Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain glycolysis, Explain glycolysis? Name the two monosaccharides w...

Explain glycolysis? Name the two monosaccharides which readily enter the glycolytic pathway. Illustrate a diagrammatic sketch of the microscopic view of a mammalian sperm a

Five kingdom classification, discuss the merits nd demerits of five kingdom...

discuss the merits nd demerits of five kingdom classification.

What is the importance of that structure in menstrual cycle, What is the st...

What is the structure into which the follicle is transformed after ovulation? What is the importance of that structure in the menstrual cycle? The follicle that released the ov

Tolerance range, what is the tolerance range of man and tillapia

what is the tolerance range of man and tillapia

What are functions of the epithelium, Q. What are some functions of the epi...

Q. What are some functions of the epithelium? The epithelial tissues can perform protection, covering and impermeability against the environment, for instance, in the skin, res

Importance of nutritional needs for management of emergency, Define Importa...

Define Importance of nutritional requirements for management of emergencies? Knowledge of nutritional requirements for management of emergencies is therefore, important due to

Define procedure for testing the presence of sugar in milk, Define Procedur...

Define Procedure for Testing the Presence of Sugar in Milk? 1. Take 0.1 ml of milk sample in a test tube. 2. Add 0.2 ml of resorcinol solution (0.05 gm of resorcinol in 100

Microfilaments comprise of the proteins, Microfilaments comprise of the pro...

Microfilaments comprise of the proteins The microfilaments comprise of the proteins, actin and myosin, the same contractile proteins that are found in skeletal muscle cells. Si

Tolerance to cold and freezing temperatures, Normal 0 false f...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Studying leaf arrangements, Studying leaf arrangements Observe as many ...

Studying leaf arrangements Observe as many growing plants as possible by looking down on them from above. Draw sketches of the dissimilar patterns of leaf arrangement.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd