Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
nissles granule found in
Darwin put fort the notion of the survival of the fittest. How do we define 'fittest'? The answer usually given is those who survive. So you can readily see that this is a circular
Q. Do the membranes form only the outer wrapping of cells? Lipid membranes do not form only the outer cover of cells. Cell organelles, such as the Golgi complex, lysosomes, chl
why mung beans has no endosperm while castor bean and maize seed has?
What is the most excellent identification hypothesis for a plant tissue seen under the microscope having most cells undergoing cell division? The most excellent hypothesis is t
Which of the following serves as an actuating signal, or as part of an actuating signal, in a system with feedback? (Either positive feedback or negative feedback) A. Blood pla
The role of ATP hydrolysis in actin polymerization is similar to the role of GTP hydrolysis in tubulin polymerization: both serve to weaken the bounds in the polymer and thereby pr
How plants control the opening and the closing of the stomata? The closing and the opening of the stomata depend upon the necessity of the plant to lose water and heat through
Flower - Plant Growth Substances Floral initiation is a dramatic event involving a total changeover of the character and developmental pattern of the meristem. The stimulus ca
Q. What is the difference between rough and smooth endoplasmic reticulum? The endoplasmic reticulum is a delicate membranous structure contiguous to the nuclear membrane as wel
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd