Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q Why is it said that during photosynthesis carbon dioxide is improved to form glucose? During photosynthesis carbon dioxide is energetically improve with hydrogen from water.
Aril - Seed Appendages It is an outgrowth that arises from the funicle or the testa near the raphe and covers the seed partially or completely. It is often referred to as the
Define Vitamins requirement to avoid underweight problem? Vitamins and Minerals: If the diet provides good amounts of fresh fruits and vegetables, vitamin or mineral supplement
Gluconeogenesis synthesizes glucose from noncarbohydrate precursors, involving pyruvate and lactate, citric acid cycle intermediates, the carbon skeletons of most glycerol and amin
Why is it important to be familiar with the laboratory apparatus and their uses? If you do not use instruments or lab apparatuses correctly (or use an apparatus for something i
how do retroviruses reproduce?
Explain Inhibition of cancer cell proliferation and growth? Vitamin D diminishes proliferation of abnormal intestinal, lymphatic, mammary and skeletal cells and provides a pote
Define Proteins as biological buffers? Proteins have the ability to accept or donate hydrogen ions and by doing so they serve as biological buffers. In blood, there are three i
Define Factors that affect the requirement of Protein? Protein requirement is greatly influenced by many factors such as age, environmental temperature, energy intake, gender,
whats the difference in respiratory system in mammals,reptilia and amphibian?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd