Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What will happen without enough insulin, Q. What will happen without enough...

Q. What will happen without enough insulin? Without enough insulin two things can happen. Firstly, the cells of the body will be unable to use the glucose in the blood for ener

Respiration in cockroach, what is the chemical reaction of respiration in c...

what is the chemical reaction of respiration in cockroach?

Define precautions for simple staining of bacterial cultures, Define Precau...

Define Precautions for Simple Staining of Bacterial Cultures? 1. Heat fix all the bacterial smears. 2. Use clean, grease free glass slides. 3. Wash the stained slide gent

Explain phylogenetically proximal species, Q. Do the phylogenetically proxi...

Q. Do the phylogenetically proximal species have cells with proximal chromosome counts? The number of chromosomes typical of each species is proximal for phylogenetically proxi

Electron transport chain, ELECTRON TRANSPORT CHAIN All processes requir...

ELECTRON TRANSPORT CHAIN All processes require energy. In living cells, we constantly use energy for a number of biochemical reactions e.g. muscular movements, synthesis  of ne

Enumerate about the traumatic brain injuries, Enumerate about the Traumatic...

Enumerate about the Traumatic brain injuries Brain injury is a common result of automobile and industrial accidents and of war injuries. Brain injury can affect brain function

VASCULAR PLANTS., WHAT TRAITS ALLOWED VASCULAR PLANTS TO GROW TALL

WHAT TRAITS ALLOWED VASCULAR PLANTS TO GROW TALL

Explain phylum rhodophyta, Phylum Rhodophyta (Red algae) 1) The photosy...

Phylum Rhodophyta (Red algae) 1) The photosynthetic pigments include red pigments (phycoerythrin) and blue pigment (phycocyanin) apart from chlorophyll, of which red pigment pr

Determine the use of natural colourants, Determine the use of natural colou...

Determine the use of natural colourants The use of natural colourants is limited due to their instability, low tinctorial power or price disadvantage.  The trend towards natura

What is the life cycle of the schistosome, What is the life cycle of the sc...

What is the life cycle of the schistosome? Male and female adult schistosomes live in blood vessels of the human intestines. The females release eggs that trespass the vessel w

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd