Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What are the difference between plasma membrane and cell wall? Plasma membrane and cell wall is not the same thing. Plasma membrane, also known as cell membrane, is the exte
Under which form is nitrogen fixed by living beings? Most living beings cannot use molecular nitrogen to get nitrogen atoms. Producers fix nitrogen mostly from nitrate (NO3-).
Carboxymethyl Cellulose (CMC) CMC is a linear, long-chain, water-soluble, anionic modified polysaccharide. It is a derivative of cellulose formed by its reaction with alkali an
EMBO L Y - The embolic morphogenetic movements are concerned with the inward migration of prospective endodermal and mesodermal blastomeres from the external surface of blast
Symbiotic interaction - Biological Stress Presence of symbiotic microorganism can result in differential growth stimulation of those plants which can recognise the beneficial
Which biological molecule contains the genetic information that controls cellular functioning
how do we write a limerick spell?
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Gastropods - Feeding and Digestion in Molluscs In several gastropods the digestion is extracellular. Though, some herbivore gastropods like Crepidula are ciliary feeders and h
A charged particle A exerts a force of 2.39uN to the right on charged particle B when the particles are 12.3 mm apart. Particle B moves straight away from A to make the distance be
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd