Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Many definitions of species have been offered, but none of them proved to be satisfactory. The definitions did not categorically provide the basis to decide whether two similar gro
What are the factors to an actual shift in the supply curve? Factors which cause an actual shift in the supply curve are described in below: When prices rise or fall this wo
Q. Pathology of aortic regurgitation? In Post Inflammatory situations scarring and retraction of valve cusps lead to aortic regurgitation. Varying degrees of commissural fusion
How are the plant tissues classified according to their functions? Plant tissues are separated into growth (embryonic) tissues, supporting, filling and photosynthetic tissues (
Q. What is Short Bowel Syndrome? Short bowel syndrome is a group of problems affecting people who have /had half or more of their small intestine removed. The massive resection
How is a disease-resistant plant selected for successful breeding? Why is the process of fertilisation in a flowering plant referred to as double fertilisation? Explain. Nam
P a ck a g i n g of Meat Products Meat needs to be packaged to prevent contamination, color deterioration, loss of moisture, odor pickup, oxidative rancidity etc and pro
Cells regulate their level of activity by regulating the amount of proteins present in the cell at any given time, so an up regulation of enzymes would be expected to A. increase t
what is the necessity of interdependence of a volvox organism in the colonial existence?
Stomatal Resistance Stomatal resistance is most important because gas exchange between leaves and external atmosphere takes place entirely through stomatal pores. Stomatal res
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd