Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain about the iron - micro minerals, Explain about the Iron - Micro Min...

Explain about the Iron - Micro Minerals? Iron was a familiar metal even in the ancient civilization. In India, iron implements made their appearance in between 1300-1000 BC and

How identical proteins form, Are proteins with the same number of each diff...

Are proteins with the same number of each different amino acid that form them necessarily identical proteins? Even if many proteins have the similar number of each dissimilar a

Open and closed type of circulatory systems, Open and Closed Type of Circul...

Open and Closed Type of Circulatory Systems There are two categories of circulatory system found in higher metazoans. In one type the original blastocoel carries on to be the

Respiration, how do flatworm and round worms respire?

how do flatworm and round worms respire?

Define the term ancestral characteristic, Define the term Ancestral charact...

Define the term Ancestral characteristic A character shared by all members of a taxonomic group of organisms (taxon) and used to define the unique nature of the group. The cha

What is the etiological agent of amebiasis, What is the etiological agent o...

What is the etiological agent of amebiasis? How is it transmitted and what are the typical manifestations of the disease? Amebiasis is caused by the protozoan Entamoeba histoly

Explain nucleosides, Nucleosides : compounds formed from a nitrogenousba...

Nucleosides : compounds formed from a nitrogenousbase and  a penstose sugar.

What do you understand by open circulatory system, What do you understand b...

What do you understand by Open circulatory system? A circulatory system in which circulating fluid (blood) flows into vessels or tubes not connected to each other by small capi

Symbiotic nitrogen fixers - nutrient cycles, Symbiotic Nitrogen Fixers - Nu...

Symbiotic Nitrogen Fixers - Nutrient Cycles Of the symbiotic nitrogen fixing bacteria, species of Rhizobium form root nodules in legumes and are the most studied nitrogen fixe

Adaptations, what are some adaptations of flatworms

what are some adaptations of flatworms

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd