Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define etiology and clinical features of epilepsy, Define Etiology and Clin...

Define Etiology and Clinical Features of Epilepsy? This disorder usually starts in childhood, with the peak incidence between birth and two years. Etiological factors include

Punnett Sqares Virtual Lab, I need help with my biology virtual lab. Its du...

I need help with my biology virtual lab. Its due tomorrow

Water of estuaries, Water of Estuaries The water of estuaries is turbi...

Water of Estuaries The water of estuaries is turbid because of the great number of particulates in suspension in the water. The turbidity is minimum near the mouth and increas

Representation of the metabolism, Biological effects: Aflatoxins are acute ...

Biological effects: Aflatoxins are acute hepatotoxins and are known to be carcinogenic in some animal species as rat. Aflatoxin B1 is acutely toxic and is responsible for liver nec

Types of synovial joint, TYPES OF SYNOVIAL JOINT - 1 .      BALL AND ...

TYPES OF SYNOVIAL JOINT - 1 .      BALL AND SOCKET JOINT - One bone forms a ball like head that fits into a socket formed in the other bone. Movement is possible in al

What are the dietitians services, What are the dietitians services Diet...

What are the dietitians services Dietitians are engaged in a variety  of  positions and  in a number of  work settings. Of course the largest proportion is  involved engaged in

Dna (deoxyribonucleic acid), DNA (deoxyribonucleic acid) is the molecule w...

DNA (deoxyribonucleic acid) is the molecule which are responsible for storing and transmitting the genetic information. DNA is a double- stranded molecule which is held together b

Economically important fermentation products-beer, Normal 0 fal...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Explain the factors affecting the process of deep fat frying, Factors affec...

Factors affecting the process of deep fat frying. The common factors influencing the process of deep frying include: 1.  Heat- Frying temperatures ranging from 150 -190°C

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd