Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define about the Paracellular Route - Calcium? It involves passive Ca transport through the tight junctions between mucosal cells. The salient features include: It is in
Explain root pressure? How can you demonstrate it experimentally? What is the cytological basis of Down's syndrome? Give two physical symptoms of this disorder. Describe why the
Osmoregulation in Aqueous Environments You are aware that the aqueous environments are of two types: i) Freshwater and ii) Seawater. The osmotic concentration of thes
How is reproduction done in beings of the class Reptilia? These beings reproduce sexually by internal fecundation by means of copulation among male and female individuals. They
1. You have two bags of polymer. Bag A has 10 kgs of polymer with weight average molecular weight of 336.6 kg and Bag B has 20kg of polymer with weight average molecular weight 39
Non Migrainous Vascular Headaches This headache associated with dilation of the cranial arteries and can be induced by a wide variety of diseases and conditions. The most commo
Classification Scheme of Protozoa Phylum Myxozoa Parasites of lower vertebrates especially fish and invertebrates. Phylum Microspora Parasites of inv
If baroreceptors are primed to detect blood pressure changes and compensate for them, how is it that some patients suffer from chronic hypertension?
Define Methods of Estimation of Energy Expenditure and Requirements? There are a variety of methods available to measure human energy expenditure. Knowledge of these methods wi
Mechanisms that Affect the Heart Rate Two different mechanisms affect the heart rate. Nerve impulse to the pacemaker region and hormonal influences. A branch of the vagues ner
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd