Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Basic Structure of Heart The heart is small organ about the size of one's fist, located in the middle and slightly to the left of the mediastinum in the chest. The wider t
VASCULA R TISSUES (= FLUID TISSUES) - The vascular tissues are of two types: blood and lymph.
Explain Simple Staining Technique? Here single staining agent is used to determine the size, shape and arrangement of bacterial cells. It is simple and easy to perform. Dried s
Q. Is the internal epithelium of the bowel the alike as it was one month ago? The internal epithelial covering of the intestine acts as means of nutrient absorption and as prot
Explain about functions of the lacrimal apparatus. Tear Secretion Aqueous tears are secreted by the main (reflex secretion) and accessory (basic secretion) lacrimal
Chemical and Heat Burn Chemical born and Heat burn injuries have currently started receiving greater attention. The reason for this is perhaps the degree of discomfort and per
CYTOCHEMISTR Y OF PROTOPLASM - It is supper mixture or mixture of mixtures . 3 4 elements present in it. 1 3 elements are universal. e.g. C, H, O, N, P, K, S,
Cytokinesis in an animal cell: Splitting of the cell is called cytokinesis which starts at telophase. In animal cells, microtubules form a furrow in a ring around the cell.
Q. Show Gastrointestinal Diseases and Disorders? Before discussing the many gastrointestinal problems, it is useful to understand the basic physiology of the gastrointestinal t
Q. Briefly explain about Type Specimens ? The specimens on which the names of the species are based are kept as type specimens. Do not replace these specimens because these wi
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd