Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Meat as a Rich Source of Protein? Skeletal or striated muscles are used for food purposes. Flesh of cattle, sheep and swine comprise most of the meat contents. Edible me
What is polyembryony? Polyembryony is the phenomenon in which a single embryo in its initial embryonic stage separates itself forming many new individuals of the similar sex an
Consumers Heterotrophs (other nourishing) are incapable of photosynthesis and depend on organic food derived from animals, plants or both. Consumers can be divided into two br
The systems of your body are capable of performing specialized functions that keep you alive and enable you to reproduce. In a very general kind of way, a cell is also capable of p
how does cockroach respire
Shapes of viruses Viruses occur in a wide variety of shapes. Some are spherical or polyhedral . Some are helical appearing cylindrical or rod-like and other are complex. Virus
Oxidative phosphorylation Oxidative phosphorylation is a metabolic pathway which uses energy released through the oxidation of nutrients to generate adenosine triphosphate (ATP
Explain about the Connecting models and data? Perhaps the most dramatic change in quantitative environmental biology in recent years has been the burgeoning progress in the dir
Hydrops allantois (Hydro allantois) This condition is uncommonly seen in dairy cattle and buffaloes. Accumulation of excessive allantoic fluid may be progressive after mid ges
Determine about the microtubules The microtubules are hollow tubular structures formed by a special arrangement of two proteins called the alpha and beta tubulins. The microtu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd