Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is hemoglobin? What is the inorganic element that is fundamental in the composition of hemoglobin? Hemoglobin is the protein present in the blood responsible for the trans
What are the Abnormalities of gaze Normal gaze is when visual axes both eyes are parallel in primary gaze. when visual axes are not parallel in primary gaze, it is abnormal ga
Define Type of Instruments used in Spectral Techniques? A wide range of instruments are available, possessing a combination of features but there is no rigid classification of
Precautions for Preparation of Selective and Differential Medium 1. Dissolve ingredients one by one. 2. Check and set the medium to appropriate pH. 3. Autoclave the mediu
what is life span
What are pleura, pericardium and peritoneum? Pleura are the membrane that hides the lungs and the inner wall of the chest; pericardium is the membrane that hides the heart; per
Glycogenesis : This is an anabolic process in which glucose is polymerized into glycogen by the sequence of reactions. Since glycogenesis occur in all body cells .but
what stimulate pituitary to release the hormone responsible for paturation name the hormone
Changes in the conformation of molecules - Qualitative Changes You may recall that linear chain of amino acids of a protein folds into a characteristic structure. Acidic resid
What are the functions of the spleen? Why is a total splenectomy (surgical removal of the spleen) compatible with life? The spleen has many functions: it participates in the de
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd