Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Soft tissue Management The periimplant soft tissue is very critical in the aesthetic zone. The handling of the tissue during surgery to minimize trauma, the preservation of ker
Q. How can bacteria produce human insulin on an industrial scale? What are the other forms of insulin made available by the pharmaceutical industry? Bacteria don't naturally sy
Prior to the solving of the structure of DNA, Erwin Chargaff calculated the amounts of the four nucleotides (A, T,G,C) and made which of the following conclusions? A. All four
This is concerned more with nature's services which also make vital contributions to the welfare of society and to ecological processes without which our planet would be uninhabita
How to reduce calorie intake from fat? Efforts should be made to increase the nutrition knowledge of the general public through mass media. The foods with lower fat co
What are the three main parts into which a neuron can be divided? What are their respective functions? The three mains parts into which a neuron can be didactically separated a
Define Absorption, Storage and Elimination of cyanocobalamin? Vitamin B 12 in food is bound to proteins and is only released by the action of a high 'Concentration of hydroch
Explain holding method of pasteurization In the holding method of pasteurization (62 o C for 30 minutes) or the high-temperature short-time (HTST), 71 o C for 15 minutes method
What is a trace element and how are they important in organisms, give an example.
Which type of plant tissue is cork? Cork, the material, for example, used to cap wine bottles, is extracted from the suber of a special oak known as cork oak.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd