Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
A healthy, primiparous (first-time) mother delivered a healthy infant several hours ago, but the mother has experienced postpartum hemorrhage. Which of the following disorders is m
Determine the Syndrome of Listeriosis Syndrome: Listeriosis in humans is not characterized by a unique set of symptoms since the course of the disease depends upon the state
The ultimate aim of somatic gene therapy is to alter the genetic material of living cells which involves transfer of DNA. Genetic material is transferred by various methods like us
Prevention of malaria No drug for malaria prevention is 100% effective. Travelers to countries that have malaria should seek prompt medical attention for febrile illness wherea
what is bowman''s capsule?
LIF E AS AN EXPRESSION OF ENERGY CHANGES - Energy is explained as capacity of body to do work. Energy may be as potential (stored) or kinetic (expended) energy. It ex
B o tu l i s m It is a toxicity in chickens, turkeys, ducks and other aquatic birds caused by a bacterial toxin produced by anaerobic bacteria Clostridium botulinum mai
how do i prove in a diagram that water is needed for photosynthesis
Explain Isoniazid It is the drug of choice for treatment of latent TB infection. It should be given for 9 months in a single daily dose of 300 mg for adults and 10 mg/kg (max 3
Change in nucleus during cleavage
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd