Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
how ionosinic pathway ric acid from ammonia forms u
Similar to all animal cells, protozoans are covered by a plasma membrane which surrounds cytoplasm of the cell, protozoan's integument or skin. Like all membranes, it's permeable;
What are the chemical substances that compose the plasma membrane? Ans) The major constituents of the plasma membrane are phospholipids, proteins and carbohydrates. The phosphol
To which heart chamber does the blood go after leaving the left atrium? What is the valve that separates these compartments? The arterial blood that has come from the lungs to
What is Osseointegration Osseointegration was the hallmark of success in implant dentistry in the 1980s. It was believed that an implant was successfully integrated when there
Is there anything I can do to keep my brain healthy in older age? It is increasingly clear that how we live our lives on a daily basis strongly influences how well our brain ag
Define Distribution of Food Products - Public Nutrition? We learnt earlier that we have buffer stocks of food grains in our country. These stocks do help to combat acute transi
GIVE ADETAILED ACCOUNT OF THE VARIETY OF FUNCTIONS PERFORMED BY THE LIVER
Ringworm in humans is caused by : 1. Bacteria 2. Fungi 3. Nematodes 4. Viruses Fungi
Phenolic compounds Gossypol: Gossypol is a toxic compound found in the cotton plant. It is concentrated in the cottonseed but can also be found in other parts of the cotton
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd