Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define pasteurization and sterilization - thermal processing, Define Pasteu...

Define Pasteurization and Sterilization - thermal processing? Pasteurization: Pasteurization is a mild heat treatment to kill part of the microorganisms present in food

Can you explain about krebs cycle, Q. Why can it be said that each glucose ...

Q. Why can it be said that each glucose molecule runs the Krebs cycle twice? Each glucose molecule "cycles" the Krebs cycle twice because after glycolysis each used glucose has

Genetics, polymorphism and its causes

polymorphism and its causes

What is waterston shunt in palliative operations, What is Waterston Shunt i...

What is Waterston Shunt in palliative operations? In this, direct anastomosis between the posterior aspect of ascending aorta and anterior aspect right pulmonary artery is done

Illustrate in detail about the cell theory, Illustrate in detail about the ...

Illustrate in detail about the Cell theory All living organisms are composed of cells, and they are the basic structural and functional units of life, just like the atom is a

Destinations of the organic material fabricate by producers, Q. What are th...

Q. What are the destinations of the organic material fabricated by the producers? The Part of the organic material synthesized by the producers is consumed as energy source for

What are meninges and cerebrospinal fluid, What are meninges and cerebrospi...

What are meninges and cerebrospinal fluid? Meninges are the membranes that enclose and protect the central nervous system (CNS). Cerebrospinal fluid is the fluid that separates

Improvement of soil aeration-aggregate structure, Improvement of Soil Aerat...

Improvement of Soil Aeration Soil organisms greatly improve soil structure and facilitate aeration. Root decay leaves the soil riddled with channels, and the burrowing of worm

What was the oral status of the patient, What was the Oral Status of the Pa...

What was the Oral Status of the Patient It is imperative that the patient carry out a strict oral hygiene regimen as dental plaque is one of the main factors that leads to impl

Energy absorbed by plants, Normal 0 false false false E...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd