Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Approximate composition of human tissue, Approximate Composition of Human T...

Approximate Composition of Human Tissue Table gives the approximate composition of human tissue. We all know that carbon, oxygen, hydrogen are present in water and other organ

Cell, how does a cell work ?

how does a cell work ?

Oligosaccharides, OLIGOSACCHARIDES They are small-sized polymers of ...

OLIGOSACCHARIDES They are small-sized polymers of monosaccharides having 2 - 6 simple sugars, occasionally upto 9 - 10. Oligosaccharides are soluble in water, sweet to t

Membrane carbohydrate, The  extracellular   surface  of  the  plasma  membr...

The  extracellular   surface  of  the  plasma  membrane   is  frequently  covered  with  a protective  coat  of carbohydrate. A Sugar  residue  of this  carbohydrate  coat can  be

What are the three main arthropod classes constituted, How are the excretor...

How are the excretory systems of the three main arthropod classes constituted? In crustaceans a pair of excretory organs known as green glands exists. The green glands collect

Is phenoxyethanol harmful?, Phenoxyethanol is dangerous and can be absorbed...

Phenoxyethanol is dangerous and can be absorbed through the skin - official sites for toxicity data, though, show little toxicity in man and some toxicity (irritation) with high do

Define reaction of fehling soxhlet method, Define Reaction of Fehling Soxhl...

Define Reaction of Fehling Soxhlet method? The reducing sugars formed are acted upon by the alkali of Fehling's solution to form enediols. These enediols are very unstable and

Counselling diabetic travellers, Counselling Diabetic Travellers The c...

Counselling Diabetic Travellers The counsellor needs to educate a diabetic patient and /or his family members to following issues when such patients plan to travel: ·  Plan

What do energy pyramids represent, Normal 0 false false fal...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd