Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Eggs of hen, EGG S OF HEN It is a meiolecithal egg which is oval. T...

EGG S OF HEN It is a meiolecithal egg which is oval. The animal pole is found in the form of a small germinal disc. The vegital pole has two types of yolk viz. White yol

Cohesiveness and surface tension-properties of water, Cohesiveness and Surf...

Cohesiveness and Surface Tension Water flows freely, yet water molecules do not break apart. They cling together particularly to polar surfaces. Therefore, water can fill a tub

Which is most likely be fatal to marin fish populations, If we were to comp...

If we were to completely eliminate one group of marine organisms from ocean, which would most likely be fatal to Marin fish populations? Elimination of: a) Starfishes b) Dia

Explain about central nervous system, Central Nervous System (CNS) Cove...

Central Nervous System (CNS) Covering of the brain and spinal cord is called Meanings (membranes which cover and protect brain and spinal cord are called meanings) There is flu

Explain the bioelectrical impedance analysis (bia), Explain the Bioelectric...

Explain the Bioelectrical impedance Analysis (BIA)? The difficulty of measuring total body water (TBW) by Isotope Dilution Method led to the search of Bioelectrical Impedance A

Terms of incubation time and the generation time, If the generation time (t...

If the generation time (t) is the incubation time (t) per generation (G), or t = t/G, rewrite the formula you derived in question 2 for bacterial population growth in terms of incu

Which are the living beings that carry out photosynthesis, Which are the li...

Which are the living beings that carry out photosynthesis? Which is the cell organelle responsible for the absorption of light for the photosynthesis process in plants and algae?

Sarcolemma, Normal 0 false false false EN-IN X-NONE ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Acetylcholine - long term potentiation, Acetylcholine, a well known neurotr...

Acetylcholine, a well known neurotransmitter, plays a critical synaptic role in the initial formation of memory. Chemical blockage of the acetylcholine receptors makes it harder to

Describe about the detectors used in hplc, Question 1 Explain pharmacokine...

Question 1 Explain pharmacokinetic parameters observed in plasma concentration time curve Question 2 What is Gas Chromatography? Mention the quantitative applications of gas

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd