Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Breifly describe the Menstrual Cycle? Each month during a female's reproductive years, the hypothalamus secretes a hormone that stimulates the anterior lobe of the pituitary gl
According to the stimuli they collect how are the sensory receptors classified? The sensory receptors are divided according to the stimuli they get: mechanoreceptors are stimul
Which are the organs of the excretory system? The excretory system is produced of kidneys (two), ureters (two), bladder and urethra. The Excretory System - Image Diversity:
Q. What is the numeric relation between purine and pyrimidine bases in the DNA molecule? Is that relation valid in the RNA molecules? The DNA molecule is made of two bound poly
Syngamy and Triple Fusion After traversing through the stylar region, the ultimate destination of the pollen tube is to reach the female gametophyte and release the male game
Explain the life cycle of Water? The water cycle , or hydrologic cycle, is one of the most important processes to living organisms on Earth. Consider the following facts:
WHAT ARE TYPES OF EGG
Define the Primary Stain and Mordant? (i) Primary Stain - Crystal violet is the primary or first stain, which stains all the cells violet/purple. (ii) Mordant - Gram's iodin
How are the bacteria and the archaea different from all the other cellular microbes? -They have cell walls? -They can move? -They reproduce asexually? -They have no nucleus?
Neurosecretory Systems Almost all groups of multicellular animals have been investigated to find out if neurosecretory cells are present in them. Such investigations have sho
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd