Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Does natural selection produce an effect directly on genes, Does natural se...

Does natural selection produce an effect directly on genes, on genotypes, or on phenotypes? Explain please.

State the bio-medical waste management, Bio-medical waste management Pe...

Bio-medical waste management Persons coming in contact with bio-medical waste are prone to get injury from sharps likes needles. Injury due to sharps leads to life threatening

List down the various mycotoxins associated with food, Q. List down the var...

Q. List down the various mycotoxins associated with food? Mycotoxins associated with foods are: • Aflatoxins (produced by Aspergillus flavus) • Ochratoxin (produced

Byproducts high in energy and nitrogen, Byproducts high in energy and nitro...

Byproducts high in energy and nitrogen Byproducts in this category include products such as blood meal and poultry offal meal, fish meal, extracted oilseed meals/cakes and wast

Illustrate dilated cardiomyopathy, Q. Illustrate Dilated cardiomyopathy? ...

Q. Illustrate Dilated cardiomyopathy? It is a disease of unknown etiology, affecting myocardium. Its diagnosis is established by presence of left ventricular dilatation and sys

What are the autotrophic beings called, In the ecological study of food int...

In the ecological study of food interactions, what are the autotrophic beings called? In the Ecology autotrophic beings are called as producers because they synthesize the orga

Nutrient cycling in tropical and temperate forests , Nutrient Cycling in Tr...

Nutrient Cycling in Tropical and Temperate Forests From this study of the nutrient cycles you must have realised the importance of the role of green plants that take up nutri

Explain unresorbable barriers - root perforation, Explain Unresorbable Barr...

Explain Unresorbable Barriers - Root Perforation MTA exhabits excellent tissue biocompatible non resorbable barrier and restorative material. It represents an extraord

Genital warts and human papillomavirus infection, Genital warts and human p...

Genital warts and human papillomavirus (hpv) infection External genital warts are caused by human papillo- mavirus, usually type 6 or 11; other types (16, 18 and others) cause

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd