Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define advantages of using yeast as a source of protein, Define Advantages ...

Define Advantages of using Yeast as a source of Protein? 1. Large size, hence separation from the culture medium is easy. 2. As the pH of the growth is towards acidic side,

Non-rapid-eye-movement sleep, Stage 1 sleep: As an individual becomes drows...

Stage 1 sleep: As an individual becomes drowsy, and enters stage 1, alpha wave decreases and theta waves appear. Theta waves with a frequency of about 6 to 8 cycles per second are

Explain process of selection of taxonomic characters, Explain process of Se...

Explain process of Selection of taxonomic characters Selection of taxonomic characters Eventually classification systems may be based almost entirely on direct study of th

General preventive measures for animals, GENERAL PREVENTIVE MEASURES - ...

GENERAL PREVENTIVE MEASURES - 1.      Infected animal should be immediately isolated and looked after. 2.      The premises should be disinfected whenever there is an outbre

Explain about monocot plants and dicot plants, What are the major morpholog...

What are the major morphological differences between monocot plants and dicot plants? The main differentiation criteria among monocots and dicots are: number of cotyledons (see

Explain spray-drying method, Spray-drying method Spray-drying is the co...

Spray-drying method Spray-drying is the common drying method in the production of ISP. The primary physical form of ISP in commerce, is that of fine powders. Structured form

What is genes duplication, What is genes Duplication ? Duplication of g...

What is genes Duplication ? Duplication of genes can happen when a portion of a chromosome breaks off and attaches itself to the end of its homologous chromosome, as seen below

Avian tuberculosis, A v i a n tuberculosis Tuberculosis in poultry ...

A v i a n tuberculosis Tuberculosis in poultry has not remained a big threat in list of diseases due to commercialization of poultry business. It is a contagious chronic di

The skin., what is the function of cornified layer of the skin

what is the function of cornified layer of the skin

Explain the function of the umbilical cord, Q. What is the function of the ...

Q. What is the function of the umbilical cord? The umbilical cord is a set of blood vessels that connects the fetus with the placenta and in the fetus one extremity of the cord

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd