Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain proteins as carriers, Explain Proteins as carriers? A large var...

Explain Proteins as carriers? A large variety of compounds are carried in the blood between tissues and organs of the body. Some of the compounds require specific protein for t

Reproduction, what are the methods of seed formation

what are the methods of seed formation

Explain about the carbohydrate malabsorption, Explain about the Carbohydrat...

Explain about the Carbohydrate Malabsorption? Carbohydrates malabsorption is usually caused by an inherited or acquired (in intestinal infection, celiac disease, PEM) defect in

Define a technique of implant by using a tissue punch, Using a Tissue Punch...

Using a Tissue Punch The implant heads are located and using a suitable sized tissue punch(depending on the implant diameter), the tissue punch is used and takes a circular pie

Radiobiology, Radiobiology : This is the study of effects of radiations on ...

Radiobiology : This is the study of effects of radiations on living organisms. Radiobiology is a branch of science which concerned with the action of ions. Radiobiology is the radi

Estimation of protein by availability of amino acids include, Estimation of...

Estimation of protein by Availability of amino acids include? Regeneration of blood and liver constituents includes Liver protein regeneration Blood protein regener

Classification of diabetes mellitus, Classification of Diabetes Mellitus ...

Classification of Diabetes Mellitus a) Type1Diabetes Mellitus i) Type 1 a ii) Type 1 b b) Type 2 Diabetes Mellitus c) Others i) Gestational Diabetes Mellitus

Determine what is the Cell Cycle, The cell cycle undergoes a sequence of ch...

The cell cycle undergoes a sequence of changes which involve a period of growth replication of DNA, Followed by cell division. This sequence of changes is called cell cycle.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd