Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Causes of apomixis, Causes of Apomixis Apomictic species are generall...

Causes of Apomixis Apomictic species are generally hybrids or polyploids, as a consequence, there is irregular meiosis. Apomixis appears to be controlled by a set of genes. T

Male reproductive disorders-congenital disorders, Congenital disorders ...

Congenital disorders Poor fertilizing quality of semen could be due to impaired spermatogenesis. When such a condition is due to genetic congenital causes the treatment is not

Define the requirements of root-end filling materials, Define the Requireme...

Define the Requirements of Root-End Filling Materials 1.  Seal well 2.  Well tolerated by periapical tissues "Biocompatible" 3.  Easily inserted "manipulated" 4.  Unr

What is the dosage and cost of micafungin, Dosage and cost of micafungin ...

Dosage and cost of micafungin The recommended dosage of micafungin is 50 mg/day for prophylaxis and 150 mg/day for treatment, both given IV as a single dose over 1 hour.

State about maxillary sinus, Maxillary sinus : It is a pyramidal shaped...

Maxillary sinus : It is a pyramidal shaped large cavity in the body of the maxilla containing many structures of concern during surgery. The sinus is lined by a membrane known

Write down a dna palindrome, Write a DNA palindrome or inverted repeat of a...

Write a DNA palindrome or inverted repeat of at least 10 nucleotides in length.

Determine the term - nitrogen, Determine the term - Nitrogen Most of n...

Determine the term - Nitrogen Most of nitrogen is available as organic nitrogen which has to be mineralised to inorganic form to become available to plants. Estimation of orga

Somatoform disorders, SOMATOFORM DISORDERS: The term 'Neurosis'  was f...

SOMATOFORM DISORDERS: The term 'Neurosis'  was first introduced in 1769 by William Cullen (1710-  1790). Till later part of nineteenth century, anxiety disorders were conspicu

Explain complex or undefined media, Explain Complex or Undefined Media? ...

Explain Complex or Undefined Media? Here, the exact composition of the medium is not known. It contains some complex components of plant and animal extracts whose exact chemica

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd