Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What happens during aerobic respiration to the pyruvic acid molecules made by glycolysis? and What is the sequence of reactions that then follows? The pyruvic acid molecules
Because of developmental abnormality, the wall of left ventricle of an infant's heart is as thin as that of right ventricle. What would be its explicit effect on circulation of blo
Q. Identification and Care of Taxonomic collections? Collection of plant specimens is essential for taxconomic research. Herbarium specimens become a permanent record. Select t
Salmonellosis in poultry A wide variety of serovars are prevalent among chicken, turkeys, ducks and geese. The poultry is an important reservoir of salmonellae. The common dise
Leptontene: The chromosomes becomes visible, shorten and thick. The size of the nucleus increase. The homologous chromosomes start getting closer to each other. Z
The gaseous pollutants can be controlled through the techniques of combustion, absorption adsorption and cold trapping. (a) Combustion: Though combustion is a major cause of i
habitat, habit, cell wall chemistry, reason why cell wall like this of Archaebacteria , eubacteria,fungi,algae,bryophytes ,pteridophyes, gymnosperms , angiosperms..
H e morrhagic enteritis in Turkeys The viral etiology in turkey poults showing sudden death was first described in1930 and thereafter reported in most turkey-producing areas.
What are the basic constituents of the cell membrane? The cell membrane is produced of lipids, proteins and carbohydrates. The membrane lipids are phospholipids, a special t
Allele-specific ligation is the technique permitting discrimination of two allele at locus by giving two short synthetic oligonucleotides which would bind ajjacent to teach other
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd