Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define risk of stress fracture among Athletes? There is an increased risk of stress fracture among athletes which is associated with lower calcium intake and lower bone density
Q. How does sexual reproduction take place in bacteria? How dissimilar are the modalities of bacterial sexual reproduction? Sexual reproduction occurs when bacteria incorporate
Importance of diversity
Theor y of Epigenesis (i) It was proposed by C.F. Wolff & supported by Von Baer. (ii) Wolff proposed that germ cells contain definite but undifferentiated
1. Andalusian chickens may be either black, white, or gray. The gene for black is not dominant over the gene for white, nor is the gene for white dominant over the gene for black.
What is the meaning of Paraplegia Paraplegia (from the Greek para, "alongside of," and plegia, "stroke") is a condition in which both lower limbs are paralyzed (quadriplegia i
Describe Class Agnatha in details? Class Agnatha takes its name from the Greek word "gnathos," which means jaw, and "a," which is the prefix for "without." These jawless fishes
What are plankton, nekton and benthos? Plankton, nekton and benthos are the three groups into which aquatic living beings may be separated. The plankton is formed by the alg
Q. What is the name of the sea anemones and larva of corals? What is the biological importance of that larval stage? Sexual reproduction in sea anemones and corals have a larva
steps of digestive system in amoeba,with a clear picture description
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd