Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain adverse effects of tenofovir disoproxil fumarate, Adverse effects o...

Adverse effects of Tenofovir disoproxil fumarate  The most common adverse effects have been nausea, vomiting and diarrhea. Renal failure, including a Fanconi-like syndrome, has

Non-renewable energy sources, In many countries of Asia biomass contributes...

In many countries of Asia biomass contributes l argely as a source of primary energy. People in rural areas at the peripheries of forests, continue to collect fuel wood from adjace

What are the nitrate reductase and nitrite reductase tests, Based on your u...

Based on your understanding of the nitrate reductase and nitrite reductase tests, why would the inclusion of nitrite inhibit anaerobic growth?

Ciliary and flagellar movements, Normal 0 false false false...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Signify the term metacoel, Signify the term Metacoel. The last of three...

Signify the term Metacoel. The last of three coelomic spaces found in tripartate body plan characteristic of deuterostome lineage of animals. Other coelomic compartments are th

How do taenias classify according to the division of sexes, How do taenias ...

How do taenias classify according to the division of sexes? Taenias are monoecious (hermaphrodite), the similar individual has female and male reproductive organs and undergoes

How nondisjunction in meiosis i and meiosis ii look in males, How does nond...

How does nondisjunction in meiosis I and meiosis II look in males and females? Diagram it.

Checker board (punnet''s square) method, CHECKER BOARD (PUNNET'S SQUARE) ME...

CHECKER BOARD (PUNNET'S SQUARE) METHOD 1.         If the genotypes of the parents are known, the genotypes of their offspring can be easily predicted with the help of a chart c

Dna structure, A)Which of the following statements about DNA structure is t...

A)Which of the following statements about DNA structure is true? 1.The nucleic acid strands in a DNA molecule are oriented ant parallel to each other, meaning they run in opposite

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd