Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Compound leaf, Compound leaf is the leaf in which the blade forms small le...

Compound leaf is the leaf in which the blade forms small leaflets. Compound leaves which have several small leaflets originating from the central axis are termed as pinnately comp

Mechanical valves, Mechanical Valves They are made of a combination o...

Mechanical Valves They are made of a combination of metal alloys, pyrolite carbon and dacron. Types of Mechanical Valves Caged-ball Valve (Star-Edwards) A me

Explain huntington disease gene, Research methods used in studying a geneti...

Research methods used in studying a genetic disease change with technological advances. These changes can be seen in Reading 22.1: Discovering the Huntington Disease Gene, which de

Define indicators at the individual level, Define Indicators at the individ...

Define Indicators at the individual level? Number of individuals who have gone hungry through lack of personal food supply, amount of expenditure on food, percent of disposable

Human respiration, Human respiration Human beings are adopted for ter...

Human respiration Human beings are adopted for terrestrial mode of life. They conduct pulmonary respiration. This system consists of external nostrils, nasal cavities, pharyn

Explain regulatory enzymes, Explain Regulatory enzymes Regulatory enzy...

Explain Regulatory enzymes Regulatory enzymes:   Citrate  synthase,  isocitrate  dehydrogenase  and a-ketoglutarate dehydrogenase complex are the key  enzymes which  regulate

Explain severe acute respiratory syndrome, Severe Acute Respiratory Syndrom...

Severe Acute Respiratory Syndrome (SARS) After travelers' diarrhea, respiratory infection is the most common infectious disease affecting travelers. In the winter of 2003 a ne

Zoology, About phylum platy helmenthus

About phylum platy helmenthus

Respiration in insect - cockroach, RESPIR A TIO N IN INSECT (COCKROACH) ...

RESPIR A TIO N IN INSECT (COCKROACH) - Respiration is direct. So metabolic rate is high. This system is related to each cell of the body so respiratory pigment is ab

Define the clinical success for the root canal treatment, Define the Clinic...

Define the Clinical success for the Root Canal Treatment a) Absence of pain and swelling. b) Disappearance of sinus tract. c) No evidence of soft tissue destruction, incl

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd