Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Ancestral Unicellular Organism So far in this unit we have considered the characteristic of body designs that are shared by various animals and the different body plans that d
Q. What is the etiological agent of amebiasis? How it transmitted and what are the typical manifestations of the disease? The Amebiasis is caused by the protozoan Entamoeba his
What is the purpose of DNA? Actually, DNA makes you who you are. It has all your heredity info, like your hair color, your personality, etc. No two person's DNA is the similar,
Q. Describe Cultural Characteristics of Microorganisms? Bacterial growth in and on foods often is extensive enough to make the food unattractive in appearance or otherwise obj
Explain Cardiac Muscle or heart muscle? Cardiac muscle, or heart muscle, is a striated muscle that occurs only in the vertebrate heart. The heartbeat is controlled by noncontr
Describe the important factors of Hand washing Hand washing is an important practice to follow before doing any procedure for the patient. The infection can be transferred
Avian (fowl cholera) Fowl cholera is a contagious septicaemic disease of almost all classes of fowl. The causal agent is Pasteurella multocida.Serotypes A:1 and A:3 are usually
Define Clinical Manifestations and Nutritional Problems Associated with Cancer? In the previous section we learnt that cancer results in several changes in the metabolism of ca
what is biology
Significant proportion of starch in the normal diet A significant proportion of starch in the normal diet escapes degradation in the stomach and small intestine and is labeled
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd