Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Determine Causes of Iron Deficiency Anaemia? Dietary Inadequacy Poor bioavailability of iron Presence of absorption interfering substances in diet Poverty and
Indications i) When there is an abnormal rise in the bilirubin level which may be due to physiological or pathological jaundice or any other problem. ii) Prophylactic ph
Genomic libraries are screened by hybridization with a DNA probe which is complementary to component of the nucleotide sequence of the desired gene. The problem should be
Definition of osmosis A) The best explanation of osmosis is 'The movement of water from a dilute solution to a concentrated solution across a partially permeable membrane'.
Direction of Energy Flow Now let us consider the first point that is the direction of flow of energy. Energy flows from lower (producer) to higher (herbivore, carnivore, etc.)
What are the main proteins that constitute the sarcomere? What is the function of those molecules in the muscle cells? In the sarcomere there are organized myosin and actin blo
Explain about Oil-bearing fruits Oil-bearing fruits, nuts and seeds have been grown and used for food for many centuries. More than 100 varieties of plants are known to have oi
Q. What is the use of Uncoated polyvinyl chloride? Uncoated polyvinyl chloride (PVC) and polyvinylidene chloride (PVDC): PVC and PVDC are closely related plastics that are a
What do numeric pyramids represent? Numeric pyramids show the number of individuals in each trophic level of a food chain.
What is scientific investigation?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd