Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Advantages of using Yeast as a source of Protein? 1. Large size, hence separation from the culture medium is easy. 2. As the pH of the growth is towards acidic side,
Stage 1 sleep: As an individual becomes drowsy, and enters stage 1, alpha wave decreases and theta waves appear. Theta waves with a frequency of about 6 to 8 cycles per second are
Explain process of Selection of taxonomic characters Selection of taxonomic characters Eventually classification systems may be based almost entirely on direct study of th
GENERAL PREVENTIVE MEASURES - 1. Infected animal should be immediately isolated and looked after. 2. The premises should be disinfected whenever there is an outbre
What are the major morphological differences between monocot plants and dicot plants? The main differentiation criteria among monocots and dicots are: number of cotyledons (see
Spray-drying method Spray-drying is the common drying method in the production of ISP. The primary physical form of ISP in commerce, is that of fine powders. Structured form
What is genes Duplication ? Duplication of genes can happen when a portion of a chromosome breaks off and attaches itself to the end of its homologous chromosome, as seen below
A v i a n tuberculosis Tuberculosis in poultry has not remained a big threat in list of diseases due to commercialization of poultry business. It is a contagious chronic di
what is the function of cornified layer of the skin
Q. What is the function of the umbilical cord? The umbilical cord is a set of blood vessels that connects the fetus with the placenta and in the fetus one extremity of the cord
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd