Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Skeletons of radiolarians, Skeletons of radiolarians The skeletons of ...

Skeletons of radiolarians The skeletons of radiolarians and foraminiferans form a primary constituent of ocean bottoms where they form 30% or more of the sediment. It is calle

Explain the torsional failure - root canal test, Explain the Torsional Fail...

Explain the Torsional Failure - Root Canal Test a. Occurs when the tip of the rotating instrument blinds (locked) in the canal while the motor continues to rotate the shank of

Natural organelle''s function would you try to replicate, If you wanted to ...

If you wanted to create a synthetic organelle to test new drugs for toxicity, which natural organelle's function would you try to replicate?

Determine the biological diversity of an ecosystem, Is monoculture a system...

Is monoculture a system that contributes to great biological diversity of an ecosystem? Monoculture means that in a large area a single crop (only single species of plant) is c

The cell, how autophagy help in converting a tadpole larva into adult amphi...

how autophagy help in converting a tadpole larva into adult amphibian

Define nutritional needs of the elderly, Define Nutritional Needs of the El...

Define Nutritional Needs of the Elderly? In this, we learnt about the nutritional needs of the elderly, and in doing so we have also focused on many other aspects such as who d

Class pycnogonida of phylum arthropoda, Class Pycnogonida of Phylum Arthrop...

Class Pycnogonida of Phylum Arthropoda Measures generally 3-4 mm; body chiefly made up of cephalothorax, abdomen being very small; generally four pairs of walking legs; long p

Resemble the homozygous recessive parental, A dihybrid cross yields 320 F2 ...

A dihybrid cross yields 320 F2 offspring. How many are expected to resemble the homozygous recessive parental?

Induction of hydrolases - responses to infection, Induction of hydrolases -...

Induction of hydrolases - Responses to Infection Plants do respond to attack by pathogens. To restrict their spread the cells synthesise and secrete enzymes to hydrolyse the c

Determine the occurrence of vitamin B12, Occurrence of vitamin B 12 Vi...

Occurrence of vitamin B 12 Vitamin B 12 is one of the cobalamin, a group of active principles widely occurring in nature. Vitamin B 12 is present especially in liver, kidney

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd