Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Proteins requirements for ulcerative colitis? Proteins: Patients with ulcerative colitis lose about 4-8 g fecal N2 as compared to the normal excretion of 2 g. In severe ulce
How can a baby become infected with (a) gonorrhoea, (b) syphilis (a) During birth, a baby might be become infected with gonorrhoea bacteria as it passes by t
Define Foods Effect on Drug Transport? Many drugs are transported in blood bound lo plasma proteins. Severe malnutrition or diseases affecting the synthesis of plasma proteins
Define the Food and Nutrition Security? In the previous section, we learnt about the trends in production of food grains in the country and their relationship to population gro
Classification
excretory product of marine teleost
PHYLUM CNIDARIA (= COELENTERATA ) Definition and Introduction Tissue grade eumetazoans with a radial symmetry .The term coelenterate signifies the presence
Does mitosis properly occur before or after the interphase? Is it a mere "point of view" issue? Mitosis must be considered a succeeding phase after interphase since this
how do mature sperm differ from those that are not fully developed
Q. Direct Approach to counseling? The direct approach to counselling is also called as the problem-solving approach. The counsellor collects relevant information which aims to
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd