Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Determine the high blood plasma levels of insulin, A patient has total dest...

A patient has total destruction of all of the beta-islet cells of the pancreas.  Prior to receiving treatment, this patient will have A. high blood plasma levels of glucose.

Physical map, Physical map is the map of locations of the identifiable lan...

Physical map is the map of locations of the identifiable landmarks on DNA (for example restriction of the enzyme cutting sites, genes), regardless of their inheritance. Distance i

Mitoses and meosis, how do mature sperm differ from those that are not full...

how do mature sperm differ from those that are not fully developed

To test the effects of temperature on the activity of yeast, To test the ef...

To test the effects of temperature on the activity of yeast Make up a quantity of bread dough .Stir a yeast cake in water and methodically mix the yeast with the dough. Divide

Enumerate the term - pathognomic sign, Enumerate the term - pathognomic sig...

Enumerate the term - pathognomic sign A comprehensive assessment ideally uses all four approaches. Some forms of specialised assessment rely heavily on pathognomic signs, behav

Determine the symptoms of bacillus cereus, Determine the Symptoms of bacill...

Determine the Symptoms of bacillus cereus Extremely large numbers (10 8 per gram) of viable cells of B. cereus must be ingested to develop signs and symptoms of the syndrome.

Defina about the lipid metabolism, Defina about the Lipid Metabolism? A...

Defina about the Lipid Metabolism? Animal studies consistently show a hypotriglyceridenlic effect although equivocal results have been seen with healthy humans. Hypotriglycerid

Infectious and inflammatory conditions for lymphatic system, Q. Why in infe...

Q. Why in infectious and inflammatory conditions may clinical signs related to the lymphatic system occur? The lymph nodes or lymph glands have lymphoid tissue that produces ly

Biodiversity and economics, With the survival and well-being of humans bein...

With the survival and well-being of humans beings so heavily dependent on biodiversity, its economic value assumes considerable importance. For instance the economic value of ecosy

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd