Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Which is the type of nitrogen waste eliminated by beings of the class Reptilia? These beings excrete mainly uric acid. This substance is less toxic than ammonia and it can be k
Absolute time is one of the two types of geologic time (relative time being the other), with the distinct age date established generally by the decay of the radioactive elements,
Q. What is Acute Aortic Regurgitation? Infective endocarditis, aortic dissection and trauma often produce severe AR. Acute increase in left ventricular end diastolic volume es
Q. What is the structure that to maintains identical chromatids bound? The structure that to maintains identical chromatids bound is the centromere.
CELL WALL Discovered by Robert Hooke , 1665 when he saw dead empty cork cells. Bonne r - studied the chemical nature of cell wall. The cell wall is a rigid & prote
Composition of blood: Take few ml. of fresh blood in a test tube and before collecting the blood add a few drops of sodium oxalate or sodium citrate solution to prevent clot
Define Dietary Factors with Antinutritional Effects? In the above sections, we have learnt about a variety of food components having a host of health promotive properties. Let
Mature Embryo A typical dicotyledonous embryo, as seen in a median longitudinal section, consists of an embryonal axis having two broad cotyledons. The portion of embryonal ax
What is the exchange list? IL is a grouping of foods in which specified amounts of all the foods provide approximately equal amount of (the same amount) carbohydrate, protein a
What are the four types of weak bonds, and how do they differ from each other and from covalent bonds? When you eat a salad with lettuce, croutons, hard-boiled egg, bacon bits,
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd