Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q Why in few cases is mitosis a synonym of reproduction? In some living beings asexual reproduction occurs by many means binary division, budding, grafting, schizogony, etc. In
What are analogies for a nucleolus? If the nucleolus is the president of a factory then the nucleolus is the manager
write the general account of porifera
Types of Somatoform Disorders: Somatoform disorders are sub classified into the following categories. These include somatization disorder, conversibtl disorder, hypochondria
What is the difference between homozygosity and heterozygosity? Homozygosity happens when an individual has two identical alleles of a gene, for instance, AA or aa. Heterozygos
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
A healthy skeletal muscle fiber is isolated and has no external forces on it. It has normal intracellular levels of ATP and is bathed in physiological saline. Which of the follow
TEET H - Study of teeth is odontology. Accumulation of oral bacteria & their products on teeth is plaque. Some acids are secreted by bacteria causing carries.
Why is carbon monoxide toxic for humans? Hemoglobin "likes" carbon monoxide (CO) much more than it likes oxygen. When there is carbon monoxide in the inhaled air it binds to he
what is the process of cell cycle?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd