Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is meant by encystment
Q. Counselling at Diagnosis? A newly diagnosed case of diabetes will have lots of questions and will be confused regarding the treatment and complications of the diabetes. It i
Clonig,plasmid vectors,lambda&M13based vectors
Q. Describe Shunts? Detection, localization and quantification of intracardiac shunts are one of the most important exercises in cardiac catheterization. In most cases a prelim
Define Gender Discrimination - Public Nutrition? Of the detrimental factors, that affect food security, gender discrimination is the most pervasive and vicious. The fact that h
6. What is the function of the myelin sheath? Do all axons present a myelin sheath?
Define the term - Functional magnetic resonance imaging Functional magnetic resonance imaging (fMRI) is a recent development that permits simultaneous measurements of the brain
List four common exercises you will recommend to a patient. Common exercises are: - brisk walking - cycling - swimming - playing tennis - dancing - rope skip
By the technology development, the price of computer has become lower and lower. For this reason, a majority of family can afford this technology. A large amount of applications so
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd