Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain in details Aerobic Respiration? The pyruvate produced in glycolysis is further broken down in most organisms. This process, called aerobic respiration, requires gaseou
What are the principal sources of of excessive nitrate and phosphatebin rivers and lakes?
Describe Gastrovascular cavity in detail? The name given to the internal cavity of cnidarians. A blind-ended (incomplete) gut with only one opening. Food is to be digested and
What is the difference between embryo and endosperm?
Structure and Content of NEUROPSYCHOLOGICAL BATTERY The battery contains 269 items, each of which may be scored on a 2- or 3- point scale. A score of 0 indicates normal perform
Determine the term - Neuropsychology The neuropsychology of the various modalities and domains involves applications from the knowledge base concerning the domain or modality i
NUMBER Benden and Boveri first indicated that number of Chromosomes is definite in each organism. (1) Haploid (n) - One set of Chromosomes. i.e. one Chromosome of each
The pentose phosphate pathway also called as the phosphogluconate pathway and the hexose monophosphate shunt is a procedure which gives pentoses 5-carbon sugars and NADPH. There ar
What is a bio regenerative system? Why is it essential? Nutritional requirements for long flights have been refined, placing more demands on food development. Despite the techn
Peripatric Speciation Speciation by small populations isolated on the periphery of the distribution of the parent population can be described as peripatric speciation. Small, pe
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd