Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Nutritional Status of the Elderly? Nutritional risk factor is defined as "characteristic or occurrence that increases the likelihood that an individual has or will have
Oceanic islands are interesting and somewhat specialised biomes. Islands which have broken away from the main continents have similarity of flora and fauna related to the continent
evolutionary effect of Oracle clinical applications in Pharmaceutical industries
What is Mendel's Crosses in genetics explain breifly? Mendel found that if he transferred pollen from a green-seed strain to a yellow-seed strain and vice versa, in a process c
Isoniazid Serum aminotransferase activity increases in 10% to 20% of patients taking isoniazid, especially in the early weeks of treatment, but often returns to normal even wh
What is HACCP? HACCP, as you may already know, is an acronym that stands for Hazard Analysis Critical Control Point, a systematic, science-based approach used in food
In this unit, you have learnt that heart is a muscular organ situated in thorax covering with pericardium and consist of four chambers i.e. right atrium, left atrium, right ventric
Q. What are the so-called "good" and "bad" cholesterol? Lipoproteins are complexes made of lipids (cholesterol and triglycerides) and proteins. The lipoproteins present differe
Define Standard Titration for estimation of reducing sugar by Fehling Soxhlet Method? Pipette 5 ml of Fehling's A and 5 ml of Fehling B solution into a 100 ml conical flask. Ad
Anomalies Related to Oral Cavity Under these anomalies we will briefly discuss the cleft lip and cleft palate. You must have seen and/or nursed a baby born with a cut on
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd