Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
A n i m a l pharming Using animals as bioreactors is also cost-effective and advantageous because animals naturally carry the cellular mechanisms needed to
Q. What is the difference between spermatid and spermatocyte II? The spermatids (n) are the products of the second division of meiosis (meiosis II) in the male gametogenesis an
What is Atraumatic needles Atraumatic needles with sutures comprise an eyeless needle attached to a specific length of suture thread. There are several shapes of surgical n
Define Ergogenic and for training and competition? There is always our desire to work with the body more .than its capability. This is more so in case of athletes. They wish to
Define the Toxicity of Vitamin K? Vitamin K, does not produce any toxic effects in doses (10-20 mg) normally used for the treatment or subjects suffering from disorders of liv
What is genesis of coronary artery diseases ? Like any other disease conditions, origin of CAD depends on an interplay between the heredity and environment so called 'nature' a
#phyletic lineage ..
I have a test online it is timed 30 minutes on Anatomy and Physiology I need an expert who is an expert in this subject to take it for me
X e n o t r a n s p l a n t a t i o n Over the past 20 years transplantation of heart and kidney has become almost a routine in human but the availability of
explain the different types of symmetry in metazoans.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd