Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What are the five human digestive secretions? Which of them is the only one that does not contain digestive enzymes? The human digestive secretions such as: saliva, gastric jui
Individual Psychotherapy: It is conducted on one to one basis. It is effective when a therapeutic rapport develops between patient and therapist. The common types of indiv
Eczema and Dermatitis: Eczema and Dermatitis are a common problem all over the world. Their incidence is 2-3 per cent of all medical problems seen in practice (about 30 per
Direction of flow--either towards or away from the transducer (positive or negative Doppler shifts). Timing-instantaneous velocity and direction of flow throughout the various
Define Barrier layer cells (photocells) They are the very simple of the detectors. It contains the bottom support layer of conductive metal like iron. A photosensitive layer of
Explain Inhibition of cancer cell proliferation and growth? Vitamin D diminishes proliferation of abnormal intestinal, lymphatic, mammary and skeletal cells and provides a pote
Q. Can two normal individuals of the same species with sexual reproduction have identical karyotypes and identical genomes? And how is the human karyotype usually represented?
Define Importance of Intestinal Bacterial Synthesis as a Source of Vitamin K? Intestinal microflora synthesizes large amounts of menaquinones, which are potentially available a
MOVEMENT OF BODY PARTS - Movement of appendages bring about locomotion. Perapodia, setae in Annelida, jointed legs in Arthropoda, flat foot in mollusca, tube feat in sta
Q. Illustrate about Components of an Angioplasty System? 1) Guiding catheter: The ideal guiding catheter must have a lumen diameter i.e. at least twice that of the diagnostic c
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd