Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is the carbon cycle? The carbon cycle represents the recycling and circulation of the chemical element carbon in nature as a result of the action of living beings. T
What are biopolymers? Polymers are macromolecules made by the union of various smaller identical molecules, called monomers. Biopolymers are polymers present in the living bei
#question.unique features of amoeba.
State the basic properties of Cell The differences of cell types notwithstanding, the similarities among them are more profound. Actually, all cells possess the same basic prop
Q. Descriptions of the genera? A manual is a book that contains information on the area of coverage and keys and descriptions of the families, genera and species including the
Determine the tenant of the Cell Theory Which of the following is not a tenant of the Cell Theory as postulated by Mathias Schleiden and Theodor Schwann? A. All organisms a
Nursing Process Nursing Assessment Health history-Past-valvular, congenital or syphilitic cardiac disease/cardiac surgery. Habits-IV drug abuse. Assess the signs an
Explain about the Fat metabolism - Ageing? With increasing age, the blood cholesterol and blood triglyceride levels gradually increase. Certain factors like the kind and amoun
classification
Chelating agents Oxalates: Only a few plants contain sufficient amounts of sodium and potassium oxalate to be considered toxic. Moreover, ruminants that consume these plants
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd