Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Protein synthesis with dna, Protein Synthesis with DNA The central dogm...

Protein Synthesis with DNA The central dogma of modern biochemistry is totally based on the coded information holded within deoxyribonucleic acid (DNA). Double stranded DNA is

What structure of the eye produces tears, Q. What structure of the eye prod...

Q. What structure of the eye produces tears? Lachrymal gland, which is a part of larger lachrymal apparatus, produces tears that flow over anterior surface of the eye. Most of

Basic principles of emergency psychiatry, BASIC PRINCIPLES OF EMERGENCY PSY...

BASIC PRINCIPLES OF EMERGENCY PSYCHIATRY:   Nurses handling psychiatric  emergencies should keep the following principles in mind:  The initial approach to a clienvpatien

What is biotechnology, What is biotechnology? Biotechnology is the appl...

What is biotechnology? Biotechnology is the application of biological knowledge to get new techniques, materials and compounds of pharmaceutical, medical, agrarian, industrial

Exercise- heat production, Exercise- Heat Production During physical ...

Exercise- Heat Production During physical activity heat production by exercise can to some extent substitute for heat generated by shivering. However, exercise also tends to

Define the etiology for bulimia nervosa, Define the Etiology for Bulimia Ne...

Define the Etiology for Bulimia Nervosa? Bulimia nervosa is a multifaceted disorder with psycologic, physiologic, developmental and cultural components. There may be a genetic

Autogamy - patterns of sexual reproduction, Autogamy - Patterns of Sexual R...

Autogamy - Patterns of Sexual Reproduction It is known to take place in many ciliate protozoans including Paramecium. Autogamy involves same nuclear behavior like in conjugati

Why the recipient important in transfusions, Why is the determination of th...

Why is the determination of the blood types of the donor and of the recipient important in transfusions? Red blood cells have dissimilar antigens in the outer surface of their

Explain about the freeze drying Method, Explain about the freeze drying Met...

Explain about the freeze drying Method? The Techniques of freeze-drying have been developed over the past half-century for the purpose of preserving certain biological material

Biological conduits, Biological Conduits : Freeze dried arterial, bov...

Biological Conduits : Freeze dried arterial, bovine MA, human umbilical vein, cryo preserved umbilical vein or artery and omniflow sheep collagen tube grafts also have poor

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd