Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Water pollutants - water pollution, Water Pollutants - Water Pollution ...

Water Pollutants - Water Pollution Water pollution can occur on account of any one or more of the following agents: 1. Biological: Pathogens such as virus, bacteria,

Deficiency diseases-ketosis, Ketosis Ketosis, also known as acetonaemia...

Ketosis Ketosis, also known as acetonaemia or ketonaemia is a multifactorial disorder that commonly occurs in dairy cows and buffaloes immediately after calving or in early lac

Sensitive/critical periods: windows of enhanced plasticity, There are speci...

There are specific sensitive/critical periods in development during which acquisition of certain skills is substantially easier than at other times. In the animal domain there are

How do cam plants vary from both c3 and c4 plants, How do CAM plants vary f...

How do CAM plants vary from both C 3 and C 4 plants? CAM plants open their stomata at night, while C 3 and C 4 plants open their stomata during the day.

Explain the mode of feeding or nutrition support, Explain the Mode of Feedi...

Explain the Mode of Feeding or Nutrition Support? Do you recall studying about the nutrition support methods, namely enteral and perenteral feeding? These two methods form the

Lipid profile, Abnormalities in the lipid profile are found in patients wit...

Abnormalities in the lipid profile are found in patients with diabetes mellitus. The lipid abnormalities increase the risk of heart disease in diabetics and hence should be regular

What are interferons, Interferons are small glycoproteins formed by virus-i...

Interferons are small glycoproteins formed by virus-infected cells that inhibit viral infection. They are heterogeneous. Gamma interferons induce MHC class II antigens in macrophag

What is the typical localization of the tropical forests, What is the typic...

What is the typical localization of the tropical forests regarding latitude? Tropical rain forests, as the Amazon forest and the Congo forest, are typically located in low lati

Find out the degrees of freedom, -The expected phenotypic ratio of offsprin...

-The expected phenotypic ratio of offspring. -The expected genotypic ratio of offspring. -Calculate the expected values you would use on a chi-square test (use genotypic rati

What is ventricular septal defect, What is Ventricular Septal Defect (VSD) ...

What is Ventricular Septal Defect (VSD) ? VSD accounts for 15-20 per cent of all CHDs. The ventricular septum may be divided into a small membranous portion and a large muscula

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd