Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Process of behaviour change, 1. Awareness - First people become aware of a...

1. Awareness - First people become aware of a problem. 2. Acquire Knowledge and skills - Next, they gather knowledge and learn new skills. 3. Motivation - At the next stag

Explain dietary fibre - thyphoid, Dietary fibre Dietary fibre: Typhoid ...

Dietary fibre Dietary fibre: Typhoid patient has an inflamed intestinal mucosa, which can be easily perforated  and  ulcerated leading  to internal  haemorrhage. Thus foods hig

Define the types of canned foods, Define the Types of Canned Foods? 1....

Define the Types of Canned Foods? 1. Some foods form convection currents when being heated inside a can and so are heated faster since self-mixing - as foods become more visco

Which are the beings that form the kingdom plantae, Q. Which are the beings...

Q. Which are the beings that form the kingdom Fungi? The kingdom Fungi is created by fungi. Q. Which are the beings that form the kingdom Plantae? Are algae parts of this k

Do primary amines can act as bases, Primary amines can act as bases; they c...

Primary amines can act as bases; they can- Select one: a. Absorb a proton to become R-NH2+2 b. Release a proton to become R-NH2+ c. Absorb a proton to become R-NH3+

What are uses of hydrocolloids for health, Uses of Hydrocolloidsfor health ...

Uses of Hydrocolloidsfor health Hydrocolloids, together with other dietary fibres are increasingly being seen as contributing to a number of health effects. Some of the hydroco

Nursing assessment of thalassemia patient, Nursing Assessment  If you ...

Nursing Assessment  If you observe a child of thalassemia major you can identify the following clinical  manifestations:  Anaemia with haemoglobin level of 3 to 8 gm per ce

Define the insulin resistance - obesity, Define the Insulin resistance - Ob...

Define the Insulin resistance - Obesity? Insulin resistance is a condition in which your body cells cannot utilize insulin efficiently although sufficient amounts are secreted

Lamarckism theory of organic evolution, THEORY OF ORGANIC EVOLUTION - ...

THEORY OF ORGANIC EVOLUTION - LAMARCKISM Theory of the inheritance of acquired characters or Lamarckism put forwarded by Jean Baptist de Lamarck (1809) in his book "

Fluid management in diarrhoea, Q. Fluid management in Diarrhoea? Fluid ...

Q. Fluid management in Diarrhoea? Fluid management: The key to diarrhoea management is the early replacement of fluid lost in the stools through intravenous or oral route. Whil

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd