Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is the typical shape of a population growth curve? How can the biotic potential be represented in the same way graphically? A usual population growth curve number of in
If you have a control group for your experience, which of the following statements is true? A. The control group should be identical to each test group with the exception of one va
What morphological structure is responsible for bacterial motility?
structure of centrosome and work
Palpate the radial or brachial artery pulsation while inflating the cuff to a level of 30 mm Hg above the point at which the brachial or radial artery pulsation disappears. Reinfla
what are the animals with respiratory organs?
How much time is required for a single cell of Detoxivicatium completeium to grown into a population large enough to fill the volume of the earth?
SPLEEN Largest lymph gland, also with myeloid tissue is an important specialized reticuloendothelial organ in vertebrates, as the site of erythropoiesis. Splenic tissue i
Name the most important allosteric effector of glycolysis in the liver. Fructose-2,6-bisphosphate is the most important allosteric effector of glycolysis in the liver
SEMEN - Sperms and secretion of accesory glands collectively known as seminal fluid or semen. It is milky, semi-solid in nature having particular smell. pH : 7.35 - 7.5. Spe
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd