Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Where does most of the water resorbed after glomerular filtration go? What are the other substances resorbed by the nephron tubules? Only 0.5 to 1% of the glomerular filtrate i
What are the Elements of Heredity and variations?
Define the Parenteral Nutrition Support? Parenteral nutrition support is the provision of dextrose, amino acids, electrolytes, vitamins, minerals and trace elements with or wit
Explain Homogenization Homogenized milk will not be affected, as the fat globules are already broken up. Homogenization increases the viscosity of whole milk but slightly dec
Define about Selenoproteins P and W? The third group comprises of selenoprotein P, an extracellular constituent with multiple selenocysteine molecules. This has an antioxidant
Digestive Enzymes Now let us consider the general principles of digestion that are applicable t6all animals. We will start with the digestive enzymes that breakdown the large
How is the concept of chromosome related to the concept of the gene? A chromosome is a DNA molecule. A chromosome may have several dissimilar genes and also DNA portions tha
Define functions of Organic Phosphorus? It is involved in the following reactions/components: a) Structural component of nucleic acids: It is important component of DNA and
What are allosteric enzymes? Allosteric regulators can be allosteric inhibitors or allosteric activators. The interaction among an allosteric enzyme and the allosteric inhibito
Dietitians and nutritionists Dietitians and nutritionists, who are associated with hospitals and clinics generally have regular work hours. At times, they may be required to wo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd