Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
show heading wise characteristics of phylum platyhelmenthiese
Explain the Toxicity of Vitamin E? Vitamin E is relatively non-toxic. Adults tolerate doses as high as 100 to 1,000 IU per day. However, adverse effects such as muscle weaknes
Algae have cell wall made up of: 1. Cellulose, galactans and mannans 2. Hemicellulose, pectins and proteins 3. Pectins, cellulose and proteins 4. Cellulose, hemicellulo
Tr aditional Meat Products The rich heritage of India contributes to wide range of traditional foods and has a role to play in health foods. Indigenous meat products are uniqu
Q. Most insects have wings. Which is the other animal phylum that contains creatures with analogous organs? Besides the phylum Arthropoda another animal phylum with flying crea
Define tracheal system in details. Respiratory system found in insects and some spiders where air passes directly to the tissues through a series of tubules. Since oxygen tran
Determine the fuction of Monomeric enzymes Monomeric enzymes include, pepsin, like the pancreatic serine proteases, plays a role in the digestion of proteins eaten by mammals.
Explain the Mortality and Survivorship Curves? Mortality : Just as a population has a birth rate, so does it have a death rate. A populations rate of death, or the number of
Explain Advantages and Disadvantages of Spread Plate Method? The advantages and disadvantages of spread plate method are highlighted next. Advantages 1. It is useful fo
Relate Mitochondria organelles with eukaryotic cells Mitochondria are highly specialised organelles in eukaryotic cells. These perform the energy transducing process, and are o
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd