Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain PR Murmur characterstic and graham steel murmur? PR Murmur Characteristic: Blowing, decrescendo murmur heard loudest in 2nd and 3rd left intercostal space with increa
Diagnosis of lyme disease In endemic areas, Lyme disease is diagnosed by recognition of erythema migrans. IgG antibodies to B. burgdorferi are usually detectable 4 to 6 weeks a
what is the fate of corpus luteum if egg gets fertilised ?
Explain about the Adolescent Pregnancy? The pregnant adolescent is viewed as a high-risk patient, highly susceptible to suboptimal pregnancy outcome. Even when not pregnant, a
C o w - po x (vaccinia) E p idemiology: This infection, although mostly occurring in cows, sometimes also occurs in buffaloes. Under natural conditions, t
Is the effect of genetic drift likely to be the same in pop 1 and pop 2? How are genetic drift and pop size related? when there is strong selection against the homozygous recessive
State the the amount of the nutrient On increasing the amount of the nutrient the yield increases and the decrease from the maximum i.e., (A-y) becomes less. Subsequent additio
life cycle of tapeworm in detail
what are the significance of zoological parks in conversation
Q. Use of Protective Eyewear as personal protective equipment? Protective lenses must be worn by dental personnel: 1. when performing procedures that can cause spatter or ae
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd