Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is the meaning of Chelicifore? These feeding mouthparts are found on most, pycnogonads. Though the proboscis is the main feeding structure in these animals when chelicifor
Economic Biology: This is the study of useful plants and animals or their products. Economic biology is referred to as economics and human biology. Economics or Human Biology can
Similar to all animal cells, protozoans are covered by a plasma membrane which surrounds cytoplasm of the cell, protozoan's integument or skin. Like all membranes, it's permeable;
Q. How DNA-RNA hybridization occurs Both DNA and RNA are able to form hybrids in solution with other RNA or DNA molecules which have complementary base pairing. Double-stranded
a sea urchin egg is injected with an mRNA encoding the cadherin protein fragment described above and an mRNA encoding the Pmar1 transcription factor. The embryo is allowed to devel
what is the function of the sweat gland?
Explain National Nutritional Anaemia Prophylaxis Programme (NNAPP)? In past, both access to and intake of iron-folate tablets have been poor in children and therefore had a lit
What is a glucose tolerance test? A glucose tolerance test, usually conducted in the 24 to 28 weeks of pregnancy measures levels of sugar (glucose) in the mother's blood. Abnor
Promoters The promoter region contains the DNA sequences that allow the formation of the transcription initiation complex that give the specificity of expression. Promoters are
Describe Insulin resistance in Non-conventional Factors ? Insulin resistance refers to a generalized metabolic disorder in which various tissues are resistant to normal levels of
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd