Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
The process of fatty acid elongation is similar to fatty acid synthesis as it also requires both: -malonyl CoA and NADPH -malonyl CoA and NADH -Acetyl CoA and NADH
Define Cardiovascular endurance Component for physical fitness? In our previous section on work capacity, concepts of aerobic capacity Vo2 max were described. Cardiovascular en
Define the Water Bath with Shaker? An electric water bath with a shaker that can hold test tubes as well as conical flasks. When on a non-shake mode, it acts as a simple water
Define Malnutrition - Effects on Milk and Effects on Mothers? Milk is the sole source of nourishment for many infants for upto 6 months or a year or even more. Therefore, the r
what is the fate of corpus luteum if egg gets fertilised ?
Explain the Recombinantion of DNA ? Recombinant DNA is made by combining DNA from more than one source - often from very different species. The technique is now the basis fo
Ask question which soil is good
Define Proteins as Enzymes? From conception to death, living cells use oxygen and metabolize fuel. Cells synthesize new products, degrade others, and generally are in a state o
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
What are gene interactions? What are the three main types of gene interactions? The Gene interaction is the phenomenon in which a given phenotypical trait is conditioned by two
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd