Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

The graph as temperature increases differ, Does the trend of the change in ...

Does the trend of the change in shape of the graph as temperature increases differ when a different gas is examined?

Ratios of different samples of nucleic acid, Ratios of the bases in differe...

Ratios of the bases in different samples of nucleic acid yielded the following results: a.  A + C    =   0.6         b.     A  +  C    =  1            c.       A  + G    =  1.2

Determine the eukaryotic replication origins, Which of the following statem...

Which of the following statements is wrong regarding eukaryotic replication origins? A. More origins are licensed and initiated within embryonic cells than in adult cells. B

Monosaccharide sugars, Monosaccharide Sugar - carbohydrate consisting o...

Monosaccharide Sugar - carbohydrate consisting of a single sugar unit Have an aldehyde or a ketone group and 2-5 alcohol groups depending of the # of carbons

Sketch structure of ethyl ammonium, Draw structure of ethyl ammonium with a...

Draw structure of ethyl ammonium with all carbons and hydrogens.

Give an example of structural protein, Give an example of each of the follo...

Give an example of each of the following types of proteins: a. Enzyme b. Structural protein c. Motor protein

Define effect micronutrients during pregnancy period, Define effect Micronu...

Define effect Micronutrients during pregnancy period? The need for many vitamins and minerals is increased during pregnancy. Since energy intake increases, the requirements for

Explain about aerobic respiration, Which is the cell organelle that is spec...

Which is the cell organelle that is specialized in aerobic respiration? The cell organelles that are specialized in aerobic respiration are the mitochondria. Cell Respiratio

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd