Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is the typical morphological feature of nematodes that differentiates them from platyhelminthes? Nematodes are also called as roundworms. As the name shows they are not fl
Explain Point Mutations gene? Mutations involving single genes occur by addition, substitution, or deletion of a single base in DNA. Such mutations, called point mutations, ca
Q. Is the internal epithelium of the bowel the alike as it was one month ago? The internal epithelial covering of the intestine acts as means of nutrient absorption and as prot
Handling : The desire for survival is same whether in animals or human beings. You may be aware of the ability of even tiny animals to scratch and bite. So we won't say any more o
Q What is the constitution of the endocrine system? The endocrine system is constituted by the hormones and the endocrine glands they secrete. Q. What is the histological n
Within the cytosol which series of enzymes in order convert citrate back into pyruvate: -citrate lyase, malate dehydrogenase, malic enzyme - citrate synthase malate dehydroge
Any significant variation in the internal temperature could have damaging effects on the body's enzymes. Homeotherms or warm-blooded animals including human can however generate co
Research and Documentation - Conservation of wildlife First, list of endangered species are established by various national and international agencies. Another important actio
need images of cranium
Internal Mammary Artery (1MA) : This is an excellent graft. When left internal mammary artery (LIMA) is anastomosed to LAD, which has more than 70 per cent block, patency at
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd