Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Biology in dispelling myths and misbeliefs, BIOLOGY IN DISPELLING MYTHS AND...

BIOLOGY IN DISPELLING MYTHS AND MISBELIEFS - Varieties of myths still exist in our society, and can be removed by the knowledge of Biology. Some of these are- 1.       Snake

Genetics what is this type of gene frequency change called, An hypothesis f...

An hypothesis for the extinction of the dinosaurs is that the earth had been hit by a gigantic meteor that caused the death of those big reptiles. In that case the entire genetic p

Regeneration - development biology, Regeneration - Development Biology ...

Regeneration - Development Biology Regeneration has, intrigued scientists for several generations and has resulting in voluminous literature on the subject beginning from the

Osmoregulation in aqueous environments, Osmoregulation in Aqueous Environme...

Osmoregulation in Aqueous Environments You are aware that the aqueous environments are of two types: i) Freshwater and ii) Seawater. The osmotic concentration of thes

What is cell theory, What is cell theory? Cell theory declares that the...

What is cell theory? Cell theory declares that the cell is the constituent unit of living beings. Before the discovery of the cell, it was not identified that living beings

Indications for surgery-tricuspid valve disease, Indications for Surgery : ...

Indications for Surgery : Echocardiography or right heart catheterization can quantify tricuspid stenosis. It is categorized as Tricuspid valve repair is advised when ther

Pre-embryonic development, Pre-Embryonic Development We had said in t...

Pre-Embryonic Development We had said in the starting of the unit that prenatal development can be divided into two phases, embryonic and foetal. The embryonic phase of devel

Define growth hormone releasing hormone receptors, Define GHRH Receptors (G...

Define GHRH Receptors (Growth Hormone Releasing Hormone Receptors)? A. GHRH Receptors are only located in the plasma membranes of cells in the hypothalamus. B. GHRH Receptor

Explain gastric bypass - surgical management for obesity, Explain Gastric B...

Explain Gastric Bypass - surgical management for obesity? Surgery is the current 'gold standard' for bariatric surgical procedures. It involves use of a stapling device to crea

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd