Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Nuclear transfer method for gene transfer, Nuclear transfer method: Nucle...

Nuclear transfer method: Nuclear transfer will extend the range of species in which gene targeting will be possible and thereby provide better models to test treatments for human

, comparitive table to explain the differences between the animals in chor...

comparitive table to explain the differences between the animals in chordate classes

State the term - focal seizures, State the term - Focal Seizures A foca...

State the term - Focal Seizures A focal seizure begins in one place and then spreads. As for example in a Jacksonian focal seizure, the attack begins with jerking movements in

Define method used for capsular staining - anthony staining, Define method ...

Define method Used for Capsular Staining - Anthony Staining Method? Another method used for capsular staining is Anthony staining method, devised by E.E. Anthony in 1931. The m

Explain the equilibrium dialysis, Explain the Equilibrium Dialysis? Equ...

Explain the Equilibrium Dialysis? Equilibrium dialysis is a useful technique for studying the binding of a small uncharged solute species (a ligand) to a macromolecule. The mac

Photosynthesis, discovery of two light phase in photosynthesis

discovery of two light phase in photosynthesis

Historically what were the two main evolutionary theories, Historically wha...

Historically what were the two main evolutionary theories? The two major evolutionary theories were darwinism and lamarckism.

What is the relevance of knowing about gi of foods, What is the relevance o...

What is the relevance of knowing about GI of foods? Let us see how this index is helpful in prescribing therapeutic diets. You would realize that the dietary GI provides an ind

Explain about the energy requirements in elderly, Explain about the Energy ...

Explain about the Energy Requirements in elderly? Based on the Benedict - Harris equation for men and women, the daily energy requirements can be calculated. For Men: 66 t

#title.circulatory system, #question.what is the mechanism of circulatory s...

#question.what is the mechanism of circulatory system .

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd