Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Anemophily - Cross-pollination It is also commonly referred to as wind pollination, i.e., the pollen grains are carried through wind currents. To ensure good pollination t
Explain about the Enteral feeding in elderly? Enteral, as you may already be aware, is defined as provision of nutrition support through the GI tract or by accessing the gut. Th
i want notes for respiration in humans full qand to the point si i can learn them
Enzymes utilization in Brewing Industry Here, the main starting material is malt, produced by allowing barley seeds to germinate under moist conditions. The reserve starch is b
Failure to organize proper adjusting entries causes net income and the balance sheet to be in error. Using Micro Train Company as an instance this section has discussed and illustr
How do the repairing enzymes of the genetic system act? There are enzymes within the cells that detect errors or alterations in DNA molecules and start a repair of those errors
Organ level -Level of body organization When organs work together to perform a specific function we have the highest level of body organization i.e. the organ system level of bo
Explain the soft diet The soft diet provides soft whole food that is lightly seasoned and moderately low in fibre. The foods have a soft texture and are easy to digest. Smal
Q. What are the major parts of ferns? Ferns are constituted by small roots that come downwards from the rhizome stem and often horizontalized. The fronds also arise from the rh
Define Anaerobic Exercise or Energy System? Thus, exercises which are done for short bursts of time lasting only for few seconds (less than 120 sec) use only anaerobic system o
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd