Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Food and diet, could you survive on a diet which contain no carbohydrates

could you survive on a diet which contain no carbohydrates

Cladogram help, Recent molecular analyses indicate that the artiodactyls, w...

Recent molecular analyses indicate that the artiodactyls, which include hippos and camels, are paraphyletic, whereas cetaceans are monophyletic and cetaceans and hippos form a clad

Are the extraembryonic membranes the same in all vertebrates, Q. Are the ex...

Q. Are the extraembryonic membranes the same in all vertebrates? The presence of each extraembryonic membrane differs according to the vertebrate class. In amphibians and fi

Why do cells of the nephron tubules present, Why do cells of the nephron tu...

Why do cells of the nephron tubules present a great amount of mitochondria? The cells of the tubule wall have high number of mitochondria because lots of substances are resorbe

Fermentation, outline the process of yeast fermentation stating all enzymes...

outline the process of yeast fermentation stating all enzymes involved

Types of community, Types of Community On the basis of size and degree ...

Types of Community On the basis of size and degree of relative independence communities may be divided into two types: i) Major Community: These are large-sized, well org

Onchology, Onchology : This is the study of cancer. Oncology word meaning i...

Onchology : This is the study of cancer. Oncology word meaning is mass, bulk & tumor. This is a branch of medicine which deals with tumors (cancer). The one who practices oncology

Psychology, Psychology : This is the study of human mind. On other words Ps...

Psychology : This is the study of human mind. On other words Psychology is the science of behavior or mental processes. Its immediate aim is to understand the individuals or groups

Is pollution always caused by humans, Q. Is pollution always caused by huma...

Q. Is pollution always caused by humans? In the most cases pollution is caused by human activity. Other species and some abiotic factors though can also pollute an ecosystem. F

What are mycorrhizas, What are mycorrhizas? How does each participant benef...

What are mycorrhizas? How does each participant benefit in this ecological interaction? Mycorrhizas are mutualist ecological interactions among fungi and some plants roots. Fun

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd