Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is the difference between the concepts of genome and karyotype? Genome is the set of DNA molecules that characterizes each species or each living being. The concept the
mORPHOLOGY OF AMOEBA AND ITS ADAPTATIONS
Diabetes Mellitus Management after Open Heart Surgery : Diabetic patients undergoing coronary artery bypass surgery who are on oral hypoglycemic drugs are pre operatively s
Which of the below statements does NOT apply to arteries when comparing them to veins: a) Have thick walls b) Carry blood away from heart c) Highly elastic walls d) Ha
Q Concerning germ layers and the presence of coelom how are arthropods characterized? Arthropods are triploblastic and coelomate beings (they have three germ layers). Q. Co
Diarrhoeas disease: Diarrhoeas disease rank among th most leading causes of children's death in developing countries. We shall discuss two main problems in this section i.e.
What are the similarities between chlorplasts and prokaryotic cells?
Neuropsychological screening of adults Normally, a neuropsychological examination explores in depth an individual's performance in a wide range of functional domains. There are
What are the uses of microorganisms
types of enzyme
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd