Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
A v i a n infectious bronchitis (IB) An acute, highly contagious respiratory disease of chicken caused by a member of the family Coronaviridae, IB was first recognized in I
Give a specific example of homeostasis An owl handles its body temperature by burning fuel to make body heat and by fluffing up its feathers to trap an insulating layer of air
Trophic structure Organisms in a community are closely interrelated with each other through feeding relationships. Another aspect which is quite obvious in a community is th
explane the role of nitrogenase enzyme
commercially important bivalve species
What are the plant tissues that constitute the functional structures of the leaf veins? Leaf veins are made of vascular tissues. They are constitute by xylem and phloem that re
When the syndrome sets in at a rapid rate before the compensatory mechanisms become operative, acute heart failure develops. The examples are acute heart failure due to acute myoca
What is Severity and Extent of Lesion in coronaw artery disease? Apart from the high prevalence, the other disturbing features of CAD in South Asians are the severity and exten
Compare the teeth of Australopithecus afaensis and Homo sapiens. a)Describe the similarities and differences between the two species. b) Write a hypothesis about dietary difference
Topical Route The medication in topical route is administered through ear, nose and eye. Drops are instilled into the nose, ear and eyes of the child in much the same way
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd