Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Examine the benefits and risks bird flu research poses to society. Indicate if you believe there are more benefits or more risks associated with this research, and give a rationale
Explain the Oligosaccharides (DP: 3-9) - carbohydrates? Oligosaccharides consists of short chains of monosaccharide units joined by covalent bonds. The glycosidic bond may be α
Purpose of Therapeutic Dietary Adaptations A therapeutic diet is a quantitative/ qualitative modified version of a basic nutritious diet which has been tailored to suit the c
Cell Theory The term cell was first used by an English cytologist, Robert Hooke (1665) not for unit protoplasmic masses, but for the well defined and empty compartments, he obs
THEORIES TO EXPLAIN FINE STRUCTURE OF CHROMOSOME (1 ) Multistranded theory Steffenson 1959 - each chromosome composed of two chromatids (Half Chromosome) and each chromat
how autophagy help in converting a tadpole larva into adult amphibian
In an adult male, which of the following is true? A. The plasma membranes of Leydig cells contain LH receptors. B. The plasma membranes of Sertoli cells contain FSH receptor
Determine the concept of imitation in the learning process The concept of imitation in the learning process is also a key developmental concept for infants and young children
why is it known as middle man
Hans spemann theory
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd