Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Uncompetitive inhibition In this type of inhibition, the inhibitor only binds with the enzyme-substrate complex making it inactive. As a result, the product formation
Tuberculosis Tuberculosis is a chronic infectious disease which is caused by a bacterium - Mycobacterium tuberculosis. It affects the lungs most commonly but call gel localize
What is Ancient Gondwanaland? Did you know that the land surface of the earth was once comprised of two super continents called Gondwana and Laurasia? Click on the Multimedia b
What Is the advantage of having a coelomic body cavity
Q. Clinical manifestations of maple syrup urine disease? Clinical manifestations are expressed upon protein loading or with febrile illness. In most severely impaired enzyme de
During a routine annual physical, a patient was checked to determine the amount of glucose in the blood. After the assay, It was found that the glucose that the glucose concentrati
You now know that natural seleqtion aims at evolving adaptations of organisms in response to environmental changes in the inanimate world. Also many adaptations arise due to intera
Q.Define Cardiac catheterization and angiography? The purpose of this unit is to give you an overview and insight into the world of Cardiac Catheterization and Angiography. Thi
Amphibians is the class of terrestrial vertebrates which lay their eggs (and mate) in water but live on land as adults following the juvenile stage where they live in water and br
LIF E AS AN EXPRESSION OF ENERGY CHANGES - Energy is explained as capacity of body to do work. Energy may be as potential (stored) or kinetic (expended) energy. It ex
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd