Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Fast response - biological responses, Fast Response - Biological Responses ...

Fast Response - Biological Responses Some of the fast responses are discussed below: It was found that when mung bean root tips were kept in a specific solution (contain

Why food which can be taken in plenty, Food Which can be Taken in Plenty an...

Food Which can be Taken in Plenty and Food to be Avoided Lastly, in the context of changing the diet, we should know the foods to be avoided and the food to be taken in plenty

Evaluation of heart failure, The initial evaluation of new onset heart fail...

The initial evaluation of new onset heart failure should include an electrocardiogram, chest radiograph, and B-type natriuretic peptide assay. The cardiac rhythm may be normal sinu

Explain conservative substitution, Conservative Substitution: The nucleoti...

Conservative Substitution: The nucleotide mutation that alters the amino acid sequence of protein, but which causes substitution of one amino acid with another which has a side ch

Types of leaves, Types of leaves Collect leaves from such plants as lil...

Types of leaves Collect leaves from such plants as lilies, bamboo, corn, willow and geraniums. View that the monocots (lily, bamboo, corn, sugar cane) have the veins running pa

How are the proteins important in metabolism of lens, How are the proteins ...

How are the proteins important in metabolism of lens? Proteins Physical slate of protein is important for transparency of lens. Morner first time classified protein of l

How membrane voltage increases, Consider an axon of a neuron. At time=t1, i...

Consider an axon of a neuron. At time=t1, its voltage is at threshold for an action potential; at time=t2, its voltage is at 0 millivolts prior to the peak of that action potential

Define the energy cost of growth, Define the Energy Cost of Growth? The...

Define the Energy Cost of Growth? The energy cost of growth has two components: 1) The energy needed to synthesize growing tissues; and 2) The energy deposited in these tis

Define in brief about the term - mri, Define in brief about the term - MRI ...

Define in brief about the term - MRI MRI is a more recent development that was initially introduced as a rival to CT. The technique itself is complex, relying on measurement o

Explain tb in pregnancy, TB in pregnancy Treatment of TB should be init...

TB in pregnancy Treatment of TB should be initiated in pregnancy when there is moderate to high suspicion of disease because active infection during pregnancy poses a risk to t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd