Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

The kidney, diseases of the kidney and their remedies

diseases of the kidney and their remedies

Estimation of protein by availability of amino acids include, Estimation of...

Estimation of protein by Availability of amino acids include? Regeneration of blood and liver constituents includes Liver protein regeneration Blood protein regener

Define about the metabolism of copper, Define about the Metabolism of Coppe...

Define about the Metabolism of Copper? In food, most copper is present as Cu 2+ and some as Cu 1+ . This copper is bound to organic compounds especially protein. Gastric HCI p

Most appropiate hypothesis about the origin of life on earth, What is the m...

What is the most accepted hypothesis about the origin of life on earth? How does it compare to the other main hypotheses? The heterotrophic hypothesis is the strongest and most

Explain about the pregnancy and obesity, Explain the Pregnancy and Obesity?...

Explain the Pregnancy and Obesity? Obesity is associated with increased risk for gestational diabetes, hypertension, pre- eclampsia, perinatal mortality and the need for induce

Results of cabg , Results of CABG: In most centres where this operation ...

Results of CABG: In most centres where this operation is routinely conducted the mortality is 1-2 per cent. In high-risk group of patients this may go up to 5 to 10 per cent.

Virus is in an inactive state, Q. What is signifying when it is said that a...

Q. What is signifying when it is said that a virus is in an inactive state? Viruses considered in inactive state are those whose genetic material is within host cells without a

What is the molarity of the solution, The molecular weight of "Y" is 200. I...

The molecular weight of "Y" is 200. I use 10g of "Y" in 10mL of water. What is the molarity of this solution of "Y"? What percentage solution of "Y" is it?

How to facilitate information transfer during transcription, How is energy ...

How is energy used to facilitate information transfer during transcription?

Which are the eukaryotic, Which of the following are eukaryotic? Bacteria p...

Which of the following are eukaryotic? Bacteria protists fungi animals' archaea plants and animals only all of the choices are eukaryotic.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd