Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Membrane potential, a solution of 5mMol/L CaCl2 is separated from a solutio...

a solution of 5mMol/L CaCl2 is separated from a solution of 1 micromole/L CaCl2 by a membrane that is selectively permeable to Ca+2 but is impermeable to Cl-1 what are the magnitu

Developmental biology, pioneers of developmental biology and their contribu...

pioneers of developmental biology and their contribution

Define the nutritional shortcomings among the elderly, Define the Nutrition...

Define the Nutritional shortcomings among the elderly? Nutritional shortcomings are common among the elderly; most often due to poor choice of foods i.e. they may be consuming

Which foods are used by microorganisms for energy, Q. Which Foods are used ...

Q. Which Foods are used by Microorganisms for Energy? The carbohydrates, especially the sugars, are most commonly used as an energy source, but other carbon compounds can also

How does hypophysis- corpus luteum negative feedback work, Q. How does the ...

Q. How does the hypophysis- corpus luteum negative feedback work? What is the name given to the atrophied corpus luteum after this feedback process? After ovulation the estroge

Provide evidence to explain the conversion, Provide supporting evidence to ...

Provide supporting evidence to explain how conversion of a normal somatic cell into a malignant one requires multiple mutations.

Can you explain the mycorrhizas, Q. What are the mycorrhizas? How does each...

Q. What are the mycorrhizas? How does each participant benefit in this ecological interaction? Mycorrhizas are mutualist ecological interactions between some plants roots and f

Types of heart failure, The various types and their description of Heart fa...

The various types and their description of Heart failure are as follows:  Left Sided Versus Right Sided Heart Failure   Predominantly left sided failure is seen in left ventr

Treatment of infective endocarditis, Two major objectives must be achieved ...

Two major objectives must be achieved to treat IE effectively. The infecting  micro-organism in the vegetation must be eradicated. Also, invasive, destructive intracardiac and foca

Gene interactions (post mendelian genetics), GENE INTERACTIONS (POST MENDEL...

GENE INTERACTIONS (POST MENDELIAN GENETICS) Phenotypic expression of a gene may be altered by the influence of other genes. The modification of the normal phenotype of certain

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd