Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define oral rehydration for treatment for pem, Define Oral rehydration for ...

Define Oral rehydration for treatment for pem? Since diarrhoea is very common in severe PEM, correction of dehydration is the first step in the treatment. Homemade (salt-sugar

Explain nature of fatty acids present in the triglyceride, Explain the Natu...

Explain the Nature of fatty acids present in the triglyceride? Nature of fatty acids present in the triglyceride determines the physico-chemical properties and biological signi

Tetrasporic embryo sacs, Tetrasporic Embryo Sacs In this group neithe...

Tetrasporic Embryo Sacs In this group neither of the meiotic divisions is accompanied by wall formation so that at the end of meiosis all the four haploid nuclei remain in a

Gluconeogenesis, Gluconeogenesis:   When  diet is deficient  incarbohydrate...

Gluconeogenesis:   When  diet is deficient  incarbohydrates. Glucose  or glycogen is formed from noncarbohydrate compounds principally from certain amino acids  and the glycerol of

Pericardium, The heart is enclosed in a membranous sac called the pericardi...

The heart is enclosed in a membranous sac called the pericardium. It has two layers- the fibrous pericardium which is the outer layer and the serous pericardium that lies inside th

Hibernation and aestivation, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Determine the stages of healing events, Determine the stages of healing eve...

Determine the stages of healing events The healing events are described in 3 stages Stage 1: Wound healing and formation of woven bone (callus) (2 to 6 weeks) Stage 2: La

Green house effect and global warming, The Term "Green House" effect was fi...

The Term "Green House" effect was first introduced by j. Fourier in 1827. The green house effects are the rise in temperature of earth because certain gases in the atmosphere (CO2,

Photosynthesis - responses of plants to stress, Photosynthesis - Responses ...

Photosynthesis - Responses of Plants to Stress Photosynthesis is also inhibited due to low water potential in the leaves. The leaf water potential is the sum of turgor pressur

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd