Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain glycolysis? Name the two monosaccharides which readily enter the glycolytic pathway. Illustrate a diagrammatic sketch of the microscopic view of a mammalian sperm a
discuss the merits nd demerits of five kingdom classification.
What is the structure into which the follicle is transformed after ovulation? What is the importance of that structure in the menstrual cycle? The follicle that released the ov
what is the tolerance range of man and tillapia
Q. What are some functions of the epithelium? The epithelial tissues can perform protection, covering and impermeability against the environment, for instance, in the skin, res
Define Importance of nutritional requirements for management of emergencies? Knowledge of nutritional requirements for management of emergencies is therefore, important due to
Define Procedure for Testing the Presence of Sugar in Milk? 1. Take 0.1 ml of milk sample in a test tube. 2. Add 0.2 ml of resorcinol solution (0.05 gm of resorcinol in 100
Microfilaments comprise of the proteins The microfilaments comprise of the proteins, actin and myosin, the same contractile proteins that are found in skeletal muscle cells. Si
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Studying leaf arrangements Observe as many growing plants as possible by looking down on them from above. Draw sketches of the dissimilar patterns of leaf arrangement.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd