Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. How different are hemoglobin and oxyhemoglobin? Where is it expected to find a higher concentration of oxyhemoglobin, in peripheral tissues or in the lungs? Oxygen-bou
Q. How can an organism that once underwent contact with an antigen be immunized against future infections by the same agent? This phenomenon is called as immune memory when an
I need the Answers for the final exam for biology it''s a one hundred question test if you can help i would appreciate it
What is Splitin first heart sound ? In complete RBBB, due to delay of tricuspid closure, the split is wide. In complete LBBB, due to delay of mitral closure the S I is single.
ROLE OF FAT OR LIPIDS - Made up of fatty acids & glycerol. Linked by ester bond. Maximum quantity of energy is librated. Helpful in temperature regulation. As stored f
Question 1: Describe the process of hearing. The ear consists of three basic parts - the outer ear, the middle ear, and the inner ear. Discuss the process of hearing
Question 1 Write short note on inflammatory response 2 Give an account of attenuated vaccines 3 What is innate immunity? Explain its characteristic features 4 What adjuvants? E
TB in pregnancy Treatment of TB should be initiated in pregnancy when there is moderate to high suspicion of disease because active infection during pregnancy poses a risk to t
classification of protozoa
This process involves the regulation of the concentration of the body fluids through control of water content and salt content of the blood. If a person loses water from their bloo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd