Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What are deciduous trees, What are deciduous trees? The Deciduous trees...

What are deciduous trees? The Deciduous trees are plants that lose their leaves in a period of the year and in the case of the deciduous trees of the temperate forest the fall

Use of alternate metabolic pathways, Use of Alternate Metabolic Pathways ...

Use of Alternate Metabolic Pathways Plants surviving under water-logged conditions offer the simplest example of such a response. The submerged parts of such plants use the an

What is micro-endodontic surgery, What is Micro-Endodontic Surgery? Co...

What is Micro-Endodontic Surgery? Combines of the magnification and illumination provided by the microscope with proper use of new micro-instruments.

Pseudocoelom - metazoa, Pseudocoelom - Metazoa The platyhelminths whic...

Pseudocoelom - Metazoa The platyhelminths which do not have a body cavity surrounding the gut, have a solid type of body constitution. The mesoderm completely fills the space

What type of membrane is the cell membrane, Concerning permeability what ty...

Concerning permeability what type of membrane is the cell membrane? The cell membrane is a selectively permeable membrane, i.e., it permits the passage of water and some select

Ancillary and sanitary accomodation, Ancillary Accomodation: Ward Kit...

Ancillary Accomodation: Ward KitchenIPantry:  It should have large sink and drain board along with fly proof door. If  the food is received from central kitchen and tray pre

For the biological diversity is mitosis or meiosis, For the biological dive...

For the biological diversity is mitosis or meiosis the more important process? Meiosis is the cell division process that permits the formation of gametes to sexual reproduction

Tissue Cells, How is an Epithelial cell made?

How is an Epithelial cell made?

What is a membrane, Membrane is any delicate sheet that divides one region ...

Membrane is any delicate sheet that divides one region from other blocking or permitting (selectively or completely) the passage of substances. The skin, for example, can be consid

Conditions requiring rapid treatment of hypertension, List of Conditions Re...

List of Conditions Requiring Rapid Treatment of Hypertension 1) Cardiac: • Acute aortic dissection • Acute left ventricular failure • Acute or evolving myocardial i

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd