Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
what is amphibian
A solute passes from higher concentration on the left of a container to the right side of container thru a membrane. What would happen if a second solute of lower concentration was
Pantothenic acid (Calcium pantothenate) Calcium pantothenate is a white, loose, faintly hygroscopic powder without odour and of bitter taste. It is easily soluble in water, gly
What causes acid precipitation? Acid precipitation is the result of air pollutants that combine with water vapor in the atmosphereto form acids, causing precipitation that is m
Explain the Management of Middle - Third Perforation Same to coronal one-third perforation, except defects located more deeper from the access cavity. For successfully
Define the Goals of treatment of Obesity? As said in the beginning, the goal of treatment of obesity today has shifted from mere 'weight loss' to 'weight management'. Each weig
Define Voriconazole It is metabolized in the liver by CYP2C19, CYP2C9 and CYP3A4. CYP2C19 is genetically variant (about 3% to 5% of Caucasians and African-Americans and about 1
Indifferences in ionic composition Answer A. across membranes can be created through the action of ATP driven pumps as long as number of negative and positive ions on remain equal
Management for Poisoning and Overdose: The following data should be obtained at the time of initial contact. Phone Number: getting the caller's telephone number is n
Define Categories of Indicators of Malnutrition? The indicators may fall under the following categories: 1. Macro indicators for sector-wide monitoring and evolution, 2.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd