Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Female reproductive system of frog: i) Ovaries : a) There are a pair of ovaries present in the abdomen. b) They are grayish or blackish in colour. c) There are numerous cham
We now understand that mutations that cause the inhibition of apoptosis are found in tumors. Because proliferation itself is not induced by the inhibition of apoptosis, explain how
An mRNA molecule codifies only one type of protein? Eukaryotic cells have monocistronic mRNA, i.e., every mRNA codifies only one polypeptide chain. Prokaryotes can present poly
Enumerate the absolute and relative contraindications. 1. Absolute contraindications - Recent myocardial infarction - Valvular prosthesis - Severe renal disea
Plate Tectonic Is a Theory of Geology Which describes the large scale motion of earth's lithosphere. The theory builds on the older theory of continental drift from the first half
#question.what do u mean by parasitic habit.give account of various parasitic adoptation in animal.
Q. Etiological factor of gastritis? Some most frequently associated risk factors for gastritis include: • Faulty dietary habits like overeating and taking highly seasoned fo
How do the cheek and onion cells visually resemble one another, and why are shapes of squamous cells so different than the onion cells?
Briefly explain about Food preservation Food preservation, as you are aware, is the process in which the perishable food materials are given a suitable physical or chemical t
Alimitation of five kingdom classification sk question #Minimum 100 words accepted#
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd