Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Illustrate the maturation of honey? Honey is the oldest sweet food known to man. Although honey is a natural sweetener, it is considered a refined sugar because 96% of dr
RESPIR A T ORY ORGANS IN ANIMALS - In Protozoa plasmalemma functions as respiratory surface. In Porifera, respiration occur through body wall. In Coelentrata resp
Define Hepatopoietic and immune System - geriatric nutrition? Though the circulating red blood cells or the white cell count or platelet number does not normally change with a
Q. Guiding and overseeing actions of Consciousness? Guiding and overseeing actions: Consciousness connects brain and body states with external occurrences. In order to functio
Question : Explain the main steps in the mongoose bioassay and the mouse bioassay as conducted for testing ciguatera in Mauritius? (i) Provide a brief description on the beh
Primary Egg Envelopes These are the egg envelopes which develop in the ovary between oocyte and follicle cells in the space occupied by the interdigitating microvilli. Such e
Classify phylum porifera with examples
The three charges in the figure below are at the vertices of an isosceles triangle. Let q = 7.00 nC and calculate the electric potential at the midpoint of the base.
Respiratory System - Developmental Changes after Birth The new-born's lungs are collapsed and need powerful breaths to inflate them; airways too are small, offering remarkable
Q. Vitamins requirements for ulcerative colitis? Vitamins: Commercial multivitamin preparation should be administered orally especially the ones needed for the healing process
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd