Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
what are the branches of botany?
LIF E AS AN EXPRESSION OF ENERGY CHANGES - Energy is explained as capacity of body to do work. Energy may be as potential (stored) or kinetic (expended) energy. It ex
mode of action of wbcs types
Define Principle for Estimation of cholesterol - Lipids? Zlatkis and associates have evolved a method of quantitative determination of cholesterol based on a reagent containing
Explain the role of Bones in human biology? Bone is covered by a tough outer membrane called the periosteum. The periosteum contains systems of capillaries that supply the bone
OSTEOPORASIS - Reduction in bone tissue mass causing weakness of skeletal strength. It leads to crush fracture. It occurs in pastmenopausal women & elderly man. Common
Define Capsule Staining (Anthony Staining Method)? A rigid, well-organized gelatinous layer called capsule is present outside the cell wall of many bacteria e.g. Streptococus p
Q. What is the pH inside the stomach? Why is there a need to keep that pH level? How is it maintained? Which are the cells that produce that pH? The normal pH of the gastric ju
Explain the Transportation of Vitamin A? The chylomicra and retinal-binding protein play an important role in the transport of retiuol. This chylomicra complex enters the lymp
Determine sequence weights for the sequences ACTA, ACTT, CGTT, and AGAT in problem 1 by using Thompson, Higgins, and Gibson method a) compute pairwise distances between sequences
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd