Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Ask question #Minimum 100 words what is joint accepted#
Explain the Obligatory Losses of Nutrients? Obligatory losses of nutrient are defined as 'the losses that occur when an individual is put on a diet free of that nutrient'. For
Describe the Stages of Atherosclerosis ? The process of atherosclerosis which gives rise to CAD marches in stages. The earliest recognizable pathologic lesions are the fatty st
Benefits of Cross-Pollination Because of the specific benefits of cross-pollination, flowering plants have evolved many devices to prevent self-pollination and to encourage cr
A decrease in blood plasma levels of parathyroid hormone A. occurs in response to an increase in the levels of calcium ions in blood plasma. B. leads to an increase in the a
Q. Why can the amphibian circulation be classified as incomplete and double? The amphibian circulation is double because it is composed of pulmonary and systemic circulations r
How does facilitated diffusion present similarities with enzymatic chemical reactions? One of the main examples of facilitated transport is the entrance of glucose from the blo
Eutrophication "Runaway" growth of the aquatic plants which takes place when agricultural fertilizers containing the phosphorus and nitrogen run off into lakes and ponds; also ult
How are roots affected by water? Grow some seedlings in single end of a glass dish or pan. When they are about 5 cm tall start watering them on one side only and a little dista
what does ICZN stand for
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd