Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Describe the shape and size of proteins, Shape and size of protiens ...

Shape and size of protiens Fibrous proteins for example: keratin in hair, actin and myosin in muscles, and collagen. Globular proteins, for example enzymes and antibo

What is molecular biology, Molecular Biology Transgenesis: pro-nucl...

Molecular Biology Transgenesis: pro-nuclear injection of isolated gene into fertilised egg cell, cell divides to form embryo, then embryo implanted into surrogate.

State about endocrine system, Endocrine System In endocrine system duct...

Endocrine System In endocrine system ductless gland or specialized cells release chemicals called hormones into the circulating blood. These hormones influence the functions of

Determine the structure of enzymes, Determine the Structure of Enzymes ...

Determine the Structure of Enzymes Since all enzymes are proteins, you will realize that knowledge of protein structure is clearly a pre-requisite to any understanding of enzym

Isomerization of dihydroxyacetone phosphate, Isomerization of dihydroxyacet...

Isomerization of dihydroxyacetone phosphate Isomerization  of  dihydroxyacetone phosphate: Triosephosphate isomerase interconverts  dihydroxyacetone phosphate and  glyceralde

Name the groups into which flowering plants are divided, What are the two m...

What are the two main groups into which flowering plants are divided? Angiosperm plants are separated into a) Monocotyledonous (monocots) and b) Dicotyledonous (dicots

Evolution of photosynthesis and aerobic respiration, Evolution of Photosynt...

Evolution of Photosynthesis and Aerobic Respiration It is assumed that the earlier form of the bacteria utilised H 2 S for the preparation of food. The following reaction shows

What the enzymes do to reaction, What do enzymes do to a reaction? Indicate...

What do enzymes do to a reaction? Indicate all that are correct. a. Lower the activation energy b. Reverse the equilibrium c. Lower the equilibrium d. Increase the reac

Soil – plant – animal relationship, Soil – plant – animal relationship ...

Soil – plant – animal relationship The plants derive the minerals from soil, and the animals from the plants / feed they consume and there is a dependent interrelationship bet

Morphological differences between monocot and dicot plants, Q. What are the...

Q. What are the major morphological differences between monocot plants and dicot plants? The main separation criteria between monocots and dicots are: number of cotyledons (see

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd