Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define about the Growth and development in children? Growth and development in children can be studied under the following heads: . • Changes in physical development and bod
Change in nucleus during cleavage
Q. Foods for phenylketonuria patient? The majority of foods for a PKU patient should come from the bottom half of the pyramid. As you may have observed, this contains the pheny
Which are the molecules that make possible active transport through membranes? Active transport is made by exact membrane proteins. These proteins are called "pumps" because
Why Nutrition is important for health Nutrition is one of the basic components of life. It is an essential part of health care. You already know that good nutrition is essent
Define Light Source of Microscope? It is either mirror or electric illuminator present at the base. Identify the mirror in Figure. Some microscopes have reversible mirror with
Kinds of Succession - Ecology The ecological succession can be broadly classified into two kinds, on the basis of the nature of the habitat. Figure: Kinds of Success
Explain the Feeding process for Preschoolers? The word preschool children, you may be aware, is used for children less than six years of age. After the first year, there is a s
Calvin cycle (the aka Calvin-Benson Cycle or the Carbon Fixation) is the series of biochemical, enzyme-mediated reactions during which the atmospheric carbon dioxide is reduced an
Ribosomes - It is also known as Protein factory, Engine of the cell. Ribosomes are smallest cell organelles (150 x 250 Å). Unit membrane less cell organelle. Ribo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd