Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What are alleles of a gene? Diploid individuals have paired chromosomes. For instance in humans there are 23 pairs of chromosomes totalling 46 chromosomes. Each pair comprehend
A restriction enzyme or restriction endonuclease is an enzyme which cuts DNA at particular recognition nucleotide sequences with Type II restriction enzymes cutting double-stranded
Classification of Enzymes : Enzymes are classified into the following six main categories in according with the nature of reaction the catalyze: 1. Oxidoreductases
help me in writing assignment on racemization,mutarotation.
What is Fern Allies - Equisetum ? The earliest land plants are thought to have evolved from green algal ancestors, since they share many features. Both green algae and plants h
How is oil droplet different from micelles? Also describe the chemical make-up of each.
Q. Discovery of insulin? The discovery of insulin has dramatically changed the lives of people having type 1 diabetes. With this wonder drug diabetics can lead a normal, enjoya
What are the phases of spermatogenesis and how it occurs ?
Explain Viruses and their classification? Viruses are living organisms. Viruses are not living organisms. No, the above is not a misprint! In fact, viruses defy the normal c
ciclo vital de la isospora belli
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd