Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Protozoa., brief account on classification and general characters of protoz...

brief account on classification and general characters of protozoa

Explain penicillin allergy, Penicillin allergy Cefazolin is often used ...

Penicillin allergy Cefazolin is often used for prophylaxis in penicillin-allergic patients, but such patients rarely may have allergic reactions to cephalosporins. When allergy

Marine animals, Marine Animals The composition of body fluids of mari...

Marine Animals The composition of body fluids of marine invertebrates, including the ascidians are similar to seawater. Such animals need not expend much energy in regulating

ANIMAL COMMUNICATION, what is the excitation threshold of a neuron?how does...

what is the excitation threshold of a neuron?how does this threshold relate to the all or nothing rule of neural transmission

Cell Communication, What would the effect be if a cell made defective recep...

What would the effect be if a cell made defective receptor tyrosine kinase protein that were unable to dimerize?

How many carbon dioxide molecules liberated in krebs cycle, Q. How many car...

Q. How many carbon dioxide (CO 2 ) molecules are liberated after each cycle of the Krebs cycle? For a single glucose how many carbon dioxide molecules were already liberated by the

Effects on plants of air pollutants, Effects on plants of Air pollutants ...

Effects on plants of Air pollutants SO 2 , O 3 and NO 2 are strong oxidants and can bring about significant changes in plant cell chemistry. The general effects of pollutant

Homeostasis, HOMEOS T ASI S - Homeo = same,   Stasis = state Li...

HOMEOS T ASI S - Homeo = same,   Stasis = state Living beings maintain their internal environment by self regulating system, it is called homeostasis. Term coined by

Duck plague (duck virus enteritis), Duck plague (duck virus enteritis) ...

Duck plague (duck virus enteritis) Duck plague is the most serious disease caused by a herpes virus (Anatid herpes virus). Though antigenically homogenous, differences in virul

#title, Feeding mechanism in holozoic organisms

Feeding mechanism in holozoic organisms

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd