Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Describe the regulation of pyruvate dehydrogenase, Describe the regulation ...

Describe the regulation of pyruvate dehydrogenase through covalent modification. PDH exists in 2 forms :  Inactive, phosphorylated and Active, dephosphorylated. The active form

What is soil horizons, What is Soil Horizons   In a profile, different...

What is Soil Horizons   In a profile, different horizons or layers are identified by certain designations assigned after comparison of the properties of the layer with those o

Define prevention of idd - double fortified salt, Define prevention of idd ...

Define prevention of idd - Double Fortified salt? iron deficiency anaemia and iodine deficiency disorders often co-exist, the most effective approach to control these public he

Adrenaline and noradrenaline, Both these neurotransmitter strengthen memory...

Both these neurotransmitter strengthen memory when they are released into the blood stream following learning. Stressful events stimulate release of stress hormones from the adrena

Explain process of stress testing in women, Q. Explain process of Stress Te...

Q. Explain process of Stress Testing in Women? Estrogen has been implicated as a cause of ST depression. For years it seemed that estrogen protect women from coronary artery di

Describe about the detectors used in hplc, Question 1 Explain pharmacokine...

Question 1 Explain pharmacokinetic parameters observed in plasma concentration time curve Question 2 What is Gas Chromatography? Mention the quantitative applications of gas

What is excretion, What is excretion? Excretion in Physiology is the me...

What is excretion? Excretion in Physiology is the method of elimination of metabolic wastes and other toxic substances from the body.

Digestive system in planarias, Q. How are nutrients distributed through the...

Q. How are nutrients distributed through the digestive system in planarias? Planarias have single opening digestive system incomplete with ramifications that transport nutrient

What are the functions of insulin and glucagon, What are the functions of i...

What are the functions of insulin and glucagon for the blood glucose control? Glucagon enhances glycemia and insulin reduces it. They are antagonistic pancreatic hormones. Gluc

Common disease of camels, COMMON DISEASE OF CAMELS - 1 .       SURRA ...

COMMON DISEASE OF CAMELS - 1 .       SURRA - Surra = Rotten. Spread by biting & blood sucking flies, dropping neck, half closed eyes are common symptoms. 2 .

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd