Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Is crossing over important for the diversity of biological evolution? Sexual reproduction and recombination of linked genes (crossing over) are, with mutations, the main instru
Do moulds grow better where it is dark or light? This time leave one culture dish in a warm place where it receives light all the time. Place the other dish in a warm dark plac
Q. Why can be the consumption of molecular oxygen indicates the metabolic rate of aerobic organisms? Molecular oxygen (O 2 ) consumption has direct relation to the cell metabol
Diplotene: The paired chromosomes repel each other and begin to separate. Separation however, is not completed, because homologous chromosomes remain united by their point
The next step in the nitrogen cycle is the assimilation of inorganic nitrogen in the type of ammonia into organic nitrogen-having compounds. Total organisms assimilate ammonia by
Floor of nose and Nasal spine Although variable, the nasal floor is typically situated 5-9mm below the level of inferior turbinates. The inferior piriform rim is used as a guid
The patient will appear anxious and dyspnoeic. Patients in chronic heart failure are usually malnourished and even cachectic. Chronic passive venous congestion may produce exophtha
Synthesis of Polyamine As the name of this class of compounds suggests, polyamines have several amino groups replacing hydrogen usually in alkyl chain e.g., putrescine is 1, 4
What is the function, other than protection, of the ribs? The ribs help to alter the volume of the thorax during breathing movements.
How much of a 10% w/v of nacl can be made using 30g of nacl? Please show all steps.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd