Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

How emulsion are formed, How emulsion are formed The most common method...

How emulsion are formed The most common method of preparing an emulsion is by mechanically dispersing one liquid phase in another by formation of small droplets. This takes pla

Why are the tropical forests also known as stratified forest, Why are the t...

Why are the tropical forests also known as stratified forests? In the tropical forests tall trees of several species have their crowns forming a superior layer under which dive

State the term - neuropsychologists, State the term - neuropsychologists ...

State the term - neuropsychologists Disorders of speech, language, reading, writing, and mathematical abilities are understood in terms of linguistics and the psychology of lan

Explain intergenic, Intergenic: Amongs the two genes; for example intergen...

Intergenic: Amongs the two genes; for example intergenic DNA is the DNA found amongs two genes. The term is frequently used to mean non-functional DNA (or at least DNA with no kno

Colluvial-transported soil, Colluvial These are the soils formed from t...

Colluvial These are the soils formed from the material transported by the pull of gravity. Fragments from cliffs or steep rocky slopes become dislodged from time to time and ma

What are gonads, What are gonads? What are the male and the female gonads i...

What are gonads? What are the male and the female gonads in humans? Gonads are the organs that make gametes. They have the germ cells that undergo division and generate gametes

Explain citric acid cycle, Explain citric acid cycle In  the citric aci...

Explain citric acid cycle In  the citric acid cycle, the oxaloacetate is first condensed with acetyl CoA, and  then regenerated  as  the cycle  is  comp!eted.  But these  react

Explain about spring model, Q. Explain about Spring Model ? The spring ...

Q. Explain about Spring Model ? The spring model depicts elasticity. A force is applied in terms of load onto the spring as illustrated in the figure 8.6. When the force is app

Conditions necessary for outbreak of staphylococcal food, Q. Conditions Nec...

Q. Conditions Necessary for Outbreak of staphylococcal food? The following conditions are necessary for an outbreak of staphylococcal food poisoning: 1. The food must conta

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd