Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is meant by "mutualist exploration of cellulose digestion", a phenomenon that occurs in some mammals and insects? Herbivorous animals eat great amounts of cellulose a s
sodium and potassium
Explain the Aseptic Technique - Sub Culturing? Aseptic technique is a series of procedures used to prevent contamination of cultures and sterile culture media. It is one of the
Management In case of small defects surgical treatment is not indicated because spontaneous closure may occur before one to two years of age. Patient is treated for conges
Calorific value is one of the most important characteristics of a fuel. It judges the efficiency of fuel. Calorific value is defined as "the total quantity of heat liberated, wh
What are protein hydrolysates? Proteins that have been treated with enzymes to break them down into amino acids or shorter peptides are referred to as protein hydrolysates. Pr
Driving Force - Mineral Nutrition Let us now find out what is the driving force involved in protein mediated transport. Many membrane transport proteins allow specific solute
How is the concept of chromosome related to the concept of the gene? A chromosome is a DNA molecule and chromosome may contain several different genes and as well DNA portions
SHORT COMING OF CELL THEORY / EXCEPTIONS OF CELL THEORY (i) Viruses can be considered as exception to cell theory. They are made of proteins and ones of nucleic acid i.e.
Principles Governing Cleavage a) The nucleus and mitotic achromatic figure tend to occupy the centre of active cytoplasmic density of the dividing cells, e.g., in isolecithal
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd