Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain about the Obliques muscles The superior and inferior oblique muscles form an angle of about 51 0 with the optical axis. The oblique muscles produce cyclorotation becau
Carrier Based Gutta percha Removal “therma-fill” If the cone the carrier is metal and has cutting flutes that are engaging lateral dentin the instrument retrieval system (IRS)
Nutrient Availability You have seen that cation exchange plays an important part in nutrient availability to plants. Cation exchange functions in two ways as nutrients are rele
NEO DARWINISM OR SYNTHETIC THEORY OF EVOLUTION - It is the synthesis of the ideas of Neo Darwinians as a new theory of evolution based upon recent findings of genetics and m
An enzyme isolated from a mutant bacterium grown at 20 degrees celsius works in a test tube at 20 degrees celsius but not at 37 degrees celsius( 37 degrees celsius is the temperatu
Which of the following occur in response to an increase in the length of the right knee extensors in response to a quick tap applied to the right patellar tendon? An increase in t
Armamentarium 1. Denture duplicator or a modified plastic soapdish. (A plastic large soapdish with a base and cover can be adapted by drilling 2 mm holes interspersed and cover
Explain the Chemical Methods for Control of Microorganisms? Different chemicals can be used which can act as disinfectant, antiseptics or even chemical sterilants. These are:
Explain the Rotary Dryers? Rotary dryers are widely used to dry relatively large throughputs of granular products and by products in a number of industries, including the food
PAEDIATRIC NURSING Parent education, family health promotion and health maintenance have been the concern of yesterday's and today's nurses. Florence Nightingale over a hu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd