Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Give definitions of atomic number and atomic mass and how they relate to protons, neutrons, and electrons in neutral atoms?
Primary Succession - Community Change In primary succession on a terrestrial site the new site is first colonised by a few hardy pioneer species that are often microbes, liche
Ask question #Minimum 100 words acceptethe best topics for seminAR d#
What are the Stages of soil The development of soil takes place in two stages. In the first stage there is formation of parent material which is generally consolidated and cons
Duck plague Duck plague, caused by a member of Herpesviridae, has world wide distribution and occurs among domestic and wild ducks, geese, swans and waterfowls. Epidemiolo
How brain thinks?
explain chemical changes during cleavage
Q. What do you mean by biodigester? A biodigester is equipment that produces hydrogen sulfide, carbon dioxide and fuel gases (biogases) like methane from organic material under
Minerals :- Phosphates Food Source Ubiquitous, animal products tend to be good sources Nutritional Functional role Essential nutrient: Deficiency is rare due
Skeletal muscle A. The myosin head is activated (energized) by the conversion of GTP (that is bound to myosin) to GDP and Pi (that are bound to myosin). B. Detachment of the
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd