Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Sedimentation, Simple sedimentation: The process of removal of suspende...

Simple sedimentation: The process of removal of suspended, colloidal impurities by allowing water to stand undisturbed in big tanks about 5m deep. Most of the suspended particl

Fertilisation, Fertilisation: Fertilisation is the process of fusion...

Fertilisation: Fertilisation is the process of fusion of male and female gametes. For fusion of male and female gametes, pollen grains have to reach the surface of the stigm

Explain working of dietitians and nutritionists, Dietitians and nutritionis...

Dietitians and nutritionists Dietitians and nutritionists, who are associated with hospitals and clinics generally have regular work hours. At times, they may be required to wo

Membrane carbohydrate, The  extracellular   surface  of  the  plasma  membr...

The  extracellular   surface  of  the  plasma  membrane   is  frequently  covered  with  a protective  coat  of carbohydrate. A Sugar  residue  of this  carbohydrate  coat can  be

Determine analyses provided by study of human age pyramids, What are the an...

What are the analyses provided by the study of human age pyramids? The study of human age pyramids can give the following analyses: proportion of individuals at an economically

Explain fungi - nutritional types of microorganisms, Explain Fungi - Nutrit...

Explain Fungi - Nutritional Types of Microorganisms? Fungi are filamentous, eukaryotic microorganisms, ubiquitous in nature. These grow best in dark and moist habitats. Their h

Photosynthesis, test to prove that carbondioxide is needed for photosynthes...

test to prove that carbondioxide is needed for photosynthesis to take place

Explain the term microfilaments, Explain the term Microfilaments ? Mi...

Explain the term Microfilaments ? Microfilaments are fine fibrils, only 7 nm in diameter, composed of a protein called actin. Actin is one of the two major proteins involved

How is the nervous system characterized, Q. How is the nervous system chara...

Q. How is the nervous system characterized in beings of the phylum Annelida? How can one compare cephalization in annelids to cephalization in platyhelminthes and nematodes? An

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd