Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define the HTST Pasteurization Method? Rapid, high pasteurization is characterized by a pasteurization time in the order of seconds and temperatures of about 85° to 90°C or mor
Reptiles Heart is incomplete 4 chambered, ventricles are not divided completely 2 auricels & 2 ventricles. Sinus venosus present, Truncus artiorsus absent [In lizzard fo
Structure of the Sperm The spermatozoa in different animal groups display a wide variety of shapes and sizes but all share a. basic morphological plan. The sperm in most anim
Radiology is a medical specialty that employs the use of imaging to both diagnose and treat disease visualised within the human body. Radiologists use an array of imaging technolog
Blood from a donor is sterile and stored in a sealed bag, but it is still kept at 4°C. What is the advantage of keeping it at this low temperature? At 4 °C, enzyme activi
What are some examples of interspecific competition? Examples of interspecific competition are: the dispute between vultures, worms, flies and microorganisms for carrion and th
Q. Economic aspect of biodiversity? Biodiversity serves as an income generating activity for countries around the world. Many people visit forests, beaches, mountains, grasslan
Insects - Hormones in Growth and Reproduction In insects hormones regulate moulting and metamorphosis. The larvae or nymphs which hatch out of the eggs undergo regular moultin
Explain Chronic Infections Fever Chronic Infections Fever: These are generally of longer and sustained duration. The patients have a past history of repeated episodes or con
Indications 1) Symptomatic patient with normal LV function (ejection fraction 2 0.5 at rest). If they are in class In or IV NYHA, surgery is recommended. In this group of pat
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd