Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is the meaning of Obesity? Obesity is a condition resulting from accumulation of excess body fat. The fat deposition takes place because over a period of time, people cons
Q. Dietary management of gastritis? Prompt medical care is successful in the management of an acute attack of gastritis only if it is accompanied by efficient and judicious nut
classification
In the process of tissue culture in plants, what is required to induce the formation of a complete plant, in addition to a growth medium with nutrients? The appropriate p
Radial Artery (RA) : Patency of RA is less than that of Ih4.A but much superior to a venous graft. One of the studies showed 90 per cent patency at 13 months and 83
Classes of Life Form The five life form classes are: Phanerophytes, Chamaephytes, Hemicryptophytes, Cryptophytes, and Therophytes.
The neurotransmitter found in insects that is similar to dopamine is?
Maturation Phase The Maturation phase characterizes he transformation of diploid primary spermatocytes into haploid spermatids. The primary spermatocyte divides meiotically t
Problem 1: What is Placebo and Nocebo? Describe the significance of Placebo in clinical trials. Definition of placebo and Nocebo Significance of Placebo in clinical t
Determine the Functions of Vitamin C? The vitamin C is involved in several physiological and biochemical functions in the body. Ascorbate is the biochemically active form of t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd