Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Determine the lateral cephalometric skull view, Determine the Lateral Cepha...

Determine the Lateral Cephalometric Skull View The use of this modality is limited in preoperative evaluation in implant placement for advance cases where there is a need for b

Biosynthesis of amino acids, Microorganisms and Plants can synthesize all o...

Microorganisms and Plants can synthesize all of the 20 standard amino acids. Mammals, furthermore, cannot synthesize all 20 and must obtain some of them in their diet.  Those  amin

Explain the procedure for preparation of bacterial smear, Explain the Proce...

Explain the Procedure for Preparation of Bacterial Smear? Start the exercise by following the steps enumerated herewith. (1) Take properly washed and dried glass slides for

Vital signs of clinical evaluation, Vital Signs of clinical evaluation ...

Vital Signs of clinical evaluation Patient's clinical evaluation starts with the examination of certain vital signs which are: B.P. (Take average of two regarding with atlea

Biochemical reactions - nitrate assimilation, Biochemical Reactions - Nitra...

Biochemical Reactions - Nitrate Assimilation Nitrate is the most readily available and preferred source of nitrogen for growth. Assimilatory reduction of NO - 3 to NH 3 is

Illustrate stents, Q. Illustrate Stents? Stents are metallic scaffolds ...

Q. Illustrate Stents? Stents are metallic scaffolds that are deployed within a diseased segment of a coronary artery to establish and then maintain a widely patent lumen. Stent

Why phylogenies using maximum likelihood methods, When constructing phyloge...

When constructing phylogenies using maximum likelihood methods, you assume?

Define manganese metabolism - micro minerals, Define Manganese Metabolism -...

Define Manganese Metabolism - Micro Minerals? Intestinal absorption of Mil occurs throughout the length of the small intestine although the exact mechanism of absorption is not

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd