Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Show the signs and symptoms of implant failure, Q. Show the Signs and sympt...

Q. Show the Signs and symptoms of implant failure? Signs and symptoms of implant failure are : 1.  Horizontal mobility beyond 0.5 mm or any clinically observed vertical move

What are the frequencies of the s, Platinum color in foxes is produced by h...

Platinum color in foxes is produced by heterozygous genotype Ss, and silver foxes are the genotype SS. The genotype ss is lethal, and the fox dies in early embryonic development. I

Why is aids difficult to prevent by vaccination, Q. Why is AIDS difficult t...

Q. Why is AIDS difficult to prevent by vaccination? It is not easy to produce a vaccine against AIDS because the HIV is a highly mutant virus. In approximately every replicatio

Water-soluble vitamins for school children and adolescents, Determine Water...

Determine Water-soluble vitamins needs of school children and adolescents? The suggested requirements are given in Table 15.2 (ICMR 1990). Thiamine is computed as 0.5 mg/1000 K

Determine the term -stolon, Determine the term -Stolon. In a number of ...

Determine the term -Stolon. In a number of colonial cnidarians, ascidians, and lophophorans, a cord of tissue connects different zooids of colony to each other. Buds on stolon

What do you mean by hypertension, Q. What do you mean by Hypertension? ...

Q. What do you mean by Hypertension? Hypertension is one of the major risk factors for cardiovascular disease. It is the most common public health problem and often referred to

Explain faecal coliforms - microbiological study of water, Explain the Faec...

Explain the Faecal Coliforms - Microbiological Study of Water? The faecal coliforms include a wide range of bacteria, many of which are not primarily the intestinal bacteria. T

Placenta - human development, Placenta - Human Development We had said...

Placenta - Human Development We had said previous in the unit that in the second week of development a primitive uteroplacental circulation is established. Early in this stage

Rehabilitation phase for nutritional treatment -neuro trauma, Rehabilitatio...

Rehabilitation Phase for nutritional treatment - Neuro Trauma? Once the patient stabilizes and starts recovering, be sides nutritional replacement, there is a need to assess fu

Skeletal system - arm bones, ARM BONES - Each arm contain 30 bones as ...

ARM BONES - Each arm contain 30 bones as : humerus in upper arm, radius ulna in forearm, 8 carples in wrist, 5 metacorples  in plam, 14 phalnges in fingers. HUMERU

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd