Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

The warmest parts of the body?, What are likely to be (a) the coldest, (b) ...

What are likely to be (a) the coldest, (b) the warmest parts of the body? The extremities of the body (hands and fingers, feet and toes, ears and nose) are likely to be the col

Define solvent chemical potentials from phase equilibria, Define Solvent Ch...

Define Solvent Chemical Potentials from Phase Equilibria? Previously explained how we can evaluate the activity coefficient γ m,B of a nonelectrolyte solute of a binary soluti

How much salt is in the human body, How much salt is in the human body? ...

How much salt is in the human body? 50 Kilo human has about 7 tablespoons of salt inside there body.

How does self infection by tapeworms occur, How does self infection by tape...

How does self infection by tapeworms occur? Taeniasis patients might be develop the most severe form of the worm infection, cysticercosis, because their feces have eggs and pre

What is physical activity ratio, What is Physical activity ratio? Physi...

What is Physical activity ratio? Physical activity ratio (PAR): The energy cost of an activity per unit of time (usually a minute or an hour) expressed as a multiple of BMR. It

Recombinent DNA, any interesting information about recombinent DNA

any interesting information about recombinent DNA

What is connective tissue proper, What is connective tissue proper? The...

What is connective tissue proper? The name connective tissue proper is used to assign the connective tissue that fills interstitial spaces as opposed to the specialized connect

What is recombination frequency?, What is recombination frequency? The ...

What is recombination frequency? The Recombination frequency, or crossing over rate, is the percentage of recombinant gametes made by crossing over (in relation to the number o

Describe the procedure of femoral approach, Q. Describe the procedure of fe...

Q. Describe the procedure of femoral approach? The catheter is inserted into the femoral sheath and advanced to the level of the left mainstem bronchus over the guidewire. Aft

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd