Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is Risk scoring ? Risk scoring is an instrument to assess both the relative risk as well as the absolute risk of developing Cardio-vascular disease and mortality in an ind
Classification of Freshwater Ecosystems Fresh water ecosystems depend on the terrestrial ecosystems for large quantities of organic and inorganic matter which are constantly a
Cellular level - Level of body organization The next higher level of organization is the cellular level. This is really an aggregation of cells that are functionally different
During final stage of cell division, mitotic apparatus disappears, chromosomes become attenuated, centrioles duplicate and split, nuclear membrane becomes reconstituted and nucleol
Define requirements of Calcium during pregnancy period? The foetus retains about 25-30 g of calcium, over the course of gestation, most of which is deposited in the last trimes
IN WHAT ASPECT ARE CNIDARIANS SIMILAR TO PROTOZOANS
Q. What are the organs that are part of the male genital system? The organs that comprise the male genital system are the testicles, the vas deferens, the seminal vesicles, the
What is Invertebrates? Invertebrates: About 99% of all the animals lack backbones, and are invertebrates! Invertebrates include the phylum Arthropoda, or the animals with joi
This problem refers to the MN and ABO loci mentioned in class. It also refers to the Rh locus, which is responsible for the positive/negative part of the blood type. The Rh+ allele
Define Mini Nutritional Assessment (MNA) Tool? It is a comprehensive and simple tool, which is able to categorize the subjects into three different categories like well nourish
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd