Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Scintigraphy or nuclear medicine, S c inti g r ap h y ...

S c inti g r ap h y or nuclear medicine: Scintigraphy was introduced in veterinary medicine in 1970s. It is highly sensitive and can detect bone dama

Photosynthesis carbon dioxide, Q. Why is it said that during photosynthesis...

Q. Why is it said that during photosynthesis carbon dioxide is improved to form glucose? During photosynthesis carbon dioxide is energetically improve with hydrogen from water.

Explain enzyme inhibition, ENZYME INHIBITION Enzymes are often inhibite...

ENZYME INHIBITION Enzymes are often inhibited by  the presence of  suitable inhibitors. Much of current drug therapy  is based  on this. Basically, there  are  three major  cla

Bacteria - type of microorganisms, Q. Bacteria - type of microorganisms? ...

Q. Bacteria - type of microorganisms? Many of us know bacteria only as "germs," invisible to naked eyes that can invade our bodies and make us sick. Few know that many bacteria

Differance between rescue-capacity-building strategy, QUESTIONS: Write ...

QUESTIONS: Write an analysis of the Chapter Twelve, the concluding chapter in ROLL AWAY THE STONE. It will be worth UP TO 50 points if you do it well. Submit it through the "Ex

Explain the functional properties of starches, Functional Properties of Sta...

Functional Properties of Starches Starch is a major source of energy (calories) in grains and tubers, and foods made from them. However, when starch is added to products as an

Sigmoid growth curve, GROWT H CURVES - S-shaped or sigmoid - Desc...

GROWT H CURVES - S-shaped or sigmoid - Described by Verhuhst in 1839. It shows 5 phases - (i) Lag phase (ii) Positive acceleration phase (iii) Exponent

Give some examples of cloning and molecular biology, Examples of cloning an...

Examples of cloning and molecular biology cloning may produce heterozygous individuals (as mother was heterozygous) and suggests a way to get pure breeding cats molecu

Explain rectangular full mucoperiosteal flaps, Explain Rectangular Full Muc...

Explain Rectangular Full Mucoperiosteal Flaps - Endodontic Surgery      a. Releasing and relaxing "vertical" incisions, with the Horizontal incision, b. Causes re

How are genetic diseases classified, How are genetic diseases classified? ...

How are genetic diseases classified? The Genetic diseases classify into chromosomal abnormalities and genetic mutations. Between chromosomal abnormalities there are the aneu

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd