Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Water Pollutants - Water Pollution Water pollution can occur on account of any one or more of the following agents: 1. Biological: Pathogens such as virus, bacteria,
Ketosis Ketosis, also known as acetonaemia or ketonaemia is a multifactorial disorder that commonly occurs in dairy cows and buffaloes immediately after calving or in early lac
There are specific sensitive/critical periods in development during which acquisition of certain skills is substantially easier than at other times. In the animal domain there are
How do CAM plants vary from both C 3 and C 4 plants? CAM plants open their stomata at night, while C 3 and C 4 plants open their stomata during the day.
Explain the Mode of Feeding or Nutrition Support? Do you recall studying about the nutrition support methods, namely enteral and perenteral feeding? These two methods form the
Abnormalities in the lipid profile are found in patients with diabetes mellitus. The lipid abnormalities increase the risk of heart disease in diabetics and hence should be regular
Interferons are small glycoproteins formed by virus-infected cells that inhibit viral infection. They are heterogeneous. Gamma interferons induce MHC class II antigens in macrophag
What is the typical localization of the tropical forests regarding latitude? Tropical rain forests, as the Amazon forest and the Congo forest, are typically located in low lati
-The expected phenotypic ratio of offspring. -The expected genotypic ratio of offspring. -Calculate the expected values you would use on a chi-square test (use genotypic rati
What is Ventricular Septal Defect (VSD) ? VSD accounts for 15-20 per cent of all CHDs. The ventricular septum may be divided into a small membranous portion and a large muscula
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd