Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What are the consequences of iodine deficiency disorders? As discussed earlier under signs and symptoms, the consequences of IDD include: mental retardation, other defects in t
Explain the Techniques of Numerical Taxonomy Many other techniques of numerical taxonomy are available now, some with special objectives. Classification based on the methods
Which of the following statements about peptide bonds are true? Peptide bonds are amide linkages Peptide bonds form from nucleophillic attack by an electron pair on an alpha-
Explain about the Family and Social History - Assessment Recent studies suggest that genetic variation plays an important role in etiology of learning problems. Hence, the col
Ask qimporatance of sponge in tourism industry
Q. What are the respective functions of the separation of homologous chromosomes and of the separation of alike chromatids in meiosis? The separation of homologous chromosomes
why uracil is present in rna and thymine in dna?
Question 1 Discuss how you would perform mounting of stained sections. List commonly used mounting media in histopathology laboratory. Add a note on advantages and disadvantages o
Sublimation is the process by which solid water changes directly to vapour phase without passing through the intervening liquid phase. The gradual disappearance of flakes of ice
The Amazon rainforest in South America is a biodiverse ecosystem. There are large numbers of plant and animal species making up the food web, including over 350 species of predator
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd