Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Convey information and trends in a convenient fashion, Graphs are a way to ...

Graphs are a way to convey information and trends in a convenient fashion. For this week's Discussion Board you should search the internet for a graph related to biology. Provide u

Describe about the halstead''s discriminating tests, Describe about the Hal...

Describe about the Halstead's discriminating tests Halstead's discriminating tests are viewed as a measure of adaptive abilities, of skills that ensured man's survival on the p

Are there chloroplasts in cyanobacteria, Are there chloroplasts in cyanobac...

Are there chloroplasts in cyanobacteria? In cyanobacteria there are no chloroplasts and the chlorophyll layers are dispersed in cytosol. Which chemical element is central in

Diagnosis and treatment of myocarditis, Diagnosis X-ray chest show...

Diagnosis X-ray chest shows cardiomegaly.  ECG shows conduction defect, low voltage QRS, atrial and ventricular disrhythrnias.  Echocardiogram - decreased LV cont

Explain diseases of pericardium, Q. Explain Diseases of pericardium? Pe...

Q. Explain Diseases of pericardium? Pericardium is the sac covering the heart. Pericardium consists of two layers-the visceral pericardium (epicardium) and the parietal pericar

Preparing financial statements from the work sheet, When the work sheet is ...

When the work sheet is finished all the essential information to prepare the statement of retained earnings, income statement and balance sheet is readily available. Currently you

Define theophrastus of eresus - taxonomy, Define Theophrastus of Eresus - T...

Define Theophrastus of Eresus - Taxonomy The Father of Botany (370-285 B.C.); of all the men who ever lived upon the earth certainly one of the most remarkable was Theophrastu

Wind energy and its advantages and disadvantages, Wind energy         ...

Wind energy            Wind power is one of most cheapest renewable energy sources today. Wind turbines convert the power of wind into electrical energy. Wind occurs due to t

What are the different phenotype, What is the genetic condition in which th...

What is the genetic condition in which the heterozygous individual has different phenotype from the homozygous individual? This condition is called lack of dominance and it can

Intermediate and the definitive hosts of the plasmodium, Q. What are the in...

Q. What are the intermediate and the definitive hosts of the plasmodium? In the life-cycle of the plasmodium humans are the intermediate hosts (where asexual reproduction takes

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd