Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain about the foods effect on drug utilization, Explain about the Foods...

Explain about the Foods Effect on Drug Utilization? The following illustrations highlight the effect of food on drug utilization. Liver and green leafy vegetables can decrea

Social determinants of health - unemployment, Social Determinants of Health...

Social Determinants of Health - Unemployment That unemployment gives rise to social insecurity and psychological stress is well recognised. Fears and uncertainties are known t

Which are the plant tissues, Which are the plant tissues responsible for th...

Which are the plant tissues responsible for the supporting of the plant? The plant supporting tissues are the collenchyma and the sclerenchyma. The collenchyma is made of li

What is the typical vegetation of the grasslands, What is the typical veget...

What is the typical vegetation of the grasslands? The Grasslands are mainly formed of herbaceous (nonwoody) vegetation: grass, small trees and bushes.

How you would accomplish cloning using of numbered steps, A restriction map...

A restriction map of plasmid and a human gene of identified sequence is demonstrated below. Your job is to clone the human liver cDNA for that gene than the start codon is closer t

Magnitude of healthcare needs, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Is there interphase again between meiosis i and meiosis ii, Is there interp...

Is there interphase again between meiosis I and meiosis II? There is no interphase nor DNA duplication among the divisions of meiosis. Only a short interval called diakinesis h

Explain supravalvular aortic stenosis murmur, Explain Supravalvular aortic ...

Explain Supravalvular aortic stenosis murmur? Supravalvular Aortic Stenosis Murmur : Characteristic: Murmur may be loudest in 1st Right ICS. It isn't associated with systolic

What is optic nerve, What is optic nerve The optic nerve contains more...

What is optic nerve The optic nerve contains more than one million axons that initiate in the ganglion cell layer of the retina. This structure originatcs at the back of the e

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd