Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Removal of obturating material -endodontics principles, Removal of obturati...

Removal of obturating material -Gutta percha . -Carrier  bassed gutta perca. -silver points . - paste type. - obstructed fracture instrument .

Sterility assurance, All the efforts that go into the preparation of instru...

All the efforts that go into the preparation of instruments are futile if the sterilization process itself is not successful. There is no way of seeing that instruments are sterile

Cells, What surrounds a plant cell

What surrounds a plant cell

What is gastrulation, Q. What is gastrulation? How during gastrulation are ...

Q. What is gastrulation? How during gastrulation are the first two germ layers formed? What are these germ layers? Gastrulation is the process through which a portion of the bl

What is the central dogma of molecular biology, What is the central dogma o...

What is the central dogma of molecular biology? Succinctly (and clearly) describe the concept.

Physical map, Physical map is the map of locations of the identifiable lan...

Physical map is the map of locations of the identifiable landmarks on DNA (for example restriction of the enzyme cutting sites, genes), regardless of their inheritance. Distance i

Explain both food and light as zeitgebers, Must account for both food AND l...

Must account for both food AND light as zeitgebers Because of the continuous light / dark periods of the year; light not always able to act as a zeitgeber. Food

Determine about the trichromatic vision, Determine about the Trichromatic v...

Determine about the Trichromatic vision Trichromatic vision is the terminology used for normal vision, those who require aU' three primary colours to make a match with an unkno

Oxidation of glyceraldehyde-3-phosphate, Oxidation of glyceraldehyde-3-phos...

Oxidation of glyceraldehyde-3-phosphate Oxidation of glyceraldehyde-3-phosphate : The  conversion  of glceraldehyde- 3-phosphate to  1,3-bisphosphoglycerate  is catalysed  by

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd