Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Meaning of counselling in diabetes mellitus, Q. Meaning of Counselling in d...

Q. Meaning of Counselling in diabetes mellitus? The word counselling is a very broad term which is used for helping others to overcome their particular difficulty. It has been

Explain about the toxicity - fat soluble vitamin, Explain about the Toxicit...

Explain about the Toxicity - fat soluble Vitamin? Because vitamin A is fat-soluble and can be stored, primarily in the liver, routine  consumption of large amounts of vitamin A

What else is carried in the plasma, What else is carried in the plasma? ...

What else is carried in the plasma? In addition to proteins, plasma having salts (ions), glucose, lipids and amino acids, hormones, carbon dioxide and urea

Explain the failure to management of ledge, Explain the Failure to Manageme...

Explain the Failure to Management of Ledge Apical transportation or perforation: movement of the physiological foramen to a new iatrogenic location. Three types of apical tr

Purposes of assessing growth and development in children, PURPOSES OF ASSES...

PURPOSES OF ASSESSING GROWTH AND DEVELOPMENT IN CHILDREN Before you assess the growth and development you should be aware of the purpose of monitoring. The purposes are a

Coelomoducts in polyplacophora, Coelomoducts in Polyplacophora In Poly...

Coelomoducts in Polyplacophora In Polyplacophora the coelomoducts divide in the region of coelomostome and the gonadal cavities become closed off from pericardial coelom. The

What is the connection between tissue fluid and plasma, What is the connect...

What is the connection between tissue fluid, plasma and lymph? Tissue fluid is plasma (minus its proteins) which has leaked out of the capillaries. Lymph is tissue fluid which

Mechanism of fertilization, MECHANIS M OF FERTILIZATION - The process ...

MECHANIS M OF FERTILIZATION - The process of fertilization complete into 5 steps - 1 .      APPROACH OF SPERM TO OVUM For fertilization sperm & ova interaction is

Describe open circulatory system, Q. What is an open circulatory system? ...

Q. What is an open circulatory system? Open circulatory system is the one in which blood doesn't circulate only inside blood vessels but it also falls in cavities that irrigate

Barker’s in utero hypothesis, Barker’s in Utero Hypothesis The develop...

Barker’s in Utero Hypothesis The developmental origins of adult disease, often called as the ‘Barker hypothesis’ states that adverse influences early in development, particula

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd