Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Planning the nursing care - wilms tumour, Planning the Nursing Care   ...

Planning the Nursing Care     Provide preoperative and post operative nursing care to child    Assist in therapeutic management of child.    Provide comfort.  S

Isomerisms types of unsaturated fatty acids, Unsaturated fatty acids show ...

Unsaturated fatty acids show different types of  isomerisms. We have already learnt about the.concept of  isomerism  in  the  last unit. You would  realize that fatty acids with s

Hyperlipidemia, Dyslipidemia is an important correctable factor for Coronar...

Dyslipidemia is an important correctable factor for Coronary Artery Disease. There is a strong, independent, continuous, and graded relation between total cholesterol (TC) or low-

Factor influencing lipid oxidation - temperature, Factors affecting lipid o...

Factors affecting lipid oxidation Temperature In general, the rate of oxidation increases as the temperature is increased. Temperature also influences the relation betw

Explain non-glycerides in edible oils, Explain Non-Glycerides in Edible Oil...

Explain Non-Glycerides in Edible Oils? You may be aware of the fact that the glyceride fraction (an ester of glycerol and fatty acids that occurs naturally as fats and fatty oi

Chemical reactions which are catalysed by enzymes, Give two examples of che...

Give two examples of chemical reactions which are catalysed by enzymes in the course of brewing.  In the course of brewing, enzymes in the grain catalyse the conversion of star

Nucellus - seed, Nucellus - Seed In a large majority of flowering plan...

Nucellus - Seed In a large majority of flowering plants the nucellus is gradually utilized by the endosperm or embryo. In leguminous seeds, for example, the nucellus degenerat

What is pollen, What is pollen? Pollen grains are the male gametophytes...

What is pollen? Pollen grains are the male gametophytes of the phanerogamic (flowering) plants. Thus within the pollen grains the male gametes of these plants are produced by m

Determine fat-soluble vitamins recommended for infant, Determine fat-solubl...

Determine fat-soluble vitamins Recommended for Infant? ICMR (1990) does not give recommendations for vitamins D, E and K. As you already know, vitamin D is expected to be met

What is atherosclerosis, Q. What is Atherosclerosis? Atherosclerosis is...

Q. What is Atherosclerosis? Atherosclerosis is an arterial lesion characterized by patchy thickening of the intima (innermost coal of artery) comprising of fat and layers of co

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd