Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is S shaped incision, Q. What is S shaped incision? The S - shaped...

Q. What is S shaped incision? The S - shaped incision is indicated where a papilla needs to be developed and was first described by Palacci. This type of incision is essentiall

frog, what is the xternal & internal respiration in fro

what is the xternal & internal respiration in frog

Explain the types of foods used in space, Explain the types of foods used i...

Explain the types of foods used in Space? The various types of foods are enumerated herewith. Thennostabilized (T): Heat processed foods ("off-the-shelf' items) in aluminium

Precipitation-water cycle, Precipitation Precipitation literally means ...

Precipitation Precipitation literally means falling from a height. In case of water, precipitation includes all forms in which atmospheric moisture descends to earth; rain, sno

Cells, what is the function of nucleus

what is the function of nucleus

What do you understand by chromosome behaviour, Q. What do you understand b...

Q. What do you understand by Chromosome Behaviour? When we study meiosis. we not only observe the regularity of pairing which is important' for' the fertility of the plants, we

Birth control - permanent methods, PERMANEN T METHOD - 1. Vasectomy in...

PERMANEN T METHOD - 1. Vasectomy in male. 2. Tubectomy in female. 3. Leproscopy is used in tubal ligation , to ligate fallopian tubes.

Explain procedure for the use of light microscope, Explain Procedure for th...

Explain Procedure for the use of Light Microscope? Now carry out the exercise following the steps enumerated herewith. 1. Place the microscopic slide with any specimen on th

How can the enzymes be classified, How can the enzymes be classified? Expla...

How can the enzymes be classified? Explain giving examples. Based on structure, enzymes can be classified into monomeric enzymes and oligomeric compounds. Monomeric enzym

What is microtubules, What is Microtubules? Microtubules are the largest...

What is Microtubules? Microtubules are the largest intracellular fibers, with a diameter of about 25 nm (2.5 x 10-8 meters). They consist of hollow fibers composed of a protein

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd