Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Enzyme Activity Enzymes are biomolecules which catalyze (i.e. increase the rates of) chemical reactions. Almost all enzymes are proteins. In enzymatic reactions, the molecules
International organization and zoonoses In 1962, the Food and Agriculture Organization and the World Health Organization created the Codex Alimentarius Commission (Codex) to e
Discuss FASB and IASB. Comment on at least two specific aspect of the two standard setting boards and their role in setting accounting.
Despite the technologic advances of recent years, many patients with chronic heart failure are elderly and have multiple comorbidities. Many of them will not experience meaningful
MR means medical representative. Medical rep has to sell products of pharma companies or drug manufacturers. He has to go to doctors and medical shops to sell drugs and promote dru
Briefly explain what is The Leaf? In a typical dicot, leaf primordia arise from the apical meristem, which is housed within the terminal bud on a shoot. The leaf cells are produc
What is the spontaneous generation hypothesis? The impulsive generation abiogenesis or hypothesys asserts that life on earth has come from nonliving material. For instance, t
Q. What are Zoonotic Diseases? The World Health Organization defines Zoonoses (Zoonosis, sing.) as "Those diseases and infections, which are naturally transmitted between verte
wich variables are controlled when conducting a phototropism experiment
Descriibe Mechanical Ventilation and Cardiac Performance During spontaneous breathing, the intrathoracic and intrapulmonary pressures are negative, while with mechanical venti
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd