Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Prolactin, assignment on prolactin

assignment on prolactin

Explain the potential benefits of micro nutrients, Explain the Potential Be...

Explain the Potential Benefits of micro nutrients? The potential benefits of micro nutrients should also be taken into account when the nutrient allowances are defined for olde

What is the mean of crp, CRP is a marker of systemic inflammation. As the r...

CRP is a marker of systemic inflammation. As the role of inflammation in the initiation and progression of atherosclerosis becomes better understood, CRP has gained prominence as a

Define formation of healthy food habit - combat from obesity, Define Format...

Define Formation of healthy food habit - combat from obesity? Discarding faulty habits as early as possible. Most food habits formed at this age are for a life time. Special c

What is angina pectoris, Q. What is Angina Pectoris? Chest discomfort i...

Q. What is Angina Pectoris? Chest discomfort is often reported by most patients especially those which are chronic cases of dyslipidemia and/or hypertension. Like diarrhoea and

Circulatory systems in animals, Circulatory Systems in Animals In anim...

Circulatory Systems in Animals In animals that have efficient circulatory systems and readily permeable vascular skins, gas exchange occurs through the integument. Thus we fin

How to investigate mitral regurgitation by chest radiogram, Q. How to inves...

Q. How to investigate mitral regurgitation by Chest Radiogram? Enlarged left atrium is obvious on chest X-ray and it may occupy most of the cardiac silhouette in patients with

To show the direction of sprout growth in seeds, To show the direction of s...

To show the direction of sprout growth in seeds Soak pumpkin or other large seeds overnight and fasten three of them on needles as shown in the diagram. Fasten single with the

Define about ecological models, Why do ecological models commonly have limi...

Why do ecological models commonly have limited applications? The applications of ecological models are limited due to the models are normally very simple and do not accurately

Cell, The scientist who described cells as “many little boxes” was

The scientist who described cells as “many little boxes” was

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd