Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
what is heterotrophic nutrition ?
Give an introduction to intensive care ? Intensive Care Medicine has its origins from the polio epidemic of 1952 in Copenhagen. Patients who suffered respiratory paralysis were
Q. An mRNA molecule codifies only one kind of protein? Eukaryotic cells have monocistronic mRNA, that is each mRNA codifies only one polypeptide chain, Prokaryotes can present
Long-hair in cats is due to a recessive long allele, l. Black cats are due to a recessive agouti allele, a. A short-haired tabby cat is crossed to a long-haired tabby cat, and they
Who was Charles Darwin? Charles Darwin was an English naturalist born in 1809 and considered the father of the theory of evolution. At the end of the year 1831, before turning 23
what is human circulatry system
Q. What is Colony Collapse Disorder? Bee colonies are attacked by a variety of pathogens and parasites. One major pathogen is the acute bee paralysis virus (IAPV), which cau
Why Ascending Method of Paper Chromatography is Preferred? The ascending method is preferred because of the simplicity of the set up. In actual method the substance to be separ
Crown and bridge remover - Nash\Taylor temporary crown remover -morell remover -position the curved tip below the height of contour or at the margin of the crown -Apply seve
Explain the Precautions for Sub-Culturing of a Culture 1. Sterilization of inoculating wire before and after the transfer is a must. Sterilized wire should not be kept on labor
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd