Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Picaridin Laboratory and field studies documenting the efficacy of picaridin. No published data are available on the efficacy of the 7% solution now available in the US. Insec
Steps of C dna amplification 1. Smart-pcr amplification of cdna is the technique which initiates with the change of mrna to cdna utilizing mmlv-rt, mutated in the rnase h dom
Describe in detail about Retina The retina is a highly complex layer of nervous tissue. The photoreceptors are rods and cones for scotopic and photopic vision respectively. Th
Explain the groups of diabetes food pyramid The six groups of diabetes food pyramid are shown in Figure below. 1) Fat, oils and sweets (smallest group) 2) Milk 3) Mea
Q. Discuss the role of dental implants in orthodontic anchorage? The increasing popularity of dental implants has led to its use for orthodontic anchorage. Conventional means o
Lamellar compaction and remodeling (6 to 18 weeks) A remodeling phase is initiated in which hematopoietic-derived osteoclastic cells form cutting cones will remove the establis
In organisms that have undergone tagmosisthe trunk often develops into two tagma, oneinvolved in locomotion and one that is notlocomotory. The tagma not involved in locomotionis re
Fish actomyosin Fish actomyosin has been found to be quite labile and easily changed during processing and storage. During frozen storage, the actomyosin becomes progressively
A small family was traveling in the car when a minor accident happened. The children in the back seats were wearing lap belts, but still sustained numerous bruises about the abdome
Explain the De Bakey Type I Dissection? De Bakey Type I Dissection : Initial steps of the operation are same as previously described. Provision for deep hypothermic ci
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd