Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Kangroo Rat Kangroo rat Dipodornys merriami, a native of South-West America is a classical example of how small mammals survive in desert. It exhibits all the osmoregulatoryad
Explain Gelatin - Tests for Presence of Exoenzymatic Activity? Gelatin is an incomplete protein as it lacks amino acid tryptophan. It is a major component of connective tissue
Q. Phylogenetic systems of classification? As already pointed out 'earlier that in Phylogenetic system, the plants are classified according to their evolutionary relationships.
Another type of soil for bacteria gardens Boil some rice or potatoes in a dish unless well cooked. Drain and save the water. Use the bouillon cube to the gelatin. Use th
Explain some Do's and Don'ts when working in Laboratory? 1) Always wear a lab coat when working a laboratory. 2) Ensure that no harm is caused to yourself or the people work
Soil – plant – animal relationship The plants derive the minerals from soil, and the animals from the plants / feed they consume and there is a dependent interrelationship bet
Explain Saquinavir Saquinavir (SQV, Fortovase, Invirase) - When administered as a single protease inhibitor, a soft-gel preparation (Fortovase) with improved bioavailability an
BLOOD - Blood is a mobile connective tissue composed of a fluid, the plasma and the cells, the blood corpuscles. Blood is basis of life. Blood is the softest tissues
Membrane Oxygenators: They are more physiological and are similar to natural lungs. There is separation of blood and gas by membrane across which gas exchange takes place. There
Alkaline slant - Observation for Carbohydrate Utilization Pattern Test Alkaline slant (red) and acid butt (yellow) with or without gas production - This indicates fermentation
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd