Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define the Management of Obesity? Management of obesity should be taken up with a clear understanding of the harsh realities of the problem and its outcome. It may be a frustra
Palaeobiology : This deals with the study of fossils and remains an impressions of the past organisms found in the rock of different ages. Paleobiology is a growing or comparativel
What are the approaches to the design of retaining walls? The approach to the design of retaining walls can be started as follows: a. Chosse a trial dimension of the wall
Q. When Aflatoxigenic molds can occur? Occurrence: Aflatoxigenic molds can occur in warmer parts of the world and aflatoxicosis maybe produced in a wide range of tropical and s
Determination of Neural Ectoderm by Induction Earlier you know that the dorsal mesoderm induces the ectoderm to differentiate into neural tissue. Spemann and his co-workers co
Explain about Riboflavin Aqueous solution shows a pronounced green-yellow fluorescence, which is maximal at a pH of about, 6-7 and disappears upon the addition of acids and al
The cell cycle undergoes a sequence of changes which involve a period of growth replication of DNA, Followed by cell division. This sequence of changes is called cell cycle.
Oxidative phosphorylation Oxidative phosphorylation is a metabolic pathway which uses energy released through the oxidation of nutrients to generate adenosine triphosphate (ATP
Why lymph is also called middle man of body
wath is sun
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd