Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Sympatric OR allopatric speciation Sympatry The development of new species within a population. Two Hebe sp living in the same location but with different chromosomal numb
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
A restriction enzyme or restriction endonuclease is an enzyme which cuts DNA at particular recognition nucleotide sequences with Type II restriction enzymes cutting double-stranded
Question 1: What are Good Pharmacovigilance Process and Good Post-Marketing Surveillance Process? How do they differ from each other? Define and illustrate briefly Good Post
Define the Proteins requirement to avoid underweight problem? Proteins are required for tissue building, as well as, to take care of the daily wear and tear. Under weight indiv
Explain Radial Symmetry in Classification of the Animal Kingdom? All of the animals besides the sponges are considered to belong to the Eumetazoa, or the "true animals" because
Secondary Induction The two primary inductive events that we have described so far are significant in the patterning of early embryo. But there are another such signaling eve
Pancreas Insulin (β cells) Promotes glucose entry in many cells, and in this way controls carbohydrate metabolism. Glucagon (α cells) Increases synthesis and release of
Categories of alloplastic implant materials The entire groups of possible alloplastic implant materials, regardless of their clinical applications fall into the following categ
Q. Indicating the name and respective ploidy of each involved cell how can the formation of sperm cells from germ cells be described? The formation of spermatogenesis or sperm
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd