Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
a solution of 5mMol/L CaCl2 is separated from a solution of 1 micromole/L CaCl2 by a membrane that is selectively permeable to Ca+2 but is impermeable to Cl-1 what are the magnitu
pioneers of developmental biology and their contribution
Define the Nutritional shortcomings among the elderly? Nutritional shortcomings are common among the elderly; most often due to poor choice of foods i.e. they may be consuming
Q. Which Foods are used by Microorganisms for Energy? The carbohydrates, especially the sugars, are most commonly used as an energy source, but other carbon compounds can also
Q. How does the hypophysis- corpus luteum negative feedback work? What is the name given to the atrophied corpus luteum after this feedback process? After ovulation the estroge
Provide supporting evidence to explain how conversion of a normal somatic cell into a malignant one requires multiple mutations.
Q. What are the mycorrhizas? How does each participant benefit in this ecological interaction? Mycorrhizas are mutualist ecological interactions between some plants roots and f
The various types and their description of Heart failure are as follows: Left Sided Versus Right Sided Heart Failure Predominantly left sided failure is seen in left ventr
Two major objectives must be achieved to treat IE effectively. The infecting micro-organism in the vegetation must be eradicated. Also, invasive, destructive intracardiac and foca
GENE INTERACTIONS (POST MENDELIAN GENETICS) Phenotypic expression of a gene may be altered by the influence of other genes. The modification of the normal phenotype of certain
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd