Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Effects on plants of Air pollutants SO 2 , O 3 and NO 2 are strong oxidants and can bring about significant changes in plant cell chemistry. The general effects of pollutant
multiple choice question
Pectin The word pectin is derived from a Greek word which means to "congeal or solidify". Pectin is an acidic structural polysaccharide, found in fruit and vegetables and mainl
Oxidation of succinate to fimarate: This reaction is catalyzed by succinate dehydrogenase and FAD' is needed as a cofactor. Malonate, structural of succinate, competitively
What is the digestive enzyme that acts within the stomach? Which type of food does it digest? What are the cells that produce that enzyme? The digestive enzyme that acts in the
HACCP Plan : The written document which is based upon the principles of HACCP and which delineates the procedures to be followed.
what are the disadvantages of protozoa
scientific names of animals
Explain Changes in Mental Development of Infants? There is evidently an increase in the brain size. There is a rapid increase in the number of brain cells in the first 5-6 mont
Define Water soluble Vitamins - B complex Vitamins and Vitamin C? Vitamins are essential nutrients found in foods. The requirements are small but they perform specific and vit
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd