Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Temperature stress, Temperature Stress We know that temperature alongwi...

Temperature Stress We know that temperature alongwith water is an important influence on the geographical distribution and range of organisms. Every organism is restricted to a

Definition of osseointegration in microscopic biology, Q. Definition of Oss...

Q. Definition of Osseointegration in microscopic biology? From a view point of macro and microscopic biology and medicine. Osseointegration of a fixture in bone is defined as t

Digestive system - oesophagus, OESOPHAGU S - Gullet opens in oesoph...

OESOPHAGU S - Gullet opens in oesophagus. First organ of alimentary canal. After piercing diaphragm, it form stomach in abdominal cavity. No digestion in it. Food mov

Describe what types of results describe hypothesis, Why did giraffes develo...

Why did giraffes develop long necks? 1) Describe an experiment to test this hypothesis. Be explicit about the methods you will use, the setting, the time that the experiment wil

Parazoans and simplest metazoans, in what aspect are the cnidarians simila...

in what aspect are the cnidarians similar to the protozoans?

What are the factors responsible for corneal hydration, What are the factor...

What are the factors responsible for corneal hydration? The factors responsible for corneal hydration are as follows: i. Stromal swelling pressure ii. Barrier function of

Define protein as an energy source, Define Protein as an energy source? ...

Define Protein as an energy source? Proteins contribute to the body's energy need. If diet does not furnish enough calories from carbohydrates and fats, proteins are catabolize

What is frog central nervous system, What is frog central nervous system ...

What is frog central nervous system Consider Neuron B in the frog central nervous system whose plasma membrane has a newly discovered ligand-gated ionotropic receptor, named th

Surrogacy, what is surrogate motherhood

what is surrogate motherhood

Cells, #question.why are active cells small .

#question.why are active cells small .

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd