Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Respiratory System in Living Organisms Respiration is a necessary physiological process in all living organisms by which they obtain energy for carrying out all the metabolic
Dextrins Dextrins are also polymers of D-glucose held by a(l,4) glycosidic linkages. Dextrins are, in fact, formed due to partial hydrolysis of starch by enzymes such as sa
Q. Study of food texture? We learnt earlier that texture is observed in terms of tactile sensations i.e. finger feel and mouth feel. Finger feel is sensed before ingestion, by
Define Precautions for Check the Presence of Rhodamine B? 1. Sample should be clean and dry. 2. Dispose off the paraffin oil carefully, so that it does not contaminate food/
Q. Guiding and overseeing actions of Consciousness? Guiding and overseeing actions: Consciousness connects brain and body states with external occurrences. In order to functio
Procedure for Morphological Characteristics of Yeast Cells? Now carry out the exercise following the steps enumerated herewith: (1) Label the clean, non-greasy slide. Put fe
Osmoregulation in Protozoans Osmoregulation or water balance in protozoa is accomplished by contractile vacuoles. One to several contractile vacuoles may be present within the
How to calculate the raw score for each scale The raw score for each scale is the sum of the 0, 1 and 2 item scores. Thus, the higher the score, the poorer the performance. Th
Explain Gastric Bypass - surgical management for obesity? Surgery is the current 'gold standard' for bariatric surgical procedures. It involves use of a stapling device to crea
How do the plants classify according to their photoperiodism-based flowering? According to their photoperiodism-based the flowering plants classify as long-day plants, those th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd