Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Pancreas and its structure, PANCREA S - It is derived from the endoder...

PANCREA S - It is derived from the endoderm of the embryo. Structure . The pancreas lies inferior to the stomach in a bend of the duodenum. It is both an exocrine an

Etenobotany, Ethnobotany : This is the study of relationship between tribal...

Ethnobotany : This is the study of relationship between tribals and plants. Ethnobotany is from "ethnology" - study of culture or "botany" - study of plants. This is the scientific

What is chromosome, Is it possible that an X chromosome of a woman can have...

Is it possible that an X chromosome of a woman can have come from her father? It is not only possible that an X chromosome of a woman is from her father, it is certain. Every w

What are the etiological agents of malaria, Q. What are the etiological age...

Q. What are the etiological agents of malaria? The etiological agents of malaria are protozoans of the genus Plasmodium. There are four different kinds of plasmodia that cause

Echinoderms, Phylogenetic considerations

Phylogenetic considerations

Classification of plant on the basis of their resemblances, Q. Classificati...

Q. Classification of plant on the basis of their resemblances? Pliny seemed to have little interest in the classification of plant on the basis of their resemblances. He classi

Cell:the unit of life, cell wall of prokaryotic cell consist of what???

cell wall of prokaryotic cell consist of what???

Explain about the insulin syringe, Insulin Syringe To administer Insuli...

Insulin Syringe To administer Insulin properly, familiarize yourself with information about insulin: (a) insulin syringes, (b) storage, (c) site selection (d) steps for injecti

Group selection, The effect of natural selection on colonies or population ...

The effect of natural selection on colonies or population favouring one group in preference to other may be referred to as group selection. A group can be the smallest collection o

Stages of research process, Stages of Research Process: Planning Stage...

Stages of Research Process: Planning Stage The planning stage of research process  includes a  series of  interdependent steps consisting of 1)  conceptualizatioq of  the r

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd