...

Q. Enumerate the anatomic consequences of edentulism? The anatomic consequences of edentulism include the effect of edentulism on bone and soft tissues. Basal bone forms the de

Explain control function of organic molecules, What are some examples of th...

What are some examples of the control and informative function of organic molecules? Based on genetic information, organic molecules control the whole work of the cell. The nuc

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd