Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Which of the following is a false statement regarding the method of recombination or crossing-over? A. Crossing-over takes place during prophase I of meiosis B. Recombinatio
Define cause of vitamin a deficiency - Infections? During acute infections, vitamin A intake in preschool children is reduced due to impaired appetite and impaired vitamin A ab
Normal 0 false false false EN-IN X-NONE X-NONE
Q. Define the Risk reduction in cardiovascular disease? Ans. Weight loss by caloric restriction diets has been shown to decrease plasma CRP levels. Additional data indicat
how does cockroach respire
# ???? ..
Occupational Lung Diseases The common occupational lung diseases include silicosis due to inhalation of inorganic dust, allergic alveolitis due to inhalation of organic dus
State the definition of soil The definition of soil has changed a great deal from a thin "outer layer of Earth's crust" to "a collection of natural bodies on the surface of th
how much classification of protozoa
ENDOPLASMIC RETICULUM (ER) Eucaryotic celIs have two major compartments- nucleus and cytoplasm. Cytoplasm was known to have no structure until the discovery of electron micrsscop
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd