Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
could you please give me a data in the form of tabular column based on milk analysis which can be done in home itself?
Subphylum Chelicerata. Six pairs of appendages, four pairs being legs, with paired chelicerae (fangs). There are three classes in this phylum.
Importance of Forests - Fuel Wood The forests are renewable resources which provide us a wide variety of commodities. For man, forests have been a source of recreation and the
Q. What are the three main parts of a eukaryotic cell? The eukaryotic cell can be separated into two major portions: the cell membrane that separates the intracellular space fr
BACK CROSS When F 1 individual (Tt) is crossed with one of the two parents, either tall (TT) or dwarf (tt), such a cross is called the back cross. There are two possibilities
the appendages of arthropods; a. may serve as walking legs, b. may be modified into atennae, c. may be modified into large pincers, or d. all of the above
List out the Different Preservation Techniques? The different preservation techniques commonly used today are given in the Table. Table: Methods of food preservation a)
If dimples may be considered a single-gene dominant trait, and 64% of the population features dimples, calculate the frequencies of heterozygotes and both types of homozygotes, ass
Surgery and Prosthetic Phase Implants are uncovered Impression recorded Abutment placed Provisional prosthesis followed by Definitive prosthesis
Q. How is it structurally explained that the motor activity of the left side of the body is controlled by the right cerebral hemisphere and the motor activity of the right side of
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd