Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
lesson plan practical requirements
Microbial polysaccharides Many microorganisms produce polysaccharides that either remain attached to the cell wall (capsular polysaccharides) or are secreted into the extracel
In vivo imaging in psychiatry To illustrate the ingenious applications to which in vivo imaging can be put, consider the use of PET in the study of hallucinations by Frith and
Detritus Food Chains Detritus food chains begin with dead organic matter which is an important source of energy. A large amount of organic matter is contributed by the death o
Explain Point Mutations gene? Mutations involving single genes occur by addition, substitution, or deletion of a single base in DNA. Such mutations, called point mutations, ca
C o l l i ba c i ll o si s It is commonly seen in newly born farm animals and occurs in septicaemic and enteric collibacillosis forms. E tiology: The disea
ROLE OF FAT OR LIPIDS - Made up of fatty acids & glycerol. Linked by ester bond. Maximum quantity of energy is librated. Helpful in temperature regulation. As stored f
Ingestion of Foreign Bodies: As we know that small children are curious and innocence children are notorious for inserting various object into their orifices like mouth, nos
when pollen tube enters the embryo-sac,it has;
In about 80 per cent of ARF patients, ASO titre is significantly raised. ASO titres vary with age, geographical area and other fevers, which influence frequency of streptococcal in
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd