Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain for Procedure Quantitative Determination of Viable Microbes? Now carry out the exercise following the steps included herewith: 1. Label the diluent tubes from 10 -1
Complete Metamorphosis In all Endopterygota insects, where wings and other structures develop internally, (in invaginate imaginal epidermal pockets) such as beetles, wasps, b
Before the emergence of life of what gases was the earth's primitive atmosphere constituted? The earth's primitive atmosphere was basically produced of methane, hydrogen, ammon
Q. What are the physiological systems known as integrative systems? Why is this designation justified? The integrative systems are the endocrine system and the nervous system.
Q. Illustrate Morphological Evidence? Morphology is the study of structure and form of plants and animals usually dealing with the organism and its component organs. Morphologi
Determine Energy Density of Human Milk? The energy density of human milk depends on the relative proportions of protein, fat and the principal carbohydrate, lactose. Lactose co
Define the Agar Shake Tube Method The agar shake tube method is useful for isolation of anaerobic microorganisms. What are anaerobic microorganisms? You may recall the theory c
Define Conditions associated with increased need for Vitamin A? Conditions and populations associated with increased need for vitamin A includes young children particularly t
Explain Denaturation and coagulation Denaturation and coagulation of the proteins are considered to be the chemical changes, since they involve the unfolding of proteins, whic
Define about the Miracidium Larva?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd