Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Hydrochory - dispersal of seeds, Hydrochory - Dispersal of Seeds Plant...

Hydrochory - Dispersal of Seeds Plants that grow in or along the bank of water bodies often utilize water as an agency for dissemination of fruits and seeds. Coconut, Cocos nu

Define importance of nutrition in human body, Define Importance of Nutritio...

Define Importance of Nutrition in Human Body? Nutrition is increasingly being recognized as an important determinant, which modulates the biological process of ageing. Poor nut

State the term - rCBF, State the term - rCBF In rCBF, the participant i...

State the term - rCBF In rCBF, the participant inhales a small amount of a radioactive gas such as xenon, which is absorbed into the bloodstream and thus transported around the

Biology Question, Why is VeggieTales such a consistently high-quality progr...

Why is VeggieTales such a consistently high-quality program?

Evaluate what is the frequency of carriers in a tank, Zebrafish are raised ...

Zebrafish are raised in fish tanks with one family per tank. The mutation spadetail is a recessive lethal. A stock tank for spadetail was made by crossing two carriers. The fish in

Define interaction of vitamin k with calcium, Define interaction of vitamin...

Define interaction of vitamin k with Calcium? Since vitamin D functions have an impact on calcium metabolism, an inter-relationship exists between vitamin IS-dependent proteins

Help, wolves are predators for hares the wolf population increases what hap...

wolves are predators for hares the wolf population increases what happenes next?

Soil ph and nutrient availability, Soil pH and Nutrient Availability So...

Soil pH and Nutrient Availability Soil pH is the most important factor which governs the availability of nutrients in soil. All the nutrients are absorbed by plants in their io

Monoclonal antibody, Monoclonal Antibody is an antibody with quite specifi...

Monoclonal Antibody is an antibody with quite specific and often unique binding specificity which is secreted by the biologically cloned line of plasmacytoma cells in the absence

Show water permeability of the luminal membranes, Healthy Person H takes a ...

Healthy Person H takes a new drug named ANTICAMPCOLLDUCT that blocks the production of cyclic AMP (cAMP) in collecting duct epithelial cells in response to vasopressin binding to V

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd