Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Pasteurization and Sterilization - thermal processing? Pasteurization: Pasteurization is a mild heat treatment to kill part of the microorganisms present in food
Q. Why can it be said that each glucose molecule runs the Krebs cycle twice? Each glucose molecule "cycles" the Krebs cycle twice because after glycolysis each used glucose has
polymorphism and its causes
What is Waterston Shunt in palliative operations? In this, direct anastomosis between the posterior aspect of ascending aorta and anterior aspect right pulmonary artery is done
Illustrate in detail about the Cell theory All living organisms are composed of cells, and they are the basic structural and functional units of life, just like the atom is a
Q. What are the destinations of the organic material fabricated by the producers? The Part of the organic material synthesized by the producers is consumed as energy source for
What are meninges and cerebrospinal fluid? Meninges are the membranes that enclose and protect the central nervous system (CNS). Cerebrospinal fluid is the fluid that separates
Improvement of Soil Aeration Soil organisms greatly improve soil structure and facilitate aeration. Root decay leaves the soil riddled with channels, and the burrowing of worm
What was the Oral Status of the Patient It is imperative that the patient carry out a strict oral hygiene regimen as dental plaque is one of the main factors that leads to impl
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd