Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Why photosynthetic prokaryotes appeared before more, Why is it more probabl...

Why is it more probable that the photosynthetic prokaryotes appeared before the aerobic eukaryotes? It is more feasible that photosynthetic prokaryotes appeared before the aero

Vitamin d, defitionce of vitamin d

defitionce of vitamin d

How is sound vibration captured by the tympanum, Q. How is the sound vibrat...

Q. How is the sound vibration captured by the tympanum transmitted through the ossicular chain of the middle ear? The acoustic transmission from the middle to the external ear

Aids, how get a aids

how get a aids

What is tricuspid valve annuloplasty, Q. What is Tricuspid valve annuloplas...

Q. What is Tricuspid valve annuloplasty? It depends upon the cause of tricuspid regurgitation. Specific therapy is directed towards the particular cause of pulmonary artery hyp

Cow-pox (vaccinia), C o w - po x (vaccinia) E p ide...

C o w - po x (vaccinia) E p idemiology: This infection, although mostly occurring in cows, sometimes also occurs in buffaloes. Under natural conditions, t

Ross operation-surgical techniques, Ross Operation :  In this technic...

Ross Operation :  In this technically demanding operation, the aortic valve is replaced by patient's own pulmonary valve (autograft) and a pulmonary or aortic allograft (homo

What do all organic compounds contain, What do all organic compounds contai...

What do all organic compounds contain? The key element is carbon. Organic compounds are all carbon-having compounds. By definition, an organic compound having carbon. Alt

What is sanning membrane proteins, Which of the following is true for the f...

Which of the following is true for the following spanning membrane proteins? A. The mAChR (muscarinic Acetylcholine Receptor) is a spanning membrane protein located in the memb

Illustrate about the metabolic waste products in the cornea, Illustrate abo...

Illustrate about the metabolic waste products in the cornea? Metabolic Waste Products During the metabolism various waste products including lactic acid, protein an

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd