Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q What is the usefulness of fungi for some industries? Fungi are industrially used in the production of fermented beverage, cheese, bread, and so on. A few fungi are very impor
what are characteristics of protozoa?
What are the functions of the Eyelids? Functions of the Eyelids: The eyelid makes the outer most layers, covering the eye. Because of its strategic position, the eyelid s
Nursing Assessment During assessment the child's parents will give you history of upper respiratory infection or skin infection in the previous one to three weeks. Initially
What does radial symmetry mean? What is the type of symmetry found in chordates? Which are other phyla of the animal kingdom that present species with radial symmetry? Radial
Puerperal Psychosis: Child birth can precipitate schizophrenia, depression and mania. Management: it depends on the nature of the symptoms. Danger to self and othcrs (inc
Define Clinical Features and Medical Complications of Anorexia Nervosa? Anorexia nervosa, as we have learnt above, is a disorder characterized by deliberate weight loss, induce
what are viroids
Explain the Cultural Practices of single crop Continuous cultivation of a single crop over years on the same site causes accumulation of a particular group of microbes, which d
Pyruvate carboxylase is a mitochondrial matrix enzyme whereas the other enzymes of gluconeogenesis are situated outside the mitochondrion. Thus oxaloacetate are produced by p
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd