Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
tell me best topic related to botany
Define Bioactive Substances from Protein Foods? Bioactive substances are derived from living organisms that can be used by humans for a variety of applications. They are consti
Does RNA molecule have two polynucleotide chains like DNA? Only DNA has two polynucleotide chains. RNA is produced by just one polynucleotide chain. Nucleic Acid Review - Im
there are a restriction map of a plasmid and a human gene of known sequence. Your task is to clone the human liver cDNA for this gene so that the start codon is closer to the EcoRI
PHASES OF NURSE-PATIENT RELATIONSHIP: Kapoor, Bimla (1994) has listed four phases of nurse patient relationship which are explained below while describing the phases she has
What are the possible sources of human embryonic stem cells? Embryonic stem cells can be derived from individual cells of an early embryo, from blood cells in the umbilical co
Structure-activity relationships Structure-activity relationships may be useful to increase the weight-of-evidence or human health hazards identification. Where classes of comp
To study the structure of a seed Soak seeds of bean, pea, pumpkin, sunflower, corn and other large forms. Take away the seed- coats and carefully cut the seeds open. Discover t
Q. What are the common contraindications of the contraceptive pills? There are medical reports associating the use of contraceptive pills with vomiting, headaches, vertigo, nau
PHYLUM PLATYHELMINTHES Definition and Introduction Bilateral and protostominal organ grade eumetazoans without a body cavity ( acoelomates) platyhelminthes means fl
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd