Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
WHAT IS THE FUNCTION OF CELL COAT
How can asexual reproduction in planarias be described? Planarias can separate themselves asexually by transversal bipartition because of the great regeneration capability of t
Q. Why is meiosis significant for the maintenance of the normal quantity of chromosomes of a species with sexual reproduction? A reduction to a half of the maximum normal quant
Manifestations of anemia that are directly due to the diminished oxygen-carrying capacity of hemoglobin include: Answer A. pale skin. B. bleeding. C. bone pain. D. fatigue.
Q. What are the major features of fishes associated to the habitat where they live? Fishes are all aquatic animals and thus they have a hydrodynamic elongated body appropriate
What is the other name given to sex chromosomes? Sex chromosomes are also known as allosomes (the other chromosomes that are not sex chromosomes are known as autosomes).
Explain briefly how computed tomography (CT) helps the doctors in pinpointing the defects in the patient's body
Treatment and Management Diagnosis History, physical examination Radiological examination chest X-ray Sputum studies, CIS, smear, ABG analysis-restin
Explain about the Vitamin A? Vitamin A, one of the fat soluble vitamins, refers to a sub-group of retinoid that possess the biological activity of all-trans-retinol. The term '
What is a community? What is the difference between the concepts of community and population? A community is a set of the populations of living beings that live in the same reg
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd