Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is the fact of Molecular Biology on which DNA fingerprint is based? DNA fingerprint, the method of individual identification using DNA, is based on the fact that the DNA o
Pre-operative Teaching Brief explanation-anatomy, physiology of the cardio-respiratory system. The disease and the operation which is going to be done. Operati
What are autotrophic beings? What are heterotrophic beings? Autotrophic beings are those that can make their own food, i.e., that make organic material from inorganic compounds
What is the natural habitat of E.coli? The E.coli was first recognized in the colon region of large intestine and so it was given the name "coli" (found in colon) they are coli
Baroreceptor activity affects coronary vascular resistance reflexly. With carotid occlusion, baroreceptor hypotension leads to reflex adrenergic stimulation, increased metabolic ac
who proposed trinomial nomenclature
Determine the Types of Exercises Exercises are generally grouped into three types: - Flexibility exercises such as stretching improves the range of motion of muscles and jo
Neuron A is a healthy neuron with all the usual ion channels. When at rest with a membrane voltage of R millivolts, neuron A produces no action potentials. The voltage thres
Modes of NO - 3 reduction Accordingly, there are the following three basic modes of NO - 3 reduction. Directly dependent upon photosynthesis as in cyanobacter
Q. Which are mineral salts? Where in living beings can found mineral salts? Ans. Mineral salts are simple inorganic substances made of metallic chemical elements, like sodiu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd