Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Insulin is released into the bloodstream by the β cells of the pancreas when blood glucose stages are high after feeding and stimulates glycogen synthesis to kept exces
Open Pulmonary Valvotonzy, I nfundibular Resection and Trans Annular Patch : The pulmonary annulus may be narrow based on pre-operative investigations and on measurement
Anomalies Related to Oral Cavity Under these anomalies we will briefly discuss the cleft lip and cleft palate. You must have seen and/or nursed a baby born with a cut on
Define Recommended Dietary Allowance for riboflavin (RDA)? Several nutritional and physiological factors govern riboflavin requirements. Negative nitrogen balance reduces rib
LYSOSOMES Like mitochondrial lysosomes are also typical membrane bound and dense fluid filled sac like cytoplasmic organelles of all eukaryotic cells these however, diffe
what is its working
Reproductive health disorders to dairy livestock accounts to a loss of about Rs 30,000- 50,000 crore annually to the nation. Better herd management can minimize the occurrence of d
How sugar play a major role in preservation? In so many products, sugars play a major role in preservation. The addition of monosaccharides, like glucose or fructose, to jams a
A glycogen molecule having entirely of glucose units, many of that are linked in long chains through α1-4 bonds. Furthermore, every 10 units or so, the chain is branched
Explain the Superficial Minor Burns? Superficial minor bums are immersed immediately in cool water if possible. The burn is carefully cleaned to prevent infection. If dirt is d
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd