Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
To be in good health, we need to take food. Energy is provided by food to carry out activities in day to day life. In the same way, a diabetic patient also needs healthy food for e
Water is widely used in various process applications in industry. Other major industrial uses are boiler feed water and cooling water. The king and degree of treatment of water in
What is black mold? Mold is a fungus. Black mold is not an official term, since it is not possible to tell with the naked eye what type of mold is present, and many of them app
Which of the following pairs of events in a human female occur at, or nearly at, the similar time during the menstrual cycle? A. High blood plasma LH levels and ovulation. B
Cost due to Damage to Equipment Cost due to Damage to Equipment, Property etc. Tooling may have to be redesigned, adding cost. Cost due to reduced output and delay
Q. What are some factors that can lead to protein denaturation? Protein denaturation can be caused by temperature variation, pH change, changes in the concentration of surround
R uminal tympany (Bloat) It is the over-distension of the rumen with gases which may be either frothy or free gas. The disease is characterized by change in silhouette of the
Question 1 Discuss eukaryotic replication Question 2 Write an account on eukaryotic transcription factors Question 3 Write a detailed account on eukaryotic translation e
What is the functional unity of the kidneys? The functional (filtering) unity of the kidneys is the nephron. A nephron is made of afferent arteriole, efferent arteriole, glomer
Unconventional oilseed cakes/meal Deoiled sal (Shorea robusta) seed meal: It is a byproduct obtained after the extraction of oil from sal seeds. It is found to be high in NF
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd