Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Which are the heart chambers respectively where the entrance and the exit of blood occur? The heart chambers through which blood enters the heart are the atria there are the
what is a Diaphragm
Secondary, tertiary, and quaternary structures of proteins are spatial structures. Denaturizing is modification in any of these spatial structures that makes the protein deficient
Q. Technical Requirements for pulmonary angiography? Digital subtraction pulmonary angiography with selective pulmonary arterial injections is vastly superior to conventional c
what are floating plants? detailed information
Non-Conventional Feed Resources There are many non-traditional or non-conventional materials which are available in abundance and can form potential source of feedstuffs for f
Mr. Smith is a 72 year male diagnosed with hypertension. Along with hypertension, Mr. Smith has been diagnosed with right-sided heart failure. The following are his list of medic
For an individual having a genotype formed of two different alleles that condition different varieties of the same phenotypical trait, upon what will the phenotypical feature actua
in natural vegetative propagation which structure gives rise to new individuals?
Explain about the Epilepsy? Epilepsy is a neuromuscular disorder in which transient seizures recur due to an abnormal brain activity. The brain, through all orderly electric ex
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd