Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Management of paediatric emergencies, MANAGEMENT OF PAEDIATRIC EMERGENCIES:...

MANAGEMENT OF PAEDIATRIC EMERGENCIES: Let us first discuss why  the  children are more  prone to  come across emergency situations.  Young children, because of  their inten

Stds, define stds give 5 examples of stds give signs, symptoms, treatment a...

define stds give 5 examples of stds give signs, symptoms, treatment and prevention of each example

Excretion, What is the excretory organ of an agama lizard

What is the excretory organ of an agama lizard

Circulatory system in cockroach, CIRCUL A T O R Y SYSTEM IN COCKROACH ...

CIRCUL A T O R Y SYSTEM IN COCKROACH Type is open or lacunar. i.e. b.v. absent. Organs are dipped in haemolymph. 1 .      HAEMOLYMPH - Blood and lymph are mixed.

Explain re- pera at ions and other interventions, Explain Re- pera at ions ...

Explain Re- pera at ions and Other Interventions ? These are required for residual VSD with significant shunt, residual RV obstruction and pulmonary valve regurgitation in a fe

Explain the differance between savanna and desert, Explain the differance b...

Explain the differance between savanna and desert? Savanna : Savanna is characterized by relatively low rainfall and pronounced dry seasons. This type of climate produces a b

Describe valvar aortic stenosis murmurs, Describe Valvar Aortic Stenosis Mu...

Describe Valvar Aortic Stenosis Murmurs ? Characteristic: Harsh, rasping crescendo-decrescendo murmur best heard anywhere in a straight line from right 2nd ICS to apex ("sash"

Procedure of hormone act, Procedure of Hormone Act All plant hormones ...

Procedure of Hormone Act All plant hormones show extraordinary varied complex effects in controlling plant growth and development, Extrapolation from how an animal hormone wor

Under which environments do echinoderms live, Q Under which environments do...

Q Under which environments do echinoderms live? Echinoderms are marine animals and they live in salt water.

Explain the coliforms - microbiological study of water, Explain the Colifor...

Explain the Coliforms - Microbiological Study of Water? These are widely used indicators which belongs to the family Enterobacteriaceae and make up about 10% of the intestinal

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd