Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
How to improve the Quality of Protein in the Diet? Since the net protein utilization (NPU) values of milk or egg proteins are higher than those of proteins of average diets con
Dinitrophenol, DNP, was prescribed in low doses in the 1940's to help obese patients lose weight. It's use for this purpose was discontinued when several users died. DNP makes the
Canine distemper Canine distemper, a highly contagious disease of dogs, is caused primarily by air- borne virus which belongs to the genus Morbillivirus in family Paramyxoviri
Assessment The child with wilm's tumour will present you with a large mass in the loin or an enlarging abdomen. This mass may be noticed accidently by the parent of the chi
Q. What is Dyslipidemia or Hyperlipidemia? It has been known for over five decades now that dyslipidemia is associated with increased severity and prevalence of atherosclerosis
Define Fluids requirement to avoid underweight problem? Take fluids only after a meal instead of with or before meals so that food intake is not reduced. High calorie nourishin
is a wheat plant a eustele or a siphonostele or a protostele?
Variability refers to the differences in heritable traits exhibited by the individuals of a species. One of the major contributions of Darwin to the study of evolution was his book
Define Trauma - Nutrition During Stress? The term "trauma" conies from a Greek word which means "a wound" (and or damage or defect). Trauma is a form of shock to the human body
Digestive system is one of eleven major body organ systems in animals; it converts food from the external environment into the nutrient molecules which can be used and stored by t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd