Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Clinic blood pressure management, Raised blood pressure is a major risk fac...

Raised blood pressure is a major risk factor for cardiovascular disease. The higher the blood pressure, the higher the risk of stroke, coronary heart disease, kidney disease, heart

Define some detrimental effects of fungi, Define some Detrimental Effects o...

Define some Detrimental Effects of Fungi? These cause diseases of animals and humans. These either cause superficial mycoses (infection of skin, hair and nails) or systemic

Define biogeographic realm, Q. Define biogeographic realm? Biogeographi...

Q. Define biogeographic realm? Biogeographic regions are large areas that contain characteristic assemblages of animals and plants, d elineated on account of natural barriers s

What is low - density lipoprotein receptor pathway, Q. What is low - densit...

Q. What is low - density lipoprotein receptor pathway? Ans. The increasing cellular free cholesterol generated regulates the activities of two enzymes that are of crucial

What is hemorrhage, What is Hemorrhage Mild to moderate capillary ooze...

What is Hemorrhage Mild to moderate capillary ooze can readily be controlled by pressure packing. A more severe venous or, in rarer instances, an arterial bleed may require cl

Function of cholecystokin in the digestive process, Q.How is it produced an...

Q.How is it produced and what is the function of cholecystokin in the digestive process? The fat level of the chyme detected in the duodenum stimulates the secretion of cholecy

Karyotype, KA R YOTYPE External morphology of Chromosomes specific...

KA R YOTYPE External morphology of Chromosomes specific for each species of living organisms. Karyotype can be studied in metaphase of mitosis. Karyotype includes th

Phylum protozoa, PHYLUM  PROTOZOA Definition  and  Introduction  ...

PHYLUM  PROTOZOA Definition  and  Introduction  All  unicellular ( or  acellular )  eukaryotic  animals. Most  primitive (Gr. Protos = first=zoon= animals ) organisms

Sugarcane, what the by products of sugarcane

what the by products of sugarcane

Explain spread plate method - pure culture techniques?, Explain Spread Plat...

Explain Spread Plate Method - Pure Culture Techniques? In this method, diluted microbial suspension containing about 30 to 300 colonies is spread uniformly on the agar surface

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd