Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Most Probable Number (MPN) Method? The MPN method is like agar shake tube method where no agar is used. The dilutions of the microbial suspension are made in liquid medi
Endocrine glands Endocrine glands have no ducts - so these are also called as ductless glands Eg.Pituitary etc., These glands secrete chemical substances called HORMONES
Insulin promotes muscle glucose uptake and metabolism. In presence of insulin muscle cells take up glucose and use it as a source of energy. Insulin also promotes storage of insuli
what are phylums included in aceolomates?
Phase (different interference) Contrast microscopy: Living cells are mostly transparent. For viewing under ordinary light microscope, therefore, live cells must be stained wi
What is Pancreas ? The pancreas lies in the abdominal cavity in a loop between the stomach and small intestine. The pancreas consists of two major types of cells: those produci
all about spleen
What is predatism? Predatism is the ecological interaction in which one individual mutilates or kills another to get food. Predatism is an inharmonious (negative) ecological i
classification of invertebrate
Define Absorption, Storage and Elimination of Riboflavin? Riboflavin is absorbed from the small intestine through the portal vein and is passed to all tissues via general circu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd