Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Does the trend of the change in shape of the graph as temperature increases differ when a different gas is examined?
Ratios of the bases in different samples of nucleic acid yielded the following results: a. A + C = 0.6 b. A + C = 1 c. A + G = 1.2
Which of the following statements is wrong regarding eukaryotic replication origins? A. More origins are licensed and initiated within embryonic cells than in adult cells. B
Monosaccharide Sugar - carbohydrate consisting of a single sugar unit Have an aldehyde or a ketone group and 2-5 alcohol groups depending of the # of carbons
Draw structure of ethyl ammonium with all carbons and hydrogens.
Give an example of each of the following types of proteins: a. Enzyme b. Structural protein c. Motor protein
Define effect Micronutrients during pregnancy period? The need for many vitamins and minerals is increased during pregnancy. Since energy intake increases, the requirements for
Which is the cell organelle that is specialized in aerobic respiration? The cell organelles that are specialized in aerobic respiration are the mitochondria. Cell Respiratio
assignments
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd