Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Adverse effects of Tenofovir disoproxil fumarate The most common adverse effects have been nausea, vomiting and diarrhea. Renal failure, including a Fanconi-like syndrome, has
In many countries of Asia biomass contributes l argely as a source of primary energy. People in rural areas at the peripheries of forests, continue to collect fuel wood from adjace
Based on your understanding of the nitrate reductase and nitrite reductase tests, why would the inclusion of nitrite inhibit anaerobic growth?
significance of gastrulation
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Signify the term Metacoel. The last of three coelomic spaces found in tripartate body plan characteristic of deuterostome lineage of animals. Other coelomic compartments are th
How do taenias classify according to the division of sexes? Taenias are monoecious (hermaphrodite), the similar individual has female and male reproductive organs and undergoes
How does nondisjunction in meiosis I and meiosis II look in males and females? Diagram it.
CHECKER BOARD (PUNNET'S SQUARE) METHOD 1. If the genotypes of the parents are known, the genotypes of their offspring can be easily predicted with the help of a chart c
A)Which of the following statements about DNA structure is true? 1.The nucleic acid strands in a DNA molecule are oriented ant parallel to each other, meaning they run in opposite
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd