Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

State in detail about the thylakoid membrane, State in detail about the thy...

State in detail about the thylakoid membrane The thylakoid membrane contains all the factors associated with the photosynthetic electron transport leading to the generation of

What is the mean of crp, CRP is a marker of systemic inflammation. As the r...

CRP is a marker of systemic inflammation. As the role of inflammation in the initiation and progression of atherosclerosis becomes better understood, CRP has gained prominence as a

Explain about the qualitative tests for carbohydrates, Explain about the Qu...

Explain about the Qualitative Tests for Carbohydrates? This section will familiarize you with simple techniques and tests to identify carbohydrates in a laboratory. The objecti

Explain about the paediatric and geriatric nutrition, Explain about the Pae...

Explain about the Paediatric and Geriatric Nutrition? Every stage has its unique requirements due to different changing needs. Adequate and optimum nutrition support is very im

What is self-catalytic rnas, Q. What is self-catalytic RNAs? Ribozymes...

Q. What is self-catalytic RNAs? Ribozymes - Term 'ribozyme' was initially suggested by Thomas R. Cech, Nobel Prize winning biochemist, who discovered this class of RNA molecul

Define about the storage of zinc in humans, Define about the Storage of Zin...

Define about the Storage of Zinc in Humans? Zinc is found in most organs, concentration being higher in liver, kidney, muscle, skin and bone. Zinc content of muscle, brain, lun

Explain about the herbal of valerius cordus, Explain about the Herbal of Va...

Explain about the Herbal of Valerius Cordus? The Herbal of Valerius Cordus published posthumously in 1561; contained not only medicinal plants found in Germany and Italy, but

Determine about the nervous system and behaviour, Determine about the Nervo...

Determine about the Nervous System and Behaviour Damage to certain parts of the brain will be reflected as behaviour deficits. For example, damage to the temporal lobe may affe

Becoming online tutor, how can i work with u as an online biology tutor?

how can i work with u as an online biology tutor?

Show the symptoms of salmonellosis, Q. Show the Symptoms of salmonellosis? ...

Q. Show the Symptoms of salmonellosis? Symptoms: The susceptibility of humans varies with the species and strains of the organism and the total number of bacteria ingested. A

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd