Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is lamarckism, What is lamarckism? The Lamarckism is the theory th...

What is lamarckism? The Lamarckism is the theory that unites the law of use and disuse with the law of the transmission of acquired characteristics that is that asserted that a

Regulation of heart, Regulation of Heart The number of electrical imp...

Regulation of Heart The number of electrical impulses initiated by the SA node is primarily the result of its innervation by fibers from both sympathetic and parasympath

Components of ecosystem, Components of Ecosystem The components of the ...

Components of Ecosystem The components of the ecosystem can be categorised into abiotic or non-living and biotic or living components; Abiotic components: The important ab

Explain nucleotides, Nucleotides Compounds  consisting of a  nitrogenou...

Nucleotides Compounds  consisting of a  nitrogenous  base,  a  pentose sugar and a phosphate group.

Define role of zinc in controlling gene expression, Define role of Zinc in ...

Define role of Zinc in controlling Gene Expression? Zinc atoms have specific structural roles in enzyme molecules, as well as, in many other proteins and in bio membranes. Thes

What does fungus looks like, Q. What does this fungus looks like? Ans...

Q. What does this fungus looks like? Ans. The important characteristic features of aflatoxicosis are jaundice, cirrhosis. Long term exposure to aflatoxins could lead to

Define deficiency and toxicity of vitamin d, Define Deficiency and Toxicity...

Define Deficiency and Toxicity of Vitamin D? Infants constitute a population at-risk for vitamin D deficiency because of relatively large vitamin D needs brought about by their

Which type of defense cell do viral infections, Q. Of which type of defense...

Q. Of which type of defense cell do viral infections stimulate the multiplication? The main leukocytes that generally participate and multiply in the defense against viral infe

Which chemical elements are involved in most of matter, Q. Which chemical e...

Q. Which chemical elements are involved to form most of living biological matter? Ans The chemical elements that form most of the molecules of living beings are carbon (C)

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd