Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What would happen to a cell if it was placed into a hypertonic solution? Into a hypotonic solution? What would happen to a cell if the cell itself was hypertonic to the solution?
Define about Traumatic needles Traumatic needles are needles with holes or eyes which are supplied to the hospital separate from their suture thread. The suture must be thread
Accident Causation - Accidents and Losses Several accidents occurs everyday year round in industries. We have already discussed different types of accidents and injuries t
Determine Procedure for determination of protein content? Now carry out the procedure as enumerated herewith: 1. Preparation of standard albumin: A standard solution of 2 mg
Define requirements of Vitamin A of infants? On the basis of vitamin A ingested by breast fed infants in well-nourished communities, ICMR (1990) has recommended a daily allowan
Concerning digestion how are poriferans characterized? Sponges are dissimilar from other animals since they present only intracellular digestion. They do not have a digestiv
Explain about Blood pressure Blood pressure is explained as the force exerted by the blood against the walls of the arteries. Blood pressure (BP) can be described as the fo
# ???? ..
This assignment was done, sent in marked then sent back to me to be resubmitted. Comments were grammar & structure to be reviewed so could you please proof read & make it more acad
Biodynamic: This dealing with energetic of organisms. Biodynamic is a method of organic farming which treats farms as unified or individual organisms, emphasizing balancing the ho
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd