Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Removal of obturating material -Gutta percha . -Carrier bassed gutta perca. -silver points . - paste type. - obstructed fracture instrument .
All the efforts that go into the preparation of instruments are futile if the sterilization process itself is not successful. There is no way of seeing that instruments are sterile
What surrounds a plant cell
Q. What is gastrulation? How during gastrulation are the first two germ layers formed? What are these germ layers? Gastrulation is the process through which a portion of the bl
What is the central dogma of molecular biology? Succinctly (and clearly) describe the concept.
Physical map is the map of locations of the identifiable landmarks on DNA (for example restriction of the enzyme cutting sites, genes), regardless of their inheritance. Distance i
What is reproduction?
Must account for both food AND light as zeitgebers Because of the continuous light / dark periods of the year; light not always able to act as a zeitgeber. Food
Determine about the Trichromatic vision Trichromatic vision is the terminology used for normal vision, those who require aU' three primary colours to make a match with an unkno
Oxidation of glyceraldehyde-3-phosphate Oxidation of glyceraldehyde-3-phosphate : The conversion of glceraldehyde- 3-phosphate to 1,3-bisphosphoglycerate is catalysed by
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd