Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define the Meaning of Isomerism? All monosaccharides exhibit isomerism. An asymmetric carbon or chiral carbon contains four different groups attached to it. The formula 2 n de
Estimation of protein by Miscellaneous parameters include? Miscellaneous parameters include Plasma amino acid levels Microbiological methods Chemical scoring
Q. What are Dopaminergic neurons? Dopamine Dopaminergic neurons occur in two closely connected groups: Ventral tegmental area (VTA) of the midbrain and Substantia nigra,(i
how does the hypothalamus begin puberty
Q What are the three major groups into which mammals are divided? The three groups into which mammals are divided are: monotremes (or prototherian that is platypus), placental
menstration
Radiobiology : This is the study of effects of radiations on living organisms. Radiobiology is a branch of science which concerned with the action of ions. Radiobiology is the radi
how is urea formed in the human body?
simplest way to learn their classifiction
Health And Economic Development - Linkage And Impact It is apparent that the relationship between health and development is a two wayprocess. While healthy people in a country
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd