Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define the operations of a public nutritionist, Define the Operations of a ...

Define the Operations of a Public Nutritionist? A public nutritionist can perform the following: In the hospital-based set up, she is a part of the team delivering thera

Bio geographical evidence of evolution, BIO GEOGRAPHICAL EVIDENCE- T...

BIO GEOGRAPHICAL EVIDENCE- The patterns of distribution of animals and plants in different parts of the globe are termed as biogeography. It is believed that around carbo

Define general nutritional functions of minerals, Define General Nutritiona...

Define General Nutritional Functions of Minerals? We hear and talk about minerals almost everyday with regards to maintaining good health. But what are minerals and what functi

Human anatomy-physiology , Human anatomy: Human anatomy is a branch of bio...

Human anatomy: Human anatomy is a branch of biology which, with deals with human physiology and biochemistry. It is mainly concerned with the scientific study of the internal stru

Explain the term trans fatty acids, Explain the term Trans fatty acids? ...

Explain the term Trans fatty acids? Plant derived fats and oils contain cis-fatty acids. You may recall reading about the cis and trans isomers in the Nutritional Biochemistry

Illustrate the respiratory system, Illustrate the Respiratory System In...

Illustrate the Respiratory System In general, respiration and breathing are understood to be same. But it is not so. Breathing simply means taking in oxygen from air and giving

What is the principle of the design, In designing an experiment to find out...

In designing an experiment to find out whether light is required for photosynthesis    (a) what is the principle of the design    (b) what control would you use?

How establish a pure-breeding population of brown pigs, Would it be possibl...

Would it be possible to establish a pure-breeding population of brown pigs with a few black spots?

What is pancreas , What is Pancreas ? The pancreas lies in the abdomina...

What is Pancreas ? The pancreas lies in the abdominal cavity in a loop between the stomach and small intestine. The pancreas consists of two major types of cells: those produci

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd