Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is cancer? The Cancers are malign neoplasias that is abnormal and uncontrolled proliferation of cells that can disseminate to other sites of the body. The Cancer dissem
Explain Historical Example of connecting models and data? An excellent instance of a program that links theory and data is collaborative work on the population dynamics of flou
why are they called as pisces
Ask question #Minimum 2o pages accepted#
In Reggie's case, he fractured the proximal end of his right femur, an integral component of his hip. Name the joint disorders that Reggie is more a risk of in (a) the short term a
EMBRYOLOGICAL EVIDENCES - A comparative study of embryology of different groups of animals reveals certain features that provide evidences for organic evolution. There ar
Q. How is hemophilia treated? Why is hemophilia rare in females? Hemophilia is medically treated with administration of factor VIII in case of hemophilia A or of factor IX in c
INORGANI C SUBSTANCES They are small, simple, low molecular weight substances which are made of elements other than Carbon and Hydrogen combined together. Inorganic substan
Explain the Nerve Cell Structure and Function? Before studying the organization of the nervous system, we will look at the relationship between structure and function of nerve
Water has key participation in organic reactions. What are examples of two types of organic reactions in which water is respectively incorporated or liberated in the products of th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd