Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Gas liquid chromatography? This is used for separating and identifying volatile compounds of fatty acids, hydrocarbons, sterols, amino acids and lipids, even from nanogr
Determine the food sources of riboflavin? The food sources of riboflavin include: 1. Rich sources: Liver, dried yeast, egg powder, milk powder. 2. Good sources: Who
Define Titrimetric Estimation of Carbohydrates? The Fehling's Soxhlet method is the commonly used method for titrimetric estimation of carbohydrates. In the following section y
What are the advancement of cnidaria over protozoa
Q. Urine Examination of the diabetes Patient? Generally when blood testing facilities are not available, urine is tested for the presence of sugar. A urine sample shows presenc
Q. What are immunoglobulins? Immunoglobulin is the alternate name given to antibody and Immunoglobulins are complex proteins containing a variable portion and an invariable por
how can we make an assignment for the subject alimentary canal
what is nutrition
Micro-organisms: The micro-organisms mixed up in aerobic absorption and their activities are the same as those found in nature. The organic compounds are oxidised to H
Q. Is water a non-polar or a polar molecule? What is the consequence of that characteristic for the function of water as solvent? Water is made of two atoms of hydrogen attache
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd