Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
conclusion on dna replication
Determine the types of Emulsions? A food emulsion is basically a two phase system consisting of a liquid, such as oil, wax or essential oil and water. An emulsion has 3 parts -
what major nerve do you think is being compressed when a person often feel pain in the posterior surface of the thigh radiating to the area behind the knee and where is the likely
Two parents who are each known to be carriers of an autosomal recessive alleles have four children. None of the children has the recessive condition. What is the probability that o
Analytic Characters - Nature and Structure of Community As you know a community has its own characteristics. Which are not shown by its individual component species. These cha
How can the hypothesis that asserts that chloroplasts as well as mitochondria were primitive prokaryotes that associated in mutualism with primitive anaerobic eukaryotic cells be c
Is the effect of genetic drift likely to be the same in pop 1 and pop 2? How are genetic drift and pop size related? When there is strong selection against the homozygous recessive
Although there are differences in interpretation of the evidence, it is generally accepted that human biological evolution has not been a linear progression from one species to the
Evolution of Metazoa The sponges, coming under phylum Porifera are the closest to Protista, and can perhaps be regarded even as a colony of protists rather than being multicel
Trace the flow of blood through the systemic circuit (hepatic portal system) and the pulmonary circuit, beginning and ending in the left ventricle. You will be using named chamber
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd