Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Which is the brain region responsible for the regulation of breathing and blood pressure? The neural regulation of breathing, blood pressure and other physiological parameters
Biological diversity is the new buzzword, the magic door to international funding and global travelling. We share the earth with million of other living beings. Just as we humans m
Gum Karaya Gum karaya (sterculia gum) is the dried gummy exudate from Sterculia urens Roxburgh and other species of Sterculia (Family: Sterculiaceae) or from Cochlosperm
The principle of homeostasis is controlling the heating system with a simple thermostat in a house. These components are essentials thermometer, source of heat turning it on or off
Define the word colloid The word colloid, you may be interested to know, is derived from the Greek word "kolla" meaning "glue" and is defined as a system containing particles o
Gastrulation Process - Formation of Primitive Streak Gastrulation in all amniotes involving eutherian mammals is related to a characteristic structure termed as the primitive
A decrease in blood plasma levels of calcium will lead to A. an increase in the calcium ion excretion in the urine. B. an increase in the calcium ion absorption from the con
#questioi want clarius diagramn..
Your breakfast consists of a cup of black coffee with sugar as well as a plain bagel covered with cream cheese. Describe the digestion of this breakfast as it passes through each m
project
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd