Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Avian infectious bronchitis (ib), A v i a n infectious bronchitis (IB) ...

A v i a n infectious bronchitis (IB) An acute, highly contagious respiratory disease of chicken caused by a member of the family Coronaviridae, IB was first recognized in I

Give a specific example of homeostasis, Give a specific example of homeosta...

Give a specific example of homeostasis An owl handles its body temperature by burning fuel to make body heat and by fluffing up its feathers to trap an insulating layer of air

Trophic structure-structure of community, Trophic structure Organisms i...

Trophic structure Organisms in a community are closely interrelated with each other through feeding relationships. Another aspect which is quite obvious in a community is th

Micro biology, explane the role of nitrogenase enzyme

explane the role of nitrogenase enzyme

Mollusca, commercially important bivalve species

commercially important bivalve species

Determine the functional structures of the leaf veins, What are the plant t...

What are the plant tissues that constitute the functional structures of the leaf veins? Leaf veins are made of vascular tissues. They are constitute by xylem and phloem that re

Acute versus chronic heart failure, When the syndrome sets in at a rapid ra...

When the syndrome sets in at a rapid rate before the compensatory mechanisms become operative, acute heart failure develops. The examples are acute heart failure due to acute myoca

What is severity and extent of lesion in cad, What is Severity and Extent o...

What is Severity and Extent of Lesion in coronaw artery disease? Apart from the high prevalence, the other disturbing features of CAD in South Asians are the severity and exten

Similarities and differences between the two species, Compare the teeth of ...

Compare the teeth of Australopithecus afaensis and Homo sapiens. a)Describe the similarities and differences between the two species. b) Write a hypothesis about dietary difference

Topical route for injection, Topical Route The medication in topical r...

Topical Route The medication in topical route is administered through ear, nose and eye. Drops are instilled into the nose, ear and eyes of the child in much the same way

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd