Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Morphology: It deals with external forms, structure and the relative position of various organs of living beings. Morphology is a branch of bioscience which dealing with the study
Climax Stage - Hydrarch A variety of trees invade the woodland community which soon develop into the climax community. The nature of the climax is dependent upon the climate o
Symptomatic patient: Symptomatic patient (class 11, 111 or IV) with severe MR and normal left ventricular function (EF > 0.6) and end systolic dimension of LV
Define the Parenteral Nutrition Support? Parenteral nutrition support is the provision of dextrose, amino acids, electrolytes, vitamins, minerals and trace elements with or wit
Perceptual Disorders The procedure actually constitute a sub-battery and include tests of the subject's ability to recognise shapes by touch and identifies numbers written on t
During mitosis ER and nucleolus begin to disappear at: 1. Late prophase 2. Early metaphase 3. Late metaphase 4. Early prophase Late prophase
Q. What is the anoxia? Anoxia is a situation in which there is no available oxygen in the cell without oxygen the respiratory chain stops there is no ATP production the cell do
International support to control HPAI and other TADs In 2008, a new global approach called "One World, One Health" was defined by the four international technical agencies, i.e
Q. Haemodynamics of Tricuspid regurgitation? Right Atrial pressure tracing shows a prominent ‘v' wave and these cannot be appreciated in a patient with atrial fibrillation. RV
From your studies in ecology, you must be aware that most ecosystems are quite complex consisting of several habitats and that habitats in turn are composed of microhabitats. Each
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd