Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain acute infections fever, Explain Acute Infections Fever Acute In...

Explain Acute Infections Fever Acute Infections Fever:  Acute fevers are of short duration with acute symptoms, the body temperature may rise to above 104°F. Examples of such i

Determine the uses of potassium, Determine the uses of Potassium Water ...

Determine the uses of Potassium Water soluble and exchangeable potassium is readily available to plants. This is extracted with Morgan reagent (10% sodium acetate in 3% acetic

Are environmental phenotypical changes, Are environmental phenotypical chan...

Are environmental phenotypical changes transmitted to the offspring? Changes caused on phenotypes by the environment are not transmitted to the offspring (unless their primary

Define the criteria for assessment of thiamin status, Define the Criteria f...

Define the Criteria for Assessment of Thiamin Status? Thiamin status has been assessed by measuring urinary thiamin excretion under basal conditions or after thiamin loading, t

Iaa stimulates cell enlargement, IAA Stimulates Cell Enlargement Cell...

IAA Stimulates Cell Enlargement Cell wall contains layer of cellulose fibrils and are normally quite rigid. Thus for a cell to grow, there must be a mechanism for relaxing th

Breathing and airway - initiation of cpr, Airway: Place the patient  s...

Airway: Place the patient  supine on a firm  surface with his  head at level  or  slightly lower than the level of heart. Immediately, clear the  airway and start  rescue brea

Energy flow - ecosystem, Energy Flow - Ecosystem Our world is a solar-...

Energy Flow - Ecosystem Our world is a solar-powered system, and green plants are the entry gates of energy into ecosystem. The total incoming solar energy, only a very small

Subphylum mastigophora, Subphylum Mastigophora One or more flagella p...

Subphylum Mastigophora One or more flagella present in adult stages; autotrophic or heterotrophic nutrition; reproduction usually asexual by fission. Class - Phytomasti

Explain biomaterial implantation, Explain biomaterial implantation When...

Explain biomaterial implantation When a biomaterial is introduced into the host, in addition to a host response there is also a material response. Immediately on implantation,

Haemodynamics of tricuspid regurgitation, Q. Haemodynamics of Tricuspid reg...

Q. Haemodynamics of Tricuspid regurgitation? Right Atrial pressure tracing shows a prominent ‘v' wave and these cannot be appreciated in a patient with atrial fibrillation. RV

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd