Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
How does biological diversity relate to the characteristics of the abiotic factors of an ecosystem? The availability of abiotic factors as light, moisture, mineral salts, heat
Q. What is the antagonism between the sympathetic and the parasympathetic neural actions? In general the action of the parasympathetic and the sympathetic are antagonistic that
Name some emulsifiers which are present in nature? There are many emulsifiers which are present in nature such as phospholipids e.g. lectin which is present in egg yolk which a
Q. What is the ecological role of earthworms? Earthworms have an important ecological role as they eat decomposing organic material. They also dig tunnels in the subsoil allowi
The major component of food is protein. The proteins ingested as part of our diet are not the same proteins required by the body, nor can large molecules be absorbed from the gut.
Plasma membrane and cell wall is not the similar thing. Plasma membrane, also known as cell membrane, is the outer membrane common to all living cells and it is made of a phospholi
Fructose-1,6-bisphosphate and Fructose-6-phosphate : The conversion of fructose-1,6- bisphosphate to fructose-6-phosphate is catalysed by fluctose-1,6-bisphosphatase which i
Q. What are the main intraspecific ecological interactions? The major harmonious intraspecific ecological interactions are societies and colonies. The major inharmonious intras
Compare and contrast the effect of a deletion in the operator of the lactose operon with one in the operator of the tryptophan operon.
Calculate the molar concentration of illinic acid and of its conjugate base illinate ion (in moles/L; M) in a 0.002 M illinate buffer at pH 12.0. The pKa of illinic acid is 6.7. En
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd