Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Thermodynamics and Cell Shapes Why are protoplasts (cells devoid of cell wall) spherical? Why are most of the unicellular organisms (prokaryotes and eukaryotes) spherical? A s
Septa prevent oxygenated and deoxygenated blood. Give reason
Illustrate the types of Bone Remodeling Bone remodeling occurs on existing bone surfaces. However, unlike modeling, remodeling cannot cause large changes in bone structure at a
Q. How does the contraceptive diaphragm work? What are the limitations of this contraceptive method? The contraceptive diaphragm is an artifact made of plastic or latex that wh
Since erythrocytes red blood cells do not hold any sub cellular organelles they are essentially a membranous sac for carrying haemoglobin their plasma membrane is a convenien
Which are the specialized conductive tissues of the plants? The vascular tissues of the plants are the xylem and the phloem. Xylem is the plant tissue that forms the vessels t
Q. What is the DNA vaccine? The DNA vaccination or is a vaccination technology based on genetic engineering. In DNA vaccine a recombinant plasmid (vector) containing the gene o
Define the word solute A solution is a homogenous mixture of two or more different substances. For instance salt in water form a solution. This means that the dissolved subs
In genetic recombination by crossing over what is the difference between parental gametes and recombinant gametes? Parental gametes are those gametes that keep the original lin
what is the advantage of being dark skinned?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd