Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define about the sterols - non glyceride fractions, Define About the Sterol...

Define About the Sterols - Non Glyceride Fractions? These constitule a major proportion of the non-glyceride component while tocopherols, carotene pigments and flavour compound

Define the microbiological study of water, Define the Microbiological Study...

Define the Microbiological Study of Water? Water is a common carrier of infectious diseases. Even clean and clear water which looks pure may be contaminated with pathogenic mic

The permissible use of the technique amniocentesis, The permissible use of ...

The permissible use of the technique amniocentesis is for: 1. detecting sex of the unborn foetus 2. artificial insemination 3. transfer of embryo into the uterus of the su

Social Status and Support Network, Social Status and Support Network ...

Social Status and Support Network Income and Social Status: Higher income and social status lead to better health.Employed persons, having more control over their workin

To study if bacteria grow better where it is dark or light, To study if bac...

To study if bacteria grow better where it is dark or light Inoculate two sterile dishes as before. Label one 'dark' and the other 'light'. Place the 1st dish in a darkwarm plac

Fertilisation, Explain how the uterus supports the development of a baby du...

Explain how the uterus supports the development of a baby during gestation

Regernation, Give ditail account on regernation in invertebrates and verta...

Give ditail account on regernation in invertebrates and vertabrites

Explain physical properties of an oil, Explain Physical properties of an oi...

Explain Physical properties of an oil Physical properties of an oil or fat are of critical importance in determining its functional characteristics or use in food products. One

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd