Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Does natural selection produce an effect directly on genes, on genotypes, or on phenotypes? Explain please.
Bio-medical waste management Persons coming in contact with bio-medical waste are prone to get injury from sharps likes needles. Injury due to sharps leads to life threatening
Q. List down the various mycotoxins associated with food? Mycotoxins associated with foods are: • Aflatoxins (produced by Aspergillus flavus) • Ochratoxin (produced
Excretory organ of agama lizard
Byproducts high in energy and nitrogen Byproducts in this category include products such as blood meal and poultry offal meal, fish meal, extracted oilseed meals/cakes and wast
Q. Illustrate Dilated cardiomyopathy? It is a disease of unknown etiology, affecting myocardium. Its diagnosis is established by presence of left ventricular dilatation and sys
In the ecological study of food interactions, what are the autotrophic beings called? In the Ecology autotrophic beings are called as producers because they synthesize the orga
Nutrient Cycling in Tropical and Temperate Forests From this study of the nutrient cycles you must have realised the importance of the role of green plants that take up nutri
Explain Unresorbable Barriers - Root Perforation MTA exhabits excellent tissue biocompatible non resorbable barrier and restorative material. It represents an extraord
Genital warts and human papillomavirus (hpv) infection External genital warts are caused by human papillo- mavirus, usually type 6 or 11; other types (16, 18 and others) cause
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd