Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What will happen without enough insulin? Without enough insulin two things can happen. Firstly, the cells of the body will be unable to use the glucose in the blood for ener
what is the chemical reaction of respiration in cockroach?
Define Precautions for Simple Staining of Bacterial Cultures? 1. Heat fix all the bacterial smears. 2. Use clean, grease free glass slides. 3. Wash the stained slide gent
Q. Do the phylogenetically proximal species have cells with proximal chromosome counts? The number of chromosomes typical of each species is proximal for phylogenetically proxi
ELECTRON TRANSPORT CHAIN All processes require energy. In living cells, we constantly use energy for a number of biochemical reactions e.g. muscular movements, synthesis of ne
Enumerate about the Traumatic brain injuries Brain injury is a common result of automobile and industrial accidents and of war injuries. Brain injury can affect brain function
WHAT TRAITS ALLOWED VASCULAR PLANTS TO GROW TALL
Phylum Rhodophyta (Red algae) 1) The photosynthetic pigments include red pigments (phycoerythrin) and blue pigment (phycocyanin) apart from chlorophyll, of which red pigment pr
Determine the use of natural colourants The use of natural colourants is limited due to their instability, low tinctorial power or price disadvantage. The trend towards natura
What is the life cycle of the schistosome? Male and female adult schistosomes live in blood vessels of the human intestines. The females release eggs that trespass the vessel w
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd