Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define the meaning of isomerism, Define the Meaning of Isomerism? All m...

Define the Meaning of Isomerism? All monosaccharides exhibit isomerism. An asymmetric carbon or chiral carbon contains four different groups attached to it. The formula 2 n de

Estimation of protein by miscellaneous parameters include, Estimation of pr...

Estimation of protein by Miscellaneous parameters include? Miscellaneous parameters include Plasma amino acid levels Microbiological methods Chemical scoring

What are dopaminergic neurons, Q. What are Dopaminergic neurons? Dopam...

Q. What are Dopaminergic neurons? Dopamine Dopaminergic neurons occur in two closely connected groups: Ventral tegmental area (VTA) of the midbrain and Substantia nigra,(i

Puberty, how does the hypothalamus begin puberty

how does the hypothalamus begin puberty

Show major groups into which mammals are divided, Q What are the three majo...

Q What are the three major groups into which mammals are divided? The three groups into which mammals are divided are: monotremes (or prototherian that is platypus), placental

Radiobiology, Radiobiology : This is the study of effects of radiations on ...

Radiobiology : This is the study of effects of radiations on living organisms. Radiobiology is a branch of science which concerned with the action of ions. Radiobiology is the radi

Echinoderms, simplest way to learn their classifiction

simplest way to learn their classifiction

Health and economic development - linkage and impact, Health And Economic D...

Health And Economic Development - Linkage And Impact It is apparent that the relationship between health and development is a two wayprocess. While healthy people in a country

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd