Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is the difference between spermatocyte I and spermatocyte II? The spermatocyte I (2n) undergoes the primary division of meiosis (meiosis I) originating two spermatocyte II
Alkaline slant - Observation for Carbohydrate Utilization Pattern Test Alkaline slant (red) and acid butt (yellow) with or without gas production - This indicates fermentation
Q. Can High blood pressure cause coronary sclerosis? High blood pressure causes coronary sclerosis (hardening in early stages, fatty lesions in the inner surface of [he artery
What do you understand by Carcinogen? Carcinogen is an agent or a process, which significantly triggers the cell to grow in an uncontrolled manner producing malignant neoplasm
Disorders of Pituitary Function: The disorders of pituitary function result in following conditions. Hypopituitarism : Growth Hormone (GH) Deficiency Hypopituitarism is
Define about the Glutathione peroxidases - Selenium? The role of selenium in the cytosolic enzyme, glutathione peroxidase (GSHPx), was first illustrated in 1973. Four selenium
Ethylene - Plant Growth Substances This hydrocarbon C 2 H 2 is a gas and is unbelievably a small and simple molecule to be accepted as a hormone. Ethylene is not produced by
Q. Concerning solubility, how are the lipids classified? Oils and Fats are hydrophobic molecules, i.e., they are insoluble in water and non polar. Lipids in general are molecul
What are the risk factors for the development of food allergy? Having gone through the discussion above, can you identify at least one important factor leading to food allergy?
Q. What are the main phases and clinical manifestations of schistosomiasis? The Schistosomiasis has acute and chronic phases and Days after the infection the cercarial dermatit
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd