Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
ENDOPLASMIC RETICULUM It is also known as Endoskeleton of the cell, Endomembranous system of the cell. Garnier (1897) first observed them and called Ergastoplasm. E.R.
Define the Nutritional shortcomings among the elderly? Nutritional shortcomings are common among the elderly; most often due to poor choice of foods i.e. they may be consuming
Transmission electron microscopy: Around 1931-32 two German scientists. Knoll and Ruska. Invented transmission electron microscopy, and built the first transmission electron m
Q. What is ST Elevation? Although a stable LV aneurysm may manifest ST-segment elevation in the precordial leads at rest. Some subjects with normal hearts show a degree of elev
How we attempt a question of phylum mollusca?
Manual and Automatic Toothbrushes Brushing is imperative and soft or medium toothbrushes are recommended. Small heads are useful because they allow better access. Automatic too
Q. Show Measurement of mitral valve? Measurement of mitral valve and gradients across mitral valve are of importance in clinical decision making. Mitral valve area can be measu
Explain the Nutrition of Women during Pregnancy? During the post-war years, the people in the developed world recognized that women were at a disadvantaged position and felt th
Q. Conditions Necessary for Outbreak in salmonellosis? The food must contain or become contaminated with the Salmonella bacteria. These bacteria must be there in considerable n
Define Pre-Exercise or Pre-Event Meal for athletes? Suitable foods in adequate quantities at all times should be consumed but before the event, strategies to fuel up the energ
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd