Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain Systemic Circulation in human biology? In systemic circulation, oxygenated blood is pumped from the left atrium through the bicuspid valve, into the left ventricle, and
Determine about the prokaryotes and eukaryote cell The eukaryotic cells, on the other hand, have a true nucleus wherein the genetic material, DNA is enclosed within a well-def
Define Body Mass Index (BMI)? Weight for height as a marker of nutritional status has the advantage that it is independent of other factors that affect foetal outcome such as m
Q. How can bacteria produce human insulin on an industrial scale? What are the other forms of insulin made available by the pharmaceutical industry? Bacteria don't naturally sy
S T ARC H - Polymer of a-D-glucose. Starch is glucosan homopolysaccharide which is the major reserve food of plants. Starch is formed as an end product of photosynt
What is Invertebrates? Invertebrates: About 99% of all the animals lack backbones, and are invertebrates! Invertebrates include the phylum Arthropoda, or the animals with joi
Photosynthesis is a process used by plants and other organisms to change the light energy captured from the sun into chemical energy which can be beneficial to fuel the organism's
It consists of: - Two kidneys that produce urine. - The left and right ureters that the urine travels through on leaving the kidneys. - The muscular urinary bladder, which
How life exist in earth?
What are the four initial stages of the embryonic development? The four initial parts of the embryonic development are the morula stage, the blastula stage, the gastrula stage
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd