Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define the nutrient requirements during trauma, Define the Nutrient Require...

Define the Nutrient Requirements during Trauma? Nutritional assessment of the trauma patient is done to determine energy and protein requirements. Basal energy requirements are

Describe the external features of the heart, Question 1 Describe the exter...

Question 1 Describe the external features of the heart. Add a note on circulation of blood within the heart Question 2 Discuss the major joints of thorax and pelvis Quest

Drug injection and hepatitis , Task: Write a maximum of five (5) pages of y...

Task: Write a maximum of five (5) pages of your research plan which should include details on the following topics as appropriate to your chosen study design: I. Background info

Characterstics of cleavage, CHARACTERSTICS OF CLEAVAGE - In cleavage...

CHARACTERSTICS OF CLEAVAGE - In cleavage involve the series of mitotic division, so daughter cells are genetically similar to the parental cell. The resulting cells are c

What is the phase of the menstrual cycle, In general what is the phase of t...

In general what is the phase of the menstrual cycle when copulation may lead to fecundation? Although this is not a rule, to be effective fecundation in general must happen wit

How does poliomyelitis affect the neural transmission, Q. How does poliomye...

Q. How does poliomyelitis affect the neural transmission in the spinal cord? The poliovirus destroys and parasites spinal motor neurons causing paralysis of the muscles that de

Effect on microbial growth of pH, Q. Effect on Microbial Growth of pH? ...

Q. Effect on Microbial Growth of pH? Every microorganism has a minimal, a maximal, and an optimal pH for growth. In general, bacteria grow in the pH range of 6.0-8.0, yeasts 4

Why is the cerebellum more developed in mammals, Why is the cerebellum more...

Why is the cerebellum more developed in mammals that jump or fly? The cerebellum is the major brain structure that coordinates the movement and the equilibrium of the body. For

Explain the primary root growth, Explain the Primary Root Growth? Prim...

Explain the Primary Root Growth? Primary Growth in Roots :  Roots grow down and through the soil by adding new cells at the tip of the root (called the root tip). There is a

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd