Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
what is cell and what are the components of cell
State about membrane-spanning molecule Neuron A is a healthy neuron with all the usual ion channels and with all the usual intracellular and extracellular distributions of ion
Q. Show Artificial systems of classification of plants? Carolus Linnaeus (1707-1778) popularly known as Carl Von Linne was born on May 1707 at Result, a small village in Smalan
Chemical Stress - Atmospheric imbalances At least two components of the environment, oxygen and carbon dioxide that plants require are predominantly in the gaseous form. As yo
Explain about the Dysphagia? Dysphagia is the inability to swallow or difficulty in swallowing. It is a common problem in those with neurological disorders and can occur in any
Q. Briefly explain about semantides? The information carrying molecules in plants are called semantides, and they have been recognised to be 3 kinds; deoxyribonucleic acid or D
Explain the Nutritional Management of Eating Disorders? Good nutritional management of patients with eating disorders requires attention to a number of areas. It is important t
Explain about the Food Spoilage? Foods gradually undergo deterioration or spoilage from the time they are harvested, caught, slaughtered or manufactured. Therefore, delay in th
Explain Poor growth - clinical signs of kwashiorkor? Growth retardation is the earliest manifestation of kwashiorkor, the child will be lighter and shorter than its normal peer
Coronal Disassembly -If the existing restoration functionally designed well fitting and esthetically pleasing , -The access the pulp chamber during retreatment is better app
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd