Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain the working of Skeletal Muscle? Skeletal muscle is under voluntary control and is responsible for voluntary movements of body parts. Skeletal muscle is also called stri
Explain the Metabolic Alterations during Cancer? As we have studied earlier, patients with advanced cancer experience profound anorexia, early satiety, changes in the structure
Vasa are a maternal-effect gene whose product functions in development of the posterior end of the Drosophila embryo. runt is a non-maternal-effect gene whose product functions in
Q. What is the significance of magnesium for plants? What are the other major biological functions of magnesium? Magnesium is basically vital for plants because it is part of t
How I can optimize shake flask culture?
What is Mendel's second law? Mendel's second law postulates that two or more different traits are also conditioned by two or more pair of dissimilar factors and that each inhe
Define Efficiency - terminologies used in chromatography? Efficiency in chromatography is expressed as number of theoretical plates. H = L/N Where, H is heigh
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
What are the organic chemical groups that characterize carbohydrates? How are carbohydrates classified according to the presence of those groups? Carbohydrates are also called
Determine Energy Density of Human Milk? The energy density of human milk depends on the relative proportions of protein, fat and the principal carbohydrate, lactose. Lactose co
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd