Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain the effect of Deficiency of Copper in Human? Owing to the remarkable homeostatic mechanisms, copper deficiency in humans is rare. However, copper deficiency has been re
diagram of dna replication
It is important to know about qualities of a counsellor because you will be counselling a diabetic patient and his family members in clinic/home/hospital and therefore, you shoul
what are the characteristis in species in the phyla division
all of their function on different system
why does the removal of extremity of coleoptile prohibit plant growth?
Matter - Living and Non-Living Our universe is made up of two basic components:, matter and. energy. Matter, as you know, has mass; it occupies space. You can touch matter. It
Some observations seen in this fever are: 1. Massive loss of lean body mass or muscle due to tissue breakdown (250-500 g muscle tissue is lost/day) leading to excessive nitro
Define Significance and Impact of Plants and Animals on Human Life? Plants and animals both have a great significance and unparalleled impact on human life. Most of our needs a
Demography : This is the study of populations. In the other words demography is the statistical study of human population. This may be a very general science which can be applied t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd