Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
discuss why obelia is considered to be of special interest in zoology as an animal showing an intermediate grade of organisation
it consists of the girdles and the skeleton of the limbs
explain polymorphism in lysosomes
Hypothetical Age Pyramids The three types of hypothetical age pyramids which are as follows: 1) A pyramid with a broad base, indicating a high percentage of young individua
How Parasitic infections are found? Parasitic infections are found throughout the world. With increasing travel, immigration, use of immunosuppressive drugs and the spread of A
Define reagents required and methodology for Benedict Test? Reagents Required - Sugar solutions of glucose, fructose, galactose, maltose, lactiose, sucrose and starch.
Future - Development Biology Fertilization in flowering plants is essential for sustaining life on earth. Production of most crops depends on the effectivity of the fertilisat
Which are the more abundant ribosomes in secretory cells - the free cytoplasmic ribosomes or those associated with the rough endoplasmic reticulum? Free cytoplasmic ribosomes
Cobalt deficiency The deficiency of cobalt is more commonly seen in ruminants fed on diets deficient in this essential micronutrient. Cobalt is stored only in limited amounts
Define the Techniques of Instrument Retrieval Endo Extractor (Brasseler) a. Hollow tube bonded to coronal tip of separated instrument by cyanoacrylate adhesive, with
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd