Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define about the Resistant Starch? Until 1980's starch was thought to be completely hydrolyzed and absorbed from the small intestine of man, independent of its source, type and
CONTRO L OF EXCRETION - 1. In brain hypothalamus is osmocentre that controls minerals. 2. Cells of DCT & arterioles combien to form Juxta glomerular node, it se
Classification of Freshwater Ecosystems Fresh water ecosystems depend on the terrestrial ecosystems for large quantities of organic and inorganic matter which are constantly a
Biomass energy Energy produced by burning biomass it is known as biomass energy. When biomass is burnt, it releases stored chemical energy, which has accumulated in it through
Which of the following molecules has more direct effect in learning and memory? A) norepinephrine B) epinephrine C) glutamate D) acetylcholine E) glycine Please leave justification
REASON S FOR GROWTH OF POPULATION - The human population explosion is mainly a result of reduced death rate. Main reasons for it are - 1 . Protection from natura
Explain what is Patent Ductus Arteriosus in details? Figure : Anatomical location of PDA Patent Ductus Arteriosus (PDA) may be an isolated defect or may co-exist with
What are zymogen granules
Define the factors effect the Quantity of Human Milk? A large healthy baby who can vigorously suck will induce and obtain much more milk from its mother than a small, sickly or
Give an example of how two organisms are interdependent.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd