Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
significance of gastrulation
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Types of Ovarian Cycles in Mammals Mammals exhibit two types of ovarian cycles; Estrous Cycle, exhibited by non-primates such as rats, cats, dogs, pigs, and Menstr
What are the main symptoms of the pulmonary and of the intestinal phases of the ascaris infestation? In the pulmonary stage the ascaris infestation causes cough, hemoptysis, dy
Little lipophilic (lipid-soluble) hormones distribute across the plasma membrane and then interact with intracellular receptors in the nucleus/cytosol. The receptor
Q. What are active and passive immunization? According to the duration of the protection how do these types of immunization differ? Active immunization is that in which an anti
What are the differences between genomes in prokaryotes vs. eukaryotes?
Conjugation – Protozoan Conjugation is characteristic of ciliates. The details vary from species to species. The general features can be observed in Paramecium sps. which has
how is biotechnology useful?
The clinical manifestations of IE result from the local destructive effects of intracardiac infection; the embolization of bland or septic fragments of vegetations to
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd