Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

How does biological diversity relate to the characteristics, How does biolo...

How does biological diversity relate to the characteristics of the abiotic factors of an ecosystem? The availability of abiotic factors as light, moisture, mineral salts, heat

Define sympathetic and the parasympathetic neural actions, Q. What is the a...

Q. What is the antagonism between the sympathetic and the parasympathetic neural actions? In general the action of the parasympathetic and the sympathetic are antagonistic that

Name some emulsifiers which are present in nature, Name some emulsifiers wh...

Name some emulsifiers which are present in nature? There are many emulsifiers which are present in nature such as phospholipids e.g. lectin which is present in egg yolk which a

What is the ecological role of earthworms, Q. What is the ecological role o...

Q. What is the ecological role of earthworms? Earthworms have an important ecological role as they eat decomposing organic material. They also dig tunnels in the subsoil allowi

Metabolism of proteins, The major component of food is protein. The protein...

The major component of food is protein. The proteins ingested as part of our diet are not the same proteins required by the body, nor can large molecules be absorbed from the gut.

What is the difference among plasma membrane and cell wall, Plasma membrane...

Plasma membrane and cell wall is not the similar thing. Plasma membrane, also known as cell membrane, is the outer membrane common to all living cells and it is made of a phospholi

Fructose-1, Fructose-1,6-bisphosphate  and Fructose-6-phosphate : The  conv...

Fructose-1,6-bisphosphate  and Fructose-6-phosphate : The  conversion of  fructose-1,6- bisphosphate  to fructose-6-phosphate is  catalysed by fluctose-1,6-bisphosphatase  which  i

What are the main intraspecific ecological interactions, Q. What are the ma...

Q. What are the main intraspecific ecological interactions? The major harmonious intraspecific ecological interactions are societies and colonies. The major inharmonious intras

Cell and molecular, Compare and contrast the effect of a deletion in the op...

Compare and contrast the effect of a deletion in the operator of the lactose operon with one in the operator of the tryptophan operon.

Calculate the molar concentration of illinic acid, Calculate the molar conc...

Calculate the molar concentration of illinic acid and of its conjugate base illinate ion (in moles/L; M) in a 0.002 M illinate buffer at pH 12.0. The pKa of illinic acid is 6.7. En

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd