Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What are biopolymers? Polymers are macromolecules made by the union of several smaller identical molecules, called monomers. Biopolymers are polymers present in the living b
Define Fat requirements in human body? There is no change in fat digestibility at altitude of
Ecotone - Nature and Structure of Community The zone of vegetation separating two different types of communities is called ecotone. It is also known as a transition zone. The
In which type of animals does the placenta exist? What is its main function? True placenta is present in placental mammals. The placenta is produced from the chorion of the
Explain the Periapical surgery - Endodontic Surgery a) Curretage 1 b) Root-end ressection 2 c) Root-end preparation 3 d) Root-end filling 4
Explain Blood Vessels that carry blood? Blood vessels that carry blood away from the heart to the lungs or to the rest of the body are called arteries. The walls of arteries ha
Brain Neurosecretory Cells and their Hormones Kopec was the very first to suggest the role of hormones in controlling metamorphosis. On the base of his experiments on the lar
Explain the Peripheral Resistance Resistance offered by arterioles or resistance vessels, as you have read above, is termed as peripheral resistance. Changes in peripheral resi
This technique utilizes an enzyme resolvase, endo vii, cloned from the bacteriophage t4. This enzyme has high specificity to find deletions, insertions, and base substitutions muta
what is the excretory organ of a lizard?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd