Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Which are the heart chambers, Q. Which are the heart chambers respectively ...

Q. Which are the heart chambers respectively where the entrance and the exit of blood occur? The heart chambers through which blood enters the heart are the atria there are the

What is protein denaturizing, Secondary, tertiary, and quaternary structure...

Secondary, tertiary, and quaternary structures of proteins are spatial structures. Denaturizing is modification in any of these spatial structures that makes the protein deficient

Technical requirements for pulmonary angiography, Q. Technical Requirements...

Q. Technical Requirements for pulmonary angiography? Digital subtraction pulmonary angiography with selective pulmonary arterial injections is vastly superior to conventional c

Floating plants, what are floating plants? detailed information

what are floating plants? detailed information

Agro-industrial by-products-non-conventional feed resources, Non-Convention...

Non-Conventional Feed Resources There are many non-traditional or non-conventional materials which are available in abundance and can form potential source of feedstuffs for f

Medication therapy and nursing consideration, Mr. Smith is a 72 year male d...

Mr. Smith is a 72 year male diagnosed with hypertension.  Along with hypertension, Mr. Smith has been diagnosed with right-sided heart failure.  The following are his list of medic

What will phenotypical feature actually manifested depend, For an individua...

For an individual having a genotype formed of two different alleles that condition different varieties of the same phenotypical trait, upon what will the phenotypical feature actua

Natural vegetative propagation, in natural vegetative propagation which st...

in natural vegetative propagation which structure gives rise to new individuals?

Explain about the epilepsy, Explain about the Epilepsy? Epilepsy is a n...

Explain about the Epilepsy? Epilepsy is a neuromuscular disorder in which transient seizures recur due to an abnormal brain activity. The brain, through all orderly electric ex

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd