Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
In vitro Studies - Nutrition of Embryo Studies involving culture of embryos excised of various stages of development (i.e., early globular proembryo, late globular proembryo o
Protoplasmic Streaming and Tubular Peristaltic Flow Model The first of the above two models involves the well known phenomenon of cytoplasmic streaming in giant algal cells. C
Define B-Complex Vitamins required for elderly? B-Complex Vitamins: Various B complex vitamins especially B folic acid, B 6 , and riboflavin are found to affect favourably t
P o x diseases Small-pox in human beings and pox in a few animal species are closely related to each other. It is shown by the fact that the vaccine for the prevention of sma
Define Measuring cylinder - Nutritional Biochemistry? It is used for measuring those reagents which need not be added in very accurate volumes. Strong acids and alkalis are add
Radial Artery (RA) : Patency of RA is less than that of Ih4.A but much superior to a venous graft. One of the studies showed 90 per cent patency at 13 months and 83
What are seed gums? What are its characteristic properties? Seed gums are a group of polysaccharides with the following properties: light to dark cream colored amorphou
Q. What is the relationship between the estrogen level and the LH level in the menstrual cycle? What is the function of LH in the menstrual cycle and when does its blood concentrat
DNA sequencing is the process of reading the nucleotide bases in a DNA molecule. It includes any technology or method which is used to verify the order of the four bases- guanine,
why is obelia considered to of special interest in Zoology as an animal showing an intermediate grade of organisation?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd