Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Other Complications of Prosthetic Valves : One of the dreaded complications of mitral valve replacement is ventricular rupture. It is difficult to manage and so it is better avoi
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
what is phulum cnideria
Q. Explain about Maple Syrup Urine Disease? Maple Syrup Urine Disease (MSUD) is a group of inherited metabolic disorders of three branched chain amino acids (BCAA) namely leuci
protozoa locomotion
Atherosclerosis, the most common part of hardening of the arteries, is characterized by the presence of cholesterol-rich arterial thickenings (atheromas). This progressive diseas
Potassium, Calcium, Iron and Magnesium - Microorganism? These are supplied by inorganic salts and exist in the cell as cations. These perform various functions in the cell like
Explain Back pain, arthritis and gout - Effect of Obesity? Abdominal obesity increases the risk of back pain because of the extra load on the spinal column. This, in turn, red
Which of the following does NOT contain a guanidinium group Select one: a. Urea b. arginine c. creatine d. guanidinium ion
Explain Poor growth - clinical signs of kwashiorkor? Growth retardation is the earliest manifestation of kwashiorkor, the child will be lighter and shorter than its normal peer
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd