Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is lamarckism? The Lamarckism is the theory that unites the law of use and disuse with the law of the transmission of acquired characteristics that is that asserted that a
Regulation of Heart The number of electrical impulses initiated by the SA node is primarily the result of its innervation by fibers from both sympathetic and parasympath
Components of Ecosystem The components of the ecosystem can be categorised into abiotic or non-living and biotic or living components; Abiotic components: The important ab
what is the first to develop in excretory system?
Nucleotides Compounds consisting of a nitrogenous base, a pentose sugar and a phosphate group.
Define role of Zinc in controlling Gene Expression? Zinc atoms have specific structural roles in enzyme molecules, as well as, in many other proteins and in bio membranes. Thes
Q. What does this fungus looks like? Ans. The important characteristic features of aflatoxicosis are jaundice, cirrhosis. Long term exposure to aflatoxins could lead to
Define Deficiency and Toxicity of Vitamin D? Infants constitute a population at-risk for vitamin D deficiency because of relatively large vitamin D needs brought about by their
Q. Of which type of defense cell do viral infections stimulate the multiplication? The main leukocytes that generally participate and multiply in the defense against viral infe
Q. Which chemical elements are involved to form most of living biological matter? Ans The chemical elements that form most of the molecules of living beings are carbon (C)
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd