Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
write the general account of porifera
weberian oscles found in
what are the chemical changes during cleavage
Explain Functional property of Emulsification Mode of action Proteins stabilize fat emulsions Food system Sausages, soups, cakes, salad dressings, infant foods
Flower - Plant Growth Substances Floral initiation is a dramatic event involving a total changeover of the character and developmental pattern of the meristem. The stimulus ca
Q. What are the cell movements and how are these movements created? Cell movements are movements executed by cell structures, like the movements of flagella and cilia, the pseu
Where in the leaves is photosynthetic tissue often located? The major photosynthetic tissue is the photosynthetic parenchyma (also known as chlorenchyma, do not confuse with co
Describe the Phylum Chordata in animal kingdom? This is the other group of animals along with the Echinodermata whose anus develops prior to the mouth's development in the embr
How is the early diagnosis of genetic diseases usually done? Genetic disease might be diagnosed in the prenatal period by karyotype analysis, in case of aneuploidies, or by DNA
before stem cuttings are planted the cut end of the stem is often dipped in a hormone powder .what is the point of this?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd