Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Match each of the methods or vectors below to an appropriate form of gene therapy, assigning two methods or vectors to each form. Use each method or vector only once. Methods/vec
Density Independent Factors Density independent factors are the extrinsic factors which tend to regulate the density of a population in ways that are not correlated with its
Explain theTechnique of total anomalous Surgery ? Corrective surgery is undertaken as an emergency procedure after diagnosis has been confirmed by two-dimensional echocardiogra
Succession - Community Change The factors like fire, floods and human interventions affect an ecosystem considerably. They often lead to the depletion or stripping off of orig
Erythrocytes or red blood cells: These are otherwise called Red Blood cells or corpuscles. These are the most numerous cells in the blood.There are about 4.5 to 5.5x 10 9
Natality - Population Parameters and Regulation Natality is the ability of a population to increase. Natality rate is equivalent to birth rate which means the production of ne
Shapes: Nightingale Ward In the 1940s, this traditional nursing unit was based on the long rectangle pavilion type ward and self-contained unit. This concept is establis
what are the adaptations of amoeba
Discuss the biological importance of Imidazole. Bring in examples of biomolecules that contain this group. Please be as thorough as possible.
The F2 phenotypic ratio from a dihybrid cross with epistasis was 9:3:4. If instead of a dihybrid cross, a double heterozygote was test crossed (crossed to a homozygous recessive in
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd