Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
The water on earth surface constitutes hydrosphere. About 75% of earth surface is covered with water and 97% of that water is present in oceans, which is very salty. We are only
Q. What are the five human digestive secretions? Which of them is the only pne that does not contain digestive enzymes? The human digestive secretions are: bile, saliva, gastri
what are the main coponents of human skeleton?
#phyletic lineage ..
Q. What is an etiological agent of disease? The etiological agent of disease is the agent that causes the disease. It may perhaps a living being, substance or environmental fac
The sewage treatment methods can be classified into the following heads: Primary treatment Secondary treatment Tertiary treatment 1. Primary Treatment: The primary
advantages and disadvantages of protozoa
NUCLEOPLAS M OR KARYOPLASM OR KARYOLYMPH OR NUCLEAR SAP Nucleoplasm and cytoplasm name proposed by E. Strassburger . Chemical composition of nucleoplasm given by Kossel . Co
Protozoans are microscopic in size however some are large enough to be seen with naked eye. Microscopic organisms such as these have numerous advantages, one of which is that they
Explain Acyclovir Available in topical, oral, and intravenous (IV) formulations, acyclovir is used to treat herpes simplex virus (HSV) and varicella-zoster virus (VZV) infectio
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd