Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What are the other substances resorbed by nephron tubules, Where does most ...

Where does most of the water resorbed after glomerular filtration go? What are the other substances resorbed by the nephron tubules? Only 0.5 to 1% of the glomerular filtrate i

Genetics, What are the Elements of Heredity and variations?

What are the Elements of Heredity and variations?

Define the parenteral nutrition support, Define the Parenteral Nutrition Su...

Define the Parenteral Nutrition Support? Parenteral nutrition support is the provision of dextrose, amino acids, electrolytes, vitamins, minerals and trace elements with or wit

Explain homogenization, Explain Homogenization Homogenized milk will n...

Explain Homogenization Homogenized milk will not be affected, as the fat globules are already broken up.  Homogenization increases the viscosity of whole milk but slightly dec

Define about selenoproteins p and w, Define about Selenoproteins P and W? ...

Define about Selenoproteins P and W? The third group comprises of selenoprotein P, an extracellular constituent with multiple selenocysteine molecules. This has an antioxidant

Digestive enzymes, Digestive Enzymes Now let us consider the general p...

Digestive Enzymes Now let us consider the general principles of digestion that are applicable t6all animals. We will start with the digestive enzymes that breakdown the large

How is the concept of chromosome related to the gene, How is the concept of...

How is the concept of chromosome related to the concept of the gene? A chromosome is a DNA molecule. A chromosome may have several dissimilar genes and also DNA portions tha

Define functions of organic phosphorus, Define functions of Organic Phospho...

Define functions of Organic Phosphorus? It is involved in the following reactions/components: a) Structural component of nucleic acids: It is important component of DNA and

What are allosteric enzymes, What are allosteric enzymes? Allosteric re...

What are allosteric enzymes? Allosteric regulators can be allosteric inhibitors or allosteric activators. The interaction among an allosteric enzyme and the allosteric inhibito

Explain working of dietitians and nutritionists, Dietitians and nutritionis...

Dietitians and nutritionists Dietitians and nutritionists, who are associated with hospitals and clinics generally have regular work hours. At times, they may be required to wo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd