Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Protozoa, What is meant by encystment

What is meant by encystment

Counselling at diagnosis, Q. Counselling at Diagnosis? A newly diagnose...

Q. Counselling at Diagnosis? A newly diagnosed case of diabetes will have lots of questions and will be confused regarding the treatment and complications of the diabetes. It i

Biotechnology, Clonig,plasmid vectors,lambda&M13based vectors

Clonig,plasmid vectors,lambda&M13based vectors

Describe shunts, Q. Describe Shunts? Detection, localization and quanti...

Q. Describe Shunts? Detection, localization and quantification of intracardiac shunts are one of the most important exercises in cardiac catheterization. In most cases a prelim

Define gender discrimination - public nutrition, Define Gender Discriminati...

Define Gender Discrimination - Public Nutrition? Of the detrimental factors, that affect food security, gender discrimination is the most pervasive and vicious. The fact that h

#nervous system, 6. What is the function of the myelin sheath? Do all axons...

6. What is the function of the myelin sheath? Do all axons present a myelin sheath?

Define the term - functional magnetic resonance imaging, Define the term - ...

Define the term - Functional magnetic resonance imaging Functional magnetic resonance imaging (fMRI) is a recent development that permits simultaneous measurements of the brain

List four common exercises you will recommend to a patient, List four commo...

List four common exercises you will recommend to a patient. Common exercises are: - brisk walking - cycling - swimming - playing tennis - dancing - rope skip

Biometric computer security systems, By the technology development, the pri...

By the technology development, the price of computer has become lower and lower. For this reason, a majority of family can afford this technology. A large amount of applications so

Parthenogenesis- asexual reproduction, Normal 0 false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd