Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Why are vaccines made of the own disease agent, Why are vaccines made of th...

Why are vaccines made of the own disease agent or of fragments of it? The goal of vaccines is to artificially persuade a specific primary immune response (and the consequent fo

Differences between budding and fission, Differences between Budding and Fi...

Differences between Budding and Fission Both budding and fission are identical in at least one way in that the young ones produced by these procedures are the result of direct

Explain whipping foam method, Explain Whipping foam method? Whipping is...

Explain Whipping foam method? Whipping is the most common method used as it forms bubbles by cutting the surface and introducing air into liquid.  Repeated action makes the

Explain elephant trunk technique in aortic aneurysm, Explain Elephant Trunk...

Explain Elephant Trunk Technique in Aortic Aneurysm ? Elephant Trunk Technique :  When aneurysm involves arch of the aorta and large portion of descending thor

Define briefly the enzymatic proteins, Define Briefly the Enzymatic Protein...

Define Briefly the Enzymatic Proteins? The most varied and very highly specialized proteins are those along with catalytic activity - the enzymes. Virtually all the chemical re

Absorption of amino acids and peptides, Absorption of amino acids and  pep...

Absorption of amino acids and  peptides Generally,  the  dietary proteins are almost comp!etely  digested to their constituent amino acids and these are rapidly absorbed  from

Sequence for the beta actin gene, The sequence for the Beta Actin gene (ACT...

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta act

Bacterial diseases- braxy, Braxy The causative agent of braxy is Cl. s...

Braxy The causative agent of braxy is Cl. septicum. It usually affects lambs. The agent is a normal inhabitant of soil and is frequently found in the faeces of herbivores. Bra

Fats , FATS ( = True Fats, Triglycerides, Neutral Fats) They are es...

FATS ( = True Fats, Triglycerides, Neutral Fats) They are esters of fatty acids and 3-carbon trihydric alcohol glycerol (= glycerine). T rue fat is also called trig

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd