Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is the ph inside the stomach, Q. What is the pH inside the stomach? Wh...

Q. What is the pH inside the stomach? Why is there a need to keep that pH level? How is it maintained? Which are the cells that produce that pH? The normal pH of the gastric ju

What is pollination, What is pollination? What are the main forms of pollin...

What is pollination? What are the main forms of pollination? The process in which pollen grains (the male gametophytes of phanerogamic plants) reach the female gametophyte is k

Carbohydrate is an organic compound , The Carbohydrate sets are covalently ...

The Carbohydrate sets are covalently attached to various variant proteins to form glycoproteins. Carbohydrates are a shorter percentage of the weight of glycoproteins than of prote

What do you understand by carcinogens, Q. What are carcinogens? The Car...

Q. What are carcinogens? The Carcinogens are factors capable of producing neoplasias and any mutagen, a substance that can induce DNA mutation, is a potential carcinogen. Insta

Categorisation of neuropsychological assessment, Categorisation of Neuropsy...

Categorisation of Neuropsychological Assessment One can divide neuropsychological assessment into two areas: i) Comprehensive and ii) Specialised assessment. Comprehen

Stages of aerobic respiration, Stages of Aerobic Respiration: Glycoly...

Stages of Aerobic Respiration: Glycolysis (cytoplasm) Process 2ATP used for Glucose -> Fructose 1,6 bisphosphate Fructose splits into G3P and DHAP. DHAP

Cromngnon skull, Subsequently many such fossils were known from France, Ita...

Subsequently many such fossils were known from France, Italy and middle East. All such fossils exhibited reduced brow ridges, steep forehead, high rounded cranial vault, short face

Show the value of embryology, Q. Show the value of embryology? The valu...

Q. Show the value of embryology? The value of embryology in solving taxonomic problems can be appreciated by studying some specific cases. Amongst the classical examples cited

Effects on materials - air pollutants, Effects on Materials - Air pollutant...

Effects on Materials - Air pollutants Most air pollutants are reactive chemicals, so they react with most of the substances around. You may recall from your chemistry lessons

Determine causes of malnutrition, Determine Causes of Malnutrition? You...

Determine Causes of Malnutrition? You may recall studying about the causes of malnutrition earlier. The causes of malnutrition are classified as immediate (individual level), u

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd