Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define the characteristics that are seen in Rickets? The following characteristics are seen in fully developed cases of rickets: 1) In case of young infants, delayed closure
Prothoracic Gland or PTC Prothoracic gland (PTC) or moulting gland and ecdysone or moulting hormone The 3 rd endocrine gland-prothoracic gland- is an irregular branching
trinominal names
Class of Crustacea - Copepoda Copepoda is a huge class of small (1-5mm) crustaceans occupying both marine and freshwater environments. Copepods form the several abundant and c
Fatty acid breakdown brings about the oxidation of long-chain fatty acids. The fatty acids are first transformed to their acyl CoA (coenzyme A) derivatives and then degraded by the
The trp (tryptophan) operon which is shown in the figure will have five structural genes encoding enzymes for tryptophan biosynthesis with an upstream Ptrp (trp promoter)
Q. What is the difference between the concepts of epidemic disease and endemic disease? The Endemic diseases are those that often affect people of a given place, many or few in
Oncogene is the gene in a tumor virus or in the cancerous cells which, when transferred into the other cells, can cause the transformation (note which only certain cells are susce
heterotrophic mode nutrition plants
Q. Relationship between Mind and Brain? In modern times, before the 20th century, the most popular interpretation of the mind-brain relationship was some version of dualism. It
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd