Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Lipid Digestion Digestion of fats is also similar in both invertebrates and vertebrates. Lipases are the - enzymes that hydrolyse fats. A single lipase can catalyse many step
What is the mechanism of lipolysis?
Define Precautions for Simple Staining of Bacterial Cultures? 1. Heat fix all the bacterial smears. 2. Use clean, grease free glass slides. 3. Wash the stained slide gent
what so special for phylum annelida
The fragility of erythrocytes The fragility of erythrocytes is impaired in the absence of NADPH generation due to the deficiency of glucose-6-phosphate dehydrogenase thereby ca
FRUIT AND VEGETABLE FACTORY BY-PRODUCTS India is emerging as a major producer of fruits and vegetables in the world. The country produced about 50 Mt of fruits and 90 Mt of veg
What is allele frequency? The Allele frequency is the percentage of appearances of an allele in the genotypes of a given population (compared to the other alleles of the studie
Determine the use of natural colourants The use of natural colourants is limited due to their instability, low tinctorial power or price disadvantage. The trend towards natura
What is the Axes of Fick The Axes of Fick show that any eye position can be specified as the amount of rotation around a set of axes fixed in the orbit: 1) Vertical Axis: Z-
Q. Define Osseointegration from patients, microscopic and biomechanical points of view. a) From the view of the patient . An implant fixture is osseointegrated if it provid
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd