Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
levels of biological organization in order from smallest to largest
Considering the hybridization in a trait like the color of the flowers of a given plant species (yellow recessive / red dominant) conditioned by a pair of different alleles, what a
Q. Why some trees lose their green color in the autumn? In autumn nights longer and days become shorter thus there is a reduction of the photosynthesis rate and some plants pre
Large Quantity of energy is released during an earthquake with a combination of radiated elastic strain seismic waves frictional, heating of the fault surface and cracking of the r
How does facilitated diffusion present similarities with enzymatic chemical reactions? One of the main examples of facilitated transport is the entrance of glucose from the blo
An adequate level of pressure is needed in the arteries to keep the blood flowing through the cardiovascular system. The chief determinant of arterial pressure is the volume of blo
Describe the procedures involved in blood doping. What are the physiological mechanisms behind blood doping that attempt to achieve the desired outcome(s).
Explain a review of Eating Disorder? If you talk to a group of young boys and girls in an informal setting about their physical appearance, you will find that a majority of the
Woodland Stage - Hydrarch When the lowland has been built up to an extent where the soil is saturated perhaps only in spring and early summer, certain species of shrubs and tr
Phylum Chlorophyta (green algae) 1) The chlorophyll is the main photosynthetic pigment. 2) There is little or no cell differention in thallus. Thallus is usually filamento
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd