Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define the Acute Phase of spinal trauma Disease? Nutritional support should start within 3-5 days or as early as possible to prevent the onset of malnutrition and secondary il
which is the last enzyme in the thrombotic system?
IRON It is present in bread, potatoes, green vegetables, especially spinach, lettuce, cocoa, raisins, red meat, liver, kidney, egg yolk etc. Iron is also available in the bo
breathing in animals
Ventricular Assist Devices : These come handy when IABP has failed or when prolonged circulatory support is needed. Now Ieft ventricular (LVAD), right ventricular (RVAD) and bive
Q. What are the main limiting factors for the growth of a population? The factors that bound the growth of a population can be divided into abiotic factors and biotic factors.
Q. Besides the liver which is the other adnexal gland of the digestive system that releases substances in the duodenum participating in extracellular digestion? The other adnex
Explain the Properties gum karaya Gum karaya is water-swellable rather than water-soluble and absorbs water very rapidly to form viscous colloidal dispersions at low concentra
Enumerate in detail about the Cytoskeleton All eukaryotic cells have distinct shapes, and are also capable of assuming different shapes. 'The internal organelles of a cell are
Restriction of physical activities to reduce myocardial work and oxygen consumption. However, care should be taken to prevent deep vein thrombosis. - Oxygen administration in dy
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd