Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Thermodynamics and cell shapes, Thermodynamics and Cell Shapes Why are...

Thermodynamics and Cell Shapes Why are protoplasts (cells devoid of cell wall) spherical? Why are most of the unicellular organisms (prokaryotes and eukaryotes) spherical? A s

Heart, Septa prevent oxygenated and deoxygenated blood. Give reason

Septa prevent oxygenated and deoxygenated blood. Give reason

Illustrate the types of Bone Remodeling, Illustrate the types of Bone Remod...

Illustrate the types of Bone Remodeling Bone remodeling occurs on existing bone surfaces. However, unlike modeling, remodeling cannot cause large changes in bone structure at a

How does the contraceptive diaphragm work, Q. How does the contraceptive di...

Q. How does the contraceptive diaphragm work? What are the limitations of this contraceptive method? The contraceptive diaphragm is an artifact made of plastic or latex that wh

Explain glycophorin, Since erythrocytes  red blood cells do not hold any su...

Since erythrocytes  red blood cells do not hold any sub cellular  organelles they are essentially  a membranous  sac for carrying  haemoglobin their plasma membrane  is a convenien

Which are the specialized conductive tissues of the plants, Which are the s...

Which are the specialized conductive tissues of the plants? The vascular tissues of the plants are the xylem and the phloem. Xylem is the plant tissue that forms the vessels t

What is the dna vaccine, Q. What is the DNA vaccine? The DNA vaccinatio...

Q. What is the DNA vaccine? The DNA vaccination or is a vaccination technology based on genetic engineering. In DNA vaccine a recombinant plasmid (vector) containing the gene o

Define the word solute, Define the word solute A solution is a homogeno...

Define the word solute A solution is a homogenous mixture of two or more different substances. For instance salt in water form a solution. This means that the dissolved subs

Explain the parental gametes and recombinant gametes, In genetic recombinat...

In genetic recombination by crossing over what is the difference between parental gametes and recombinant gametes? Parental gametes are those gametes that keep the original lin

Skin, what is the advantage of being dark skinned?

what is the advantage of being dark skinned?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd