Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
How are the transparency and functions of cornea evaluated? Physiological roles of barrier function, refractive function (with interaction of tear film), response to wound and
Q. What do you mean by Taxonomist? Modern classification systems are based on many types of evidence. A truly natural classification is obtained from analysis and harmonisation
In the human body, the potassium ion can pass easily through cell membranes, yet the potassium ion concentration is higher inside many cells than it is outside these cells. Could t
R E TIN A - It is inverted. Innermost, sensitive layer. The part of ratina which is attached to choroid is pars optica. The part of retina attached to cilliary b
Q. Discuss the advantages of implant supported maxillo-facial prosthesis. Maxillofacial Prosthodontics involves the prosthetic rehabilitation of patients with congenital or acq
How can i design an experiment to compare the heat output by two different types of germinating seeds?
Determine the Principles of suturing These are universal principles which are applicable in all aspects not just implant surgery: 1. Sutures should always be inserted throug
what is the term used for study of sponges,protozoa,colentreta,molusca,fish,aves,mammal
Q. Explain Consciousness as inner state? Consciousness as inner state: We are conscious of thoughts, images, emotions and memories within ourselves though they may not have phy
Valvular heart diseases : Congenital and acquired valvular heart diseases often require surgical intervention. 1 is well known that conservative surgery by valve repair gives bet
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd