Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
what is allele
Or nit h o s i s (psittacosis) This is an important zoonotic bacterial infection and causes disease in humans and birds. Collectively, these conditions are called as chla
Explain Procedure for Performing the Completed Coliform Test? Completed test is the last step in the Coliform test procedure which is described herewith. Conduct the exercise f
Q. What is the lasting form in the gametophyte, pteridophytes or the sporophyte? How can it be compared to bryophytes? The lasting form in pteridophytes is the diploid (2n) spo
Foods that are frequently incriminated in staphylococcal food poisoning include meat and meat products, poultry and egg products, egg, tuna, chicken, potato and macaroni, bakery pr
What is the role of mitosis in growth?
Q. Does the fish heart pump venous or arterial blood? After oxygenation in the gills the arterial blood goes to the tissues so the fish heart pumps venous blood, the venous blo
Explain the Bioavailability of Thiamin? Thiamin is readily available from the gut from food sources (as thiamin phosphate esters). Drugs and alcohol abuse may interfere with th
What are plasmids? The Plasmids are circular DNA molecules present in the genetic material of some bacteria. They may perhaps contain genes responsible for bacterial resistance
Categorisation of Major Brain Functions As a framework, the major brain functions typically divided into modalities and domains. The major modalities are motor function and th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd