Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Chest complications-peri operative problems, Chest Complications : Many of...

Chest Complications : Many of the patients undergoing coronary artery bypass surgery have risk factors for post-operative lung complications. These include old age, chronic obstru

Define lactobacillus, Mention the product and its use formed by each the mi...

Mention the product and its use formed by each the microbes listed below: i)  Lactobacillus ii) Streptococcus iii)  Saccharomyces cerevisiae

Ammonia assimilation, Ammonia Assimilation - Inorganic Nitrogen and Sulphur...

Ammonia Assimilation - Inorganic Nitrogen and Sulphur Metabolism Nitrogen (N 2 ) gas and NO 3 are the most common available forms of inorganic nitrogen. Both are enzymaticall

Lung abscess, Lung Abscess: Lung  abscess  is a localised collection o...

Lung Abscess: Lung  abscess  is a localised collection of pus in  the pulmonary parenchyma as a result of  suppuration and necrosis. The obstruction  of the bronchus of the in

Explain use of food additives - method of food preservation, Explain Use of...

Explain Use of food Additives - method of food preservation? Food additives may be defined as substances added intentionally to food, generally, in small quantities to improve

Phlum protoza, what are the some examples of phlum protoza?

what are the some examples of phlum protoza?

Homeopathic cures, If water dousing, homeopathic cures, and so on work for ...

If water dousing, homeopathic cures, and so on work for just me but not for anyone else, it is still science.

What is diffusion, What is diffusion? Diffusion is the spreading of sub...

What is diffusion? Diffusion is the spreading of substance molecules from a region where the substance is more concentrated to another region where it is less concentrated. For

What progeny are expected in the f1, Cut wings (ct) is an X chromosome (sex...

Cut wings (ct) is an X chromosome (sex linked) recessive mutant of D melanogaster. Antennaless (al) is an autosomal recessive mutant. A cut, antennaless (homozygous) female is mate

Explain the interaction of vitamin a with iron, Explain the interaction of ...

Explain the interaction of vitamin A with Iron? Iron: Iron status of an individual correlates with vitamin A. The deficiency of  vitamin A has been found to be associated with

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd