Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain the indications for neuropsychological screening, Explain the Indic...

Explain the Indications for neuropsychological screening Nature of referral question warrants it. Situational explanation for changes in emotions or cognitive functioni

Can you illustrate chylomicrons, Q. What is the special route that lipids f...

Q. What is the special route that lipids follow during digestion? What are chylomicrons? Triglycerides emulsified by the bile within micelles suffer the action of lipases that

Explain ebb or shock period - dietary management for burn, Explain the Ebb ...

Explain the Ebb or Shock Period - Dietary Management for Burns? During the initial bums after injury, the focus is on counteracting the stress induced neurohormonal and physiol

Develop a hypothesis relating to the amount, Develop a hypothesis relating ...

Develop a hypothesis relating to the amount of dissolved oxygen measured in the water sample and the number of fish observed in the body of water.

Functions of respiratory pigments, Functions of Respiratory Pigments A...

Functions of Respiratory Pigments As you have learnt in the preceding sub-sections, the pigments are the carrier of oxygen. In the nonexistence of respiratory pigments the blo

Dietary management during myocardial infarction, Dietary management during ...

Dietary management during Myocardial Infarction? Patients who suffer from an attack of myocardial infarction are hospitalized and are usually kept under strict medical supervis

Adhesion of cells to extracellular cell matrix, Adhesion of Cells to Extrac...

Adhesion of Cells to Extracellular Cell Matrix You know that the cells in order to move or change shape, adhere to each other or to the substratum in their environment. Usual

Light and dark reactions, Evidence for Existence of Light and Dark Reaction...

Evidence for Existence of Light and Dark Reactions The process of photosynthesis was known in its bare outline already at the beginning of this century. But the phenomenon wa

Acid rain, The Phenomenon of acid rain was first introduced by Rober Angus ...

The Phenomenon of acid rain was first introduced by Rober Angus smith in 1852. Is means presence of excessive acids in rain water? Acid rain is a form of precipitation (rain, sn

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd