Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What are dioxins and why they harmful for food safety, Normal 0 ...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

What are primary mediators, Primary mediators are those, which are produced...

Primary mediators are those, which are produced before degranulation. These primary mediators are stored in granules. Some of the primary mediators are histamine, heparin, protease

What is the life cycle of the hookworms, What is the life cycle of the hook...

What is the life cycle of the hookworms? Adult hookworms within the human intestine release eggs that are eliminated with the human feces. Under adequate conditions of moisture

Mechanism of movements, Normal 0 false false false EN-I...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Deoxyribonucleic acid (dna), Deoxyribonucleic acid (DNA) is the nucleic ac...

Deoxyribonucleic acid (DNA) is the nucleic acid composed of two polynucleotide strands wound around the central axis to form a double helix; the repository of genetic information.

What does ecological niche of an organism represent, a) Mention the scienti...

a) Mention the scientific term used for modified form of reproduction in which seeds are produced without fusion of gametes. b) What does ecological niche of an organism represe

Determine the categories of Taxonomic breakdown, For convenience, living th...

For convenience, living things are placed into different groups. Taxonomic breakdown of living things comprises the following categories: Family, Class, Genus, Phylum, Order, K

Describe the experimental approach using the tools, For many of the mammali...

For many of the mammalian Hox genes, it has been possible to determine that some of them are more similar to one of the insect HOM-C genes than to the others. Describe an experimen

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd