Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain why meat products causes diabetics, Explain why Meat products cause...

Explain why Meat products causes diabetics Diabetics can have meat products in case they eat non-vegetarian food. Baking, roasting or grilling is preferable to frying. Patient

EMBRYOLOGY.., WHAT IS RECAPITULATION THEORY OF EMBRYOLOGY?AND WHAT IS EMBRY...

WHAT IS RECAPITULATION THEORY OF EMBRYOLOGY?AND WHAT IS EMBRYOLOGY

Echinococcosis (hydatidosis), Echinococcosis (hydatidosis) Echinococco...

Echinococcosis (hydatidosis) Echinococcosis, also called hydatidosis, is a global problem particularly in countries where sheep and cattle raising forms the major animal husba

Plant breeding, Describe about the role of plant breeding in crop improveme...

Describe about the role of plant breeding in crop improvement?

Cell determination, Cell Determination Cell determination is a process...

Cell Determination Cell determination is a process through which portions of embryonic genome are selected for expression in particular embryonic cells. Determination to follo

Protoplasmic - level of body organization, Protoplasmic - Level of body org...

Protoplasmic - Level of body organization Organisms which are made of just one cell are the simplest and the most primitive creatures called unicellular organisms. Their level

Do you know about lateral lines of fishes, Q. What are the lateral lines of...

Q. What are the lateral lines of fishes? The lateral lines of bony fishes are sense organs that extend along both sides of the animal body they make contact with the environmen

Enzyme vocabulary, what is a limited resourse needed by all cells?

what is a limited resourse needed by all cells?

Unitary explanation for protein synthesis, Q. Why is the concept of a singl...

Q. Why is the concept of a single gene as ultimateunit of inheritance inadequate to provide a unitary explanation for protein synthesis, recombination and mutation? Answer:

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd