Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Structural variations in vertebrate kidney, Normal 0 false fa...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Consciousness as inner state, Q. Explain Consciousness as inner state? ...

Q. Explain Consciousness as inner state? Consciousness as inner state: We are conscious of thoughts, images, emotions and memories within ourselves though they may not have phy

Define feeding options for premature and lbw babies, Define Feeding Options...

Define Feeding Options for Premature and LBW Babies? Different workers have tried different method and since all methods are successful, it is dependent on the individual infan

Explain precautions for detection of metanil yellow, Explain Precautions fo...

Explain Precautions for Detection of Metanil Yellow? 1. One should be careful while using concentrated HCl otherwise it may result in burn. 2. Amount of concentrated HCl in

Homeostasis, HOMEOS T ASI S - Homeo = same,   Stasis = state Li...

HOMEOS T ASI S - Homeo = same,   Stasis = state Living beings maintain their internal environment by self regulating system, it is called homeostasis. Term coined by

Define historical example of virulence, Define Historical example of virule...

Define Historical example of virulence? The "classical dogma" of epidemiologists was that pathogens all the time evolve in the direction of lower virulence, eventually becoming

Importance of fat synthesis and storage, Importance  of fat  synthesis  ...

Importance  of fat  synthesis  and storage : As  is clear from above  account, all  surplus nutrients, digested and  absorbed  from above the  immediate need of  body, are readily

Show very low level of lactase activity, Q. Show Very low level of lactase ...

Q. Show Very low level of lactase activity? Very low level of lactase activity: at very low level of lactase activity all milk products must be eliminated, substitutes of milk

Manufacture of metallurgical coke, Using high temperature carbonization, me...

Using high temperature carbonization, metallurgical coke  (hard coke) can be prepared by two processes. 1.      Beehive coke oven process. 2.      Otto-hoffmann's by-product

What is the law of limiting factors, What is the law of limiting factors? H...

What is the law of limiting factors? How would the rate of photosynthesis be affected if the soil water becomes limiting? Describe.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd