Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
components of human skeleton
Primary mediators are those, which are produced before degranulation. These primary mediators are stored in granules. Some of the primary mediators are histamine, heparin, protease
What is the life cycle of the hookworms? Adult hookworms within the human intestine release eggs that are eliminated with the human feces. Under adequate conditions of moisture
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
what are the modes of nutrition in different animals
Deoxyribonucleic acid (DNA) is the nucleic acid composed of two polynucleotide strands wound around the central axis to form a double helix; the repository of genetic information.
a) Mention the scientific term used for modified form of reproduction in which seeds are produced without fusion of gametes. b) What does ecological niche of an organism represe
For convenience, living things are placed into different groups. Taxonomic breakdown of living things comprises the following categories: Family, Class, Genus, Phylum, Order, K
For many of the mammalian Hox genes, it has been possible to determine that some of them are more similar to one of the insect HOM-C genes than to the others. Describe an experimen
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd