Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Addition of glycine to the physiological saline A complete motor neuron is removed from a frog and placed in a large volume of normal physiological saline. The neuron is heal
Explain the Virtual Dissection of the Rat in multimedia tutorials? This animation will teach you about basic mammalian anatomy. The major organ systems in a rat are very simila
Class of Mollusca - Aplacophora Worm-like, no shell, head or excretory organs mantle with chitinous cuticle or scales or spicules mantle cavity posterior. Aplacophorans are a
Q. What is represented by the cellular secretion? Cell secretion is the removal to the exterior of substances produced by the cell for instance, hormones, mucus, and sweat, so
Define Reagents for Measurement of pH? Buffer solutions of pH 4, pH 7 and pH 9.18 for calibration and an unknown solution (i.e. solution of unknown pH) You can prepare these
A 70-year old woman presents with a 1-hour history of crushing substernal chest pain. Shortly after admission, the patient expires. An autopsy reveals calcium deposits in the intim
what are the sources of infection (human, animal and non-living reservoirs), the routes of transmission (way in which the infection spreads) and different ways in which micro-organ
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Measures to control malaria infection: Malaria is a communicable disease caused by the female anopheles mosquito. a) Controlling mosquito population : Mosquito population can b
Explain the term - Social Attention and Environmental Influences The importance of social environment and early experiences in neurodevelopment is increasingly recognised. Due
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd