Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What do you mean by Oesophagitis? We already know that oesophagus is a muscular tube 25 cm in length and basically helps in transporting the food from the mouth to stomach,
Are the arterial pulsations normal? Is the pulse volume normal or increased? Is there a discrepancy of pulsation in any of the four extremities? A careful evaluation of pulsati
I have a six page assignment, which involves barely any writing, just labeling some plant structures etc. Can someone do this?
Explain the Source of Energy - Growth of Microorganism? Constant supply of energy is required to carry out cellular activities, like biosynthesis and degradation of macromolecu
Indications for Surgery : Once diagnosis of constrictive pericarditis is made and confirmed by chest X-ray, ECG, echocardiogram, CT, MRI scan, cardiac catheterisation and angio,
Give one example in each case of the usefulness of bacteria in (a) a natural environment, (b) an industrial process. (a) In a natural environment bacteria brin
In the previous sub-section we discussed the possible ways by which variabiliti can, be generated. We shall now examine one instance that illustrates the consequence of variability
Locomotion Continuous formation of new pseudopodia keeps amoeba in constant locomotion .This is called amoeboid movement .It occurs in many other protozoans , in amoebo
EPIDERMIS - Ectodermal in origin. Outer part of skin. Made up of stratified epithelium. Branches of sensory nerves present. More branches on lips, tips of fingers. B
electron transport chain
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd