Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Joint, Ask question #Minimum 100 words what is joint accepted#

Ask question #Minimum 100 words what is joint accepted#

Explain the obligatory losses of nutrients, Explain the Obligatory Losses o...

Explain the Obligatory Losses of Nutrients? Obligatory losses of nutrient are defined as 'the losses that occur when an individual is put on a diet free of that nutrient'. For

Describe the stages of atherosclerosis, Describe the Stages of Atherosclero...

Describe the Stages of Atherosclerosis ? The process of atherosclerosis which gives rise to CAD marches in stages. The earliest recognizable pathologic lesions are the fatty st

Benefits of cross-pollination, Benefits of Cross-Pollination Because o...

Benefits of Cross-Pollination Because of the specific benefits of cross-pollination, flowering plants have evolved many devices to prevent self-pollination and to encourage cr

A decrease in blood plasma levels of parathyroid hormone, A decrease in blo...

A decrease in blood plasma levels of parathyroid hormone A. occurs in response to an increase in the levels of calcium ions in blood plasma. B. leads to an increase in the a

Amphibian circulation be classified as incomplete and double, Q. Why can th...

Q. Why can the amphibian circulation be classified as incomplete and double? The amphibian circulation is double because it is composed of pulmonary and systemic circulations r

Determine the enzymatic chemical reactions, How does facilitated diffusion ...

How does facilitated diffusion present similarities with enzymatic chemical reactions? One of the main examples of facilitated transport is the entrance of glucose from the blo

Explain eutrophication, Eutrophication "Runaway" growth of the aquatic pla...

Eutrophication "Runaway" growth of the aquatic plants which takes place when agricultural fertilizers containing the phosphorus and nitrogen run off into lakes and ponds; also ult

How are roots affected by water, How are roots affected by water? Grow ...

How are roots affected by water? Grow some seedlings in single end of a glass dish or pan. When they are about 5 cm tall start watering them on one side only and a little dista

Zoology, what does ICZN stand for

what does ICZN stand for

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd