Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain texturization - function of protein, Texturization       Protei...

Texturization       Proteins  constitute the basis of structures and texture  in several foods, whether these come from living tissue  (myofibrills in  meat or fish) or from fa

Which functional groups cannot react with each other, Which of the followin...

Which of the following pairs of functional groups CANNOT react with each other by a dehydration reaction? Select one: a. Carboxyl;Hydroxyl b. Carboxyl;Sulfhydryl c. Pho

Explain lauric fats - edible fats, Lauric Fats  Fats of this group are ...

Lauric Fats  Fats of this group are derived from certain species of palm, such as coconut. The fats are characterized by their high content of lauric acid (40 - 50%), moderate

Chlamydiosis-diagnosis, Diagnosis Clinical signs: In most of the case...

Diagnosis Clinical signs: In most of the cases in initial stages like bacterial infections there is leucocytosis with neutrophilia, which at later stages of the disease may c

Does ph affect the enzyme activity, Q. Does pH affect the enzyme activity? ...

Q. Does pH affect the enzyme activity? The concentrations of hydrogen ions in solution affect the enzyme activity. Each enzyme has utmost efficiency under an optimum p H . S

Define types of indicators, Define Types of Indicators? Macro indicator...

Define Types of Indicators? Macro indicators are used at strategic levels while micro indicators are used at performance levels. From the previous sections it is clear that man

Define the energy cost of growth, Define the Energy Cost of Growth? The...

Define the Energy Cost of Growth? The energy cost of growth has two components: 1) The energy needed to synthesize growing tissues; and 2) The energy deposited in these tis

What is tricuspid atresia: surgery for single ventricle, What is Tricuspid ...

What is Tricuspid Atresia: Surgery for Single Ventricle Physiology In tricuspid atresia, the right atrium fails to open into right ventricle through a right atrioventricular va

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd