Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is the structure of the adult fern, What is the structure of the adult...

What is the structure of the adult fern within which cells undergoing meiosis can be found? In these plants meiosis takes place within structures known as sorus (plural, sori),

Agro industrial-packaging, Packaging Compound feeds, whether in mash o...

Packaging Compound feeds, whether in mash or pellet form, are packed in bags or stored in bins. Bags may be filled directly from mixers, pellet coolers or holding bins and wei

What are cytochromes, What are cytochromes? Cytochromes are proteins of...

What are cytochromes? Cytochromes are proteins of the internal mitochondrial membrane that are specialized in electron transfer and participate in the respiratory chain. Energi

How does a population differ from a community, How does a population differ...

How does a population differ from a community? A population having of all members of a single species that live in an area, while a community consists of all organisms of any s

What is the generic function of leukocytes, What is the generic function of...

What is the generic function of leukocytes? What are leukocytosis and leukopenia? The generic function of leukocytes is to contribute in the defense of the body against strange

Childhood obesity, Specify the things needed for a nurse-led primary health...

Specify the things needed for a nurse-led primary health care practice relating to childhood obesity. In particular, you need to do the following two things: (a) Indicate:

Reproductive disorders, Reproductive health disorders to dairy livestock ac...

Reproductive health disorders to dairy livestock accounts to a loss of about Rs 30,000- 50,000 crore annually to the nation. Better herd management can minimize the occurrence of d

Explain the modern trends in animal taxonomy, Explain the Modern Trends in ...

Explain the Modern Trends in Animal Taxonomy? Earlier you learnt how taxonomy is interrelated to other biological fields. You also learnt how information is used from other f

Explain viscosity and plasticity of colloidal particle, Viscosity and Plast...

Viscosity and Plasticity of colloidal particle Various degrees of viscosity and plasticity are encountered in colloids. Viscosity may be described as resistance to pouring.

List any five differences between dna and rna, Question 1 List any five...

Question 1 List any five differences between DNA and RNA 2 What is tandemly repeated DNA? Describe its types 3 What is rolling circle replication of DNA? How does it take place

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd