Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is Class Asteroidea ? Sea stars are probably one of the most recognizable of all Echinoderms. Often beautifully colored and symmetrical, they are predators that feed vorac
Mass transportation is the access or the exiting of substances in or from the cell engulfed by portions of membrane. The fusion of internal substance-having membranous vesicles wit
give the theory of spermatogenesis
Explain what is Third Heart Sound S 3 ? S, is generated during the rapid filling pliase. It is a low frequency event. Mechanism of S, production: It is due to a sudden limita
Pathogenesis of Viruses Viral diseases An indicated before, viruses cause a number of infectious human diseases from minor ailments like common cold, to fatal disease, lik
RESPIR A T O R Y PIGMENTS - Resp. pig. is generally Hb (Fe is attached to globine by chellate bond). In Earthworm Erythroqruorine present. Haemocyanine (Cu) genera
Types of Organization Chart: There are two important types of organization chart. a) Vertical i.e., from top to bottom. b) Horizontal i.e., from left to right.
Q. Are proteins with the same number of each dissimilar amino acid that forms them necessarily identical proteins? Even if many proteins have the same number of each different
Amoebae- Parasitic Protozoan The amoebae of the genus Entamoeba vary in their biology. Entamoeba histolytica or the dysentery amoeba occurs as a parasite in the large intestin
Light Stratification - Lake Ecosystem The penetration of light in water bodies is limited depending on the transparency of water and its ability to absorb light. On the basis
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd