Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Usefulness of fungi for some industries, Q What is the usefulness of fungi ...

Q What is the usefulness of fungi for some industries? Fungi are industrially used in the production of fermented beverage, cheese, bread, and so on. A few fungi are very impor

Protozoa, what are characteristics of protozoa?

what are characteristics of protozoa?

What are the functions of the eyelids, What are the functions of the Eyelid...

What are the functions of the Eyelids? Functions of the Eyelids: The eyelid makes the outer most layers, covering the eye. Because of its strategic position, the eyelid s

Nursing assessment of acute glomerulonephritis, Nursing Assessment   Du...

Nursing Assessment   During assessment the child's parents will give you history of upper respiratory infection or skin infection  in the previous one to three weeks. Initially

What does radial symmetry mean, What does radial symmetry mean? What is the...

What does radial symmetry mean? What is the type of symmetry found in chordates? Which are other phyla of the animal kingdom that present species with radial symmetry? Radial

Puerperal psychosis and rape - psychiatric emergencies, Puerperal Psychosis...

Puerperal Psychosis: Child birth can precipitate schizophrenia, depression and mania. Management:  it  depends on  the nature of the symptoms. Danger  to  self and othcrs (inc

Clinical feature & medical complications of anorexia nervosa, Define Clinic...

Define Clinical Features and Medical Complications of Anorexia Nervosa? Anorexia nervosa, as we have learnt above, is a disorder characterized by deliberate weight loss, induce

Explain the cultural practices of single crop, Explain the Cultural Practic...

Explain the Cultural Practices of single crop Continuous cultivation of a single crop over years on the same site causes accumulation of a particular group of microbes, which d

Transport of oxaloacetate, Pyruvate   carboxylase   is a mitochondrial   ma...

Pyruvate   carboxylase   is a mitochondrial   matrix enzyme whereas the other enzymes of gluconeogenesis are situated outside the mitochondrion. Thus oxaloacetate are produced by p

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd