Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Concept of species, Many definitions of species have been offered, but none...

Many definitions of species have been offered, but none of them proved to be satisfactory. The definitions did not categorically provide the basis to decide whether two similar gro

What are the factors to an actual shift in the supply curve, What are the f...

What are the factors to an actual shift in the supply curve? Factors which cause an actual shift in the supply curve are described in below: When prices rise or fall this wo

Pathology of aortic regurgitation, Q. Pathology of aortic regurgitation? ...

Q. Pathology of aortic regurgitation? In Post Inflammatory situations scarring and retraction of valve cusps lead to aortic regurgitation. Varying degrees of commissural fusion

How are the plant tissues classified, How are the plant tissues classified ...

How are the plant tissues classified according to their functions? Plant tissues are separated into growth (embryonic) tissues, supporting, filling and photosynthetic tissues (

What is short bowel syndrome, Q. What is Short Bowel Syndrome? Short bo...

Q. What is Short Bowel Syndrome? Short bowel syndrome is a group of problems affecting people who have /had half or more of their small intestine removed. The massive resection

How is a disease-resistant plant selected for breeding, How is a disease-re...

How is a disease-resistant plant selected for successful breeding? Why is the process of fertilisation in a flowering plant referred to as double fertilisation? Explain. Nam

Packaging of meat products, P a ck a g i n g of Meat Products Me...

P a ck a g i n g of Meat Products Meat needs to be packaged to prevent contamination, color deterioration, loss of moisture, odor pickup, oxidative rancidity etc and pro

Amount of proteins present in the cell, Cells regulate their level of activ...

Cells regulate their level of activity by regulating the amount of proteins present in the cell at any given time, so an up regulation of enzymes would be expected to A. increase t

Volvox, what is the necessity of interdependence of a volvox organism in th...

what is the necessity of interdependence of a volvox organism in the colonial existence?

Stomatal resistance, Stomatal Resistance Stomatal resistance is most i...

Stomatal Resistance Stomatal resistance is most important because gas exchange between leaves and external atmosphere takes place entirely through stomatal pores. Stomatal res

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd