Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain Acute Infections Fever Acute Infections Fever: Acute fevers are of short duration with acute symptoms, the body temperature may rise to above 104°F. Examples of such i
Determine the uses of Potassium Water soluble and exchangeable potassium is readily available to plants. This is extracted with Morgan reagent (10% sodium acetate in 3% acetic
Are environmental phenotypical changes transmitted to the offspring? Changes caused on phenotypes by the environment are not transmitted to the offspring (unless their primary
Define the Criteria for Assessment of Thiamin Status? Thiamin status has been assessed by measuring urinary thiamin excretion under basal conditions or after thiamin loading, t
IAA Stimulates Cell Enlargement Cell wall contains layer of cellulose fibrils and are normally quite rigid. Thus for a cell to grow, there must be a mechanism for relaxing th
Airway: Place the patient supine on a firm surface with his head at level or slightly lower than the level of heart. Immediately, clear the airway and start rescue brea
Energy Flow - Ecosystem Our world is a solar-powered system, and green plants are the entry gates of energy into ecosystem. The total incoming solar energy, only a very small
Subphylum Mastigophora One or more flagella present in adult stages; autotrophic or heterotrophic nutrition; reproduction usually asexual by fission. Class - Phytomasti
Explain biomaterial implantation When a biomaterial is introduced into the host, in addition to a host response there is also a material response. Immediately on implantation,
Q. Haemodynamics of Tricuspid regurgitation? Right Atrial pressure tracing shows a prominent ‘v' wave and these cannot be appreciated in a patient with atrial fibrillation. RV
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd