Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is pollination, What is pollination? What are the main forms of pollin...

What is pollination? What are the main forms of pollination? The process in which pollen grains (the male gametophytes of phanerogamic plants) reach the female gametophyte is k

Haematology, differenciate between plasma and serum

differenciate between plasma and serum

Explain sinus venosus defect with partial anomalous venous, Explain Sinus V...

Explain Sinus Venosus Defect with Partial Anomalous Venous Connection ? In this defect the atrial septal defect is situated just below the orifice of superior vena cava above

What are some examples of biological activities, Q. What are some examples ...

Q. What are some examples of biological activities in which osmosis plays an significant role? Hemolysis destruction of red blood cells by entrance of water, the hydric regulat

Describe nerve cells, In eukaryotes possibly the most rapid and complex sig...

In eukaryotes possibly the most rapid and complex signaling is mediated through nerve impulses.  The Nerve  cells  (neurons)  consist  of  a cell  body  with  numerous projections

Explain about tropical rain forests, Q. Explain about Tropical Rain Forests...

Q. Explain about Tropical Rain Forests? As you approach the equator the climate becomes increasingly hot and seasonal variation in climate decreases resulting in practically th

Theory of germplasm, THEOR Y OF GERMPLASM - August Weismann (1834-1...

THEOR Y OF GERMPLASM - August Weismann (1834-1914) criticized the inheritance of acquired characters by putting forward the theory of continuity of germplasm. According

Diversty of living organisms, write down the division of cryptogamae and p...

write down the division of cryptogamae and phanerogamae

Self-pollination - types of pollination, Self-Pollination - Types of Pollin...

Self-Pollination - Types of Pollination Self-pollination refers to the transfer of pollen grains from the anther to the stigma of the same flower. In chasmogamous flowers the

Determine the term mentalis, Mentalis The mental tubercles on either si...

Mentalis The mental tubercles on either side of mental protruberance(in midline) gives origin to the mentalis muscle. Above the mentalis origin, the incisivus muscle takes orig

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd