Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What are the major cellular features of fungi, Q. What are the major cellul...

Q. What are the major cellular features of fungi? There are pluricellular and unicellular fungi. All fungi are heterotrophs and eukaryotes. Fungi have cells with cell wall m

Explain nongonococcal urethritis, Nongonococcal nonchlamydial urethritis an...

Nongonococcal nonchlamydial urethritis and cervicitis Nongonococcal urethritis (NGU) in men is often nonchlamydial as well. Possibly caused by Ureaplasma urealyticum, Mycoplas

Determine energy density of human milk, Determine Energy Density of Human M...

Determine Energy Density of Human Milk? The energy density of human milk depends on the relative proportions of protein, fat and the principal carbohydrate, lactose. Lactose co

How different are fecundation in chondrichthyes, Q. How different are fecun...

Q. How different are fecundation in chondrichthyes and in osteichthyes? In chondrichthyes fecundation is internal by resources of copulation. In osteichthyes fecundation genera

How the required weight gain calculated, How the Required weight gain Calcu...

How the Required weight gain Calculated? Weight gain is another aspect deserving attention. 'Allowable' or recommended weight gain could be higher than for adults. The weight g

How much ampicillin can dissolve in 400 ml, How much ampicillin (sodium sal...

How much ampicillin (sodium sal, mw=371.40) would you dissolve in 400 mL of water to make 80 mg/ml solution of ampicillin?

Explain difficult feeding and poor growth, Explain Difficult Feeding and Po...

Explain Difficult Feeding and Poor Growth to recognition of congenital heart disease? Difficult Feeding and Poor Growth: The parent of an infant with CHD may complain that the

Describe pericardial rub and their characteristic, Describe Pericardial Rub...

Describe Pericardial Rub and their Characteristic ? Generation of sound: The sound is generated due to rubbing of visceral and parietal pericardial surfaces against each other

Microbiology, control of microorganisms by chemical method.

control of microorganisms by chemical method.

What is energy, What is Energy ? Energy Energy is defined as the cap...

What is Energy ? Energy Energy is defined as the capacity to do work. Work is defined as the movement of a mass, or the product of the force and the distance through which t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd