Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is the significance of magnesium for plants? What are the other major biological functions of magnesium? Magnesium is basically vital for plants because it is part of t
The nucleus comprise the genetic information of cell. In addition to activities which maintain the cell, nucleus creates copies of itself for new protozoans by either asexual repro
how vagina is inserted in cock
Explain about the Observation and Classification of Arthropoda? Introduction In the previous unit you have examined the representatives of artliropoda. In this unit, you wi
D i se a s e s of Neonates Calf scour It is also known as dietary diarrhoea and is characterized by foul smelling liquid faeces, and weight loss. E t iolo
Q. What is tubular secretion? What are some examples of substances secreted through the renal tubules? Uric acid, Ammonia, potassium bicarbonate and hydrogen ions, bases and me
In what way do chlorofluorocarbons (CFCs) cause global problems? Chlorofluorocarbons react with and deplete the ozone in the ozone layer. This permits more ultra-violet light f
Biopathways 1. Find out pathway information about these proteins using the Human Reactome. O00327 O14503 O75586 O95096 P01137 P01308 P06744 P08240 P12
How can the fact that fishes and dolphins have similar organs and similar general shape be explained? Dolphins and Fishes have similar organs and shape because although they ha
mode of nutrition in zebra
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd