Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
MICROBODIES Single unit membrane bound small spherical structures. Microbodies are structurally related to lysosome. On the basis of functions microbodies are of four typ
Q. Define Diabetic Ketoacidosis? Diabetic Ketoacidosis (DKA) is one of the acute complications of diabetes mellitus. The name itself implies that there is acidosis (decrease in
What are the general symptoms of brain tumors The general symptoms of brain tumors, which result from increased intracranial pressure, include headache, vomiting, swelling of t
Define Clinical Trials for Changing nutrient requirements with age? Several clinical trials provide evidence of changing nutrient requirements with age. The metabolic demand fo
Explain Future challenges of connecting models and data? Since biological systems are complex, models of biological systems are also complex, and matching models and data is a
Over the last three decades medical imaging has developed to be an important tool for medical condition diagnosis, treatment planning and surgery. The insight provided by informati
Q. Why is a leguminous crop rotation used in agriculture? The Leguminous crop rotation and other crop rotations are used in agriculture for the reason that in these plants many
how is an increase in glucose concentration controlled in the human body?
Explain about the Chromium Metabolism? Chromium appears to be absorbed throughout the small intestine, with absorption being higher in jejunum. The mechanism of absorption has
Animal Reproduction - Reproduction is the ability to produce new organism of its own type. It is meant to increase their number. Reproduction includes - (i) Replication o
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd