Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Limiting Factor - Ecosystem In all ecosystems one factor, usually abiotic, limits the growth of organisms and is therefore called a limiting factor. The limiting factor is one
list any 15 characteristics of phyla protozoa
Q Why do protease-supplying cells of the stomach and of the pancreas make only precursors of the active proteolytic enzymes? The stomach and the pancreas make zymogens of the p
Which of the following terms best describes calcium metals? Check all that apply. Molecule, element, matter, and compound.
What are mutagenic agents? The Mutagenic agents, or mutagens, are physical, chemical or biological factors that can cause alteration in DNA molecules. Instances of believed
Explain Magnetic Stirrer - Food Microbiology It can be used for mixing ingredients at the time of media or reagents preparation. Mixing happens with spinning of a teflon coat
Q. Why are most ammoniotelic beings aquatic animals? Aquatic animals like crustaceans, amphibian larvae and bony fishes generally are ammoniotelic since ammonia diffuses more e
Explain some important phospholipids The chemical structure of phosphatidylcholine (lecithin) illustrated here in Figure is typical of the phosphatides found in the brai
how fertilization occur in human?
How the blood is circulated with the help of Heart?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd