Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
A patient has total destruction of all of the beta-islet cells of the pancreas. Prior to receiving treatment, this patient will have A. high blood plasma levels of glucose.
Physical map is the map of locations of the identifiable landmarks on DNA (for example restriction of the enzyme cutting sites, genes), regardless of their inheritance. Distance i
how do mature sperm differ from those that are not fully developed
To test the effects of temperature on the activity of yeast Make up a quantity of bread dough .Stir a yeast cake in water and methodically mix the yeast with the dough. Divide
Enumerate the term - pathognomic sign A comprehensive assessment ideally uses all four approaches. Some forms of specialised assessment rely heavily on pathognomic signs, behav
Determine the Symptoms of bacillus cereus Extremely large numbers (10 8 per gram) of viable cells of B. cereus must be ingested to develop signs and symptoms of the syndrome.
Defina about the Lipid Metabolism? Animal studies consistently show a hypotriglyceridenlic effect although equivocal results have been seen with healthy humans. Hypotriglycerid
Q. Why in infectious and inflammatory conditions may clinical signs related to the lymphatic system occur? The lymph nodes or lymph glands have lymphoid tissue that produces ly
i want to learn
With the survival and well-being of humans beings so heavily dependent on biodiversity, its economic value assumes considerable importance. For instance the economic value of ecosy
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd