Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain the transcription factor of zinc, Explain the Transcription Factor ...

Explain the Transcription Factor of Zinc? Zinc is an important structural component of DNA- binding proteins also known as 'transcription factors'. These transcription factors

Explain the process of absorption of fats, Explain the process of Absorptio...

Explain the process of Absorption of Fats? After digestion, only 25% of triglycerides are broken completely to glycerol and fatty acids. Major digestion product is 2-monoacylgl

Botany, Suggest a mechanism that would allow a plant to grow better if it h...

Suggest a mechanism that would allow a plant to grow better if it had intermorph neighbors than if it had intramorph neighbors. Think about the degree of genetic similarity between

Heart and lungs, what are the main functions of lungs and heart

what are the main functions of lungs and heart

What is root cap, What is root cap? Root cap is a protective structure ...

What is root cap? Root cap is a protective structure located in the tip of the growing root. It defends the meristematic tissue of the root forming a cap that surrounds the tip

How does the Cornea work, How does the Cornea work, I heard that it is like...

How does the Cornea work, I heard that it is like a motor, however i''m not too sure... because a motor is in vehicle and has piston, and the Cornea is in our eyes and... Well does

Explain the sub-clinical protein energy malnutrition, Explain the Sub-clini...

Explain the Sub-clinical Protein Energy Malnutrition? You have already learnt that clinical forms of PEM represent only a small proportion of the total cases of PEM in a commun

Classification of living things, Ask question what is classification of liv...

Ask question what is classification of livibg thingsMinimum 100 words accepted#

What are nymph and imago, What are nymph and imago? Nymphs are larvae o...

What are nymph and imago? Nymphs are larvae of hemimetabolic insects (like grasshoppers). They are very same to the adult insect although smaller. In holometabolic insects (lik

Explain the economics in nutrition, Explain the Economics in Nutrition? ...

Explain the Economics in Nutrition? We mentioned earlier that nutritional problems affect the productivity of the individual, which, in turn affects the productivity of the nat

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd