Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
The most recent blood work of a patient with a diagnosis of acute myelogenous leukemia (AML) reveals thrombocytopenia. Where is the patient most likely to experience abnormal bleed
Bacteria never have a nucleus but some members of the domain Archaea are known to contain a true nucleus.
Functionality of cellulose Cellulose has many uses as an anticaking agent, emulsifier, stabilizer, dispersing agent, thickener and gelling agent, but these are generally subsid
Histoplamosis Caveran disease, darling’s disease, reticuloendothelial cytomycosis or tingo maria fever are the other synonyms for histoplamosis caused by Histoplasma capsulatum. T
What is Gene therapy Gene therapy targets non germ line cells, ie somatic cells, so will not directly affect gene pool. The frequency of the allele for the genetic disease w
Q. How do you define Normal Pulmonary Vasculature? Pulmonary vessels are seen in the medial 2/3 of the lung. Vessels are generally not identified in the lateral third. The rad
distinguishing characteristics of phylum platyhelminthes?
#Predict: In order to be able to energize a transport protein by phosphorylation (by addition of a phosphate group from ATP), the portion of the protein to which the phosphate grou
Circulatory Assist Devices : Intra aortic balloon pump (IAUP) was introduced by Kantrowitz (19hX). It is also known as Counter pulsation or Diastolic augmentation.
Minerals :- Sodium Food Source NaCl, MSG, other food additives, milk, low in most raw foods Nutritional Functional role Essential nutrient: Deficiency is ra
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd