Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Braxy The causative agent of braxy is Cl. septicum. It usually affects lambs. The agent is a normal inhabitant of soil and is frequently found in the faeces of herbivores. Bra
Implant failures On the basis of the stage when problems occurs implant failures can be classified as : i) Before Abutment Connection. ii) During Abutment Connection.
Why in some cases is mitosis a synonym of reproduction? In some living beings asexual reproduction happens by many means: binary division, schizogony, budding, grafting, etc. I
Production of Rare Hybrids Hybridization is a well established plant breeding procedure to obtain superior plants by combining useful characters distributed in different plan
Disease occurrence due to climate change The movement of animal diseases across physical and political boundaries threatens food security and creates a global public co
What is omnispective classification
RACE S OF MODERN MAN Australoids Negroids Caucasoids Monogoloids American Indian Polynesian All human races have the same number of chromosomes (46) and b
Which of the following is true for a toe motor neuron that excites a toe muscle that moves the big toe in the right foot? A. The cell body of the toe motor neuron is located in
economic importance of mulluscas
Explain Skeletal muscle Skeletal muscle has low activity of glucose-6-phosphate dehydogenase. Yet, like most other tissues it can synthesize ribose-5-phosphate. This is.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd