Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain about the Iron - Micro Minerals? Iron was a familiar metal even in the ancient civilization. In India, iron implements made their appearance in between 1300-1000 BC and
Are proteins with the same number of each different amino acid that form them necessarily identical proteins? Even if many proteins have the similar number of each dissimilar a
Open and Closed Type of Circulatory Systems There are two categories of circulatory system found in higher metazoans. In one type the original blastocoel carries on to be the
how do flatworm and round worms respire?
Define the term Ancestral characteristic A character shared by all members of a taxonomic group of organisms (taxon) and used to define the unique nature of the group. The cha
What is the etiological agent of amebiasis? How is it transmitted and what are the typical manifestations of the disease? Amebiasis is caused by the protozoan Entamoeba histoly
Nucleosides : compounds formed from a nitrogenousbase and a penstose sugar.
What do you understand by Open circulatory system? A circulatory system in which circulating fluid (blood) flows into vessels or tubes not connected to each other by small capi
Symbiotic Nitrogen Fixers - Nutrient Cycles Of the symbiotic nitrogen fixing bacteria, species of Rhizobium form root nodules in legumes and are the most studied nitrogen fixe
what are some adaptations of flatworms
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd