Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Agro industrial-uterine infections, Uterine infections Uterine bacteri...

Uterine infections Uterine bacterial contamination compromises uterine functions. Initially, the uterus is contaminated with a wide range of bacteria, but this is not consiste

What is the transcription of the gene downstream, A substitution mutation o...

A substitution mutation occurs in the GRE making it unrecongnizable to the glucocorticoid receptor. What impact would this have on the transcription of the gene downstream of this

What are the two reactants, what are the two reactants and the two products...

what are the two reactants and the two products of a dehydration reaction/ What are the two reactants and products of a hydrolysis reaction

What are target organs of the hormones, What are target organs of the hormo...

What are target organs of the hormones? Target organs, target tissues and target cells are those exact organs, tissues and cells upon which each hormone acts and makes its effe

What is the significance of protein for the cell, Q. How does the sodium-po...

Q. How does the sodium-potassium pump present in the cell membrane work? What is the significance of this protein for the cell? The sodium-potassium pump is the transport prote

What is the embryonic development called, What are the cells produced in th...

What are the cells produced in the first stage of the embryonic development called? The cells that result from the cleavage (the first stage of the embryonic development) are k

Oogenesis, Oogenesis Oogenesis is the formation of ovum from oogonial...

Oogenesis Oogenesis is the formation of ovum from oogonial cells that are formed in the ovary from primordial germ cells. And as in spermatogenesis it involves meiosis to pro

D-glucose exists in all of the forms except, As a result of mutarotation, D...

As a result of mutarotation, D-glucose exists in all of the following forms EXCEPT: Select one: a. L-glucopyranose. b. alpha-anomer. c. free aldehyde (linear) d. bet

Equipment of cardio pulmonary bypass , Equipment : To maintain effective c...

Equipment : To maintain effective circulation and carry out functions of the lungs during an open heart operation the equipment should have: 1) Blood Pump 2) Oxygenator 3

Digestion, Adsk question #Minimum 100 words accepted#saliva enzyme

Adsk question #Minimum 100 words accepted#saliva enzyme

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd