Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Why does the ingestion of vegetable fibers improve the bowel habit in people that suffer from hard stools? Some types of plant fibers are not absorbed by the intestine but play
i have a question on how to proceed the fomular of delete the gene on the human body.
Manifestations of Hypertension • Renal Failure • Left Ventricular Failure • Myocardial Infarction • Cerebral Haemorrhage
Dietitians and nutritionists Dietitians and nutritionists, who are associated with hospitals and clinics generally have regular work hours. At times, they may be required to wo
Imporatnce of food preservation These include: increased shelf-life decreased hazards from microbial pathogen decreased spoilage (microbial, enzymatic) in
Q. What are diseases of the connective tissue? What are some of them? Diseases of the connective tissue are acquired or hereditary diseases numerous of autoimmune cause charact
Water Water is the most important constituent of all living tissue. It forms up to 95% of the fresh weight of some animals. We all know that water is lost through sweat, excre
Q. Can you explain Pneumothorax? Air in the pleural cavity manifests in a number of ways on the CXR, depending on the volume of air and position of the patient. The typical fin
what does the sperm cell fuses with?
# ???? ..
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd