Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Animal biodiversity, discuss why obelia is considered to be of special inte...

discuss why obelia is considered to be of special interest in zoology as an animal showing an intermediate grade of organisation

Appendical skeleton, it consists of the girdles and the skeleton of the lim...

it consists of the girdles and the skeleton of the limbs

Lysosomes, explain polymorphism in lysosomes

explain polymorphism in lysosomes

Hypothetical age pyramids, Hypothetical Age Pyramids The three types o...

Hypothetical Age Pyramids The three types of hypothetical age pyramids which are as follows: 1) A pyramid with a broad base, indicating a high percentage of young individua

How parasitic infections are found, How Parasitic infections are found? ...

How Parasitic infections are found? Parasitic infections are found throughout the world. With increasing travel, immigration, use of immunosuppressive drugs and the spread of A

Define reagents required and methodology for benedict test, Define reagents...

Define reagents required and methodology for Benedict Test? Reagents Required - Sugar solutions of glucose, fructose, galactose, maltose, lactiose, sucrose and starch.

Future - development biology, Future - Development Biology Fertilizati...

Future - Development Biology Fertilization in flowering plants is essential for sustaining life on earth. Production of most crops depends on the effectivity of the fertilisat

Which are the more abundant ribosomes in secretory cells, Which are the mor...

Which are the more abundant ribosomes in secretory cells - the free cytoplasmic ribosomes or those associated with the rough endoplasmic reticulum? Free cytoplasmic ribosomes

Cobalt deficiency, Cobalt deficiency The deficiency of cobalt is more ...

Cobalt deficiency The deficiency of cobalt is more commonly seen in ruminants fed on diets deficient in this essential micronutrient. Cobalt is stored only in limited amounts

Define the techniques of instrument retrieval, Define the Techniques of Ins...

Define the Techniques of Instrument Retrieval Endo Extractor (Brasseler) a. Hollow tube bonded to coronal tip of separated instrument by cyanoacrylate adhesive, with

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd