Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define the htst pasteurization method, Define the HTST Pasteurization Metho...

Define the HTST Pasteurization Method? Rapid, high pasteurization is characterized by a pasteurization time in the order of seconds and temperatures of about 85° to 90°C or mor

Heart in reptiles, Reptiles  Heart is incomplete 4 chambered, ventri...

Reptiles  Heart is incomplete 4 chambered, ventricles are not divided completely 2 auricels & 2 ventricles. Sinus venosus present, Truncus artiorsus absent [In lizzard fo

Structure of the sperm, Structure of the Sperm The spermatozoa in dif...

Structure of the Sperm The spermatozoa in different animal groups display a wide variety of shapes and sizes but all share a. basic morphological plan. The sperm in most anim

Explain radiology, Radiology is a medical specialty that employs the use of...

Radiology is a medical specialty that employs the use of imaging to both diagnose and treat disease visualised within the human body. Radiologists use an array of imaging technolog

Blood from a donor is sterile and stored in a sealed bag, Blood from a dono...

Blood from a donor is sterile and stored in a sealed bag, but it is still kept at 4°C. What is the advantage of keeping it at this low temperature?   At 4 °C, enzyme activi

What are some examples of interspecific competition, What are some examples...

What are some examples of interspecific competition? Examples of interspecific competition are: the dispute between vultures, worms, flies and microorganisms for carrion and th

Economic aspect of biodiversity, Q. Economic aspect of biodiversity? Bi...

Q. Economic aspect of biodiversity? Biodiversity serves as an income generating activity for countries around the world. Many people visit forests, beaches, mountains, grasslan

Insects - hormones in growth and reproduction, Insects - Hormones in Growth...

Insects - Hormones in Growth and Reproduction In insects hormones regulate moulting and metamorphosis. The larvae or nymphs which hatch out of the eggs undergo regular moultin

Explain chronic infections fever, Explain Chronic Infections Fever Chr...

Explain Chronic Infections Fever Chronic  Infections Fever: These are generally of longer and sustained duration. The patients have a past history of repeated episodes or con

Indications for surgery, Indications 1) Symptomatic patient with normal...

Indications 1) Symptomatic patient with normal LV function (ejection fraction 2 0.5 at rest). If they are in class In or IV NYHA, surgery is recommended. In this group of pat

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd