Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is an example of a hypothesis, What is an example of a hypothesis whic...

What is an example of a hypothesis which may explain why there is not a big representation of the class Reptilia found in polar regions? Beings of the class Reptilia are abunda

Explain cell signaling, In multicellular organisms there is a requirement f...

In multicellular organisms there is a requirement for the cells to communicate with one another in order to coordinate their metabolism and growth.  The principal way by  that  cel

Study giude, how many atoms are H2SO4 compound

how many atoms are H2SO4 compound

Explain about the pregnancy and obesity, Explain the Pregnancy and Obesity?...

Explain the Pregnancy and Obesity? Obesity is associated with increased risk for gestational diabetes, hypertension, pre- eclampsia, perinatal mortality and the need for induce

Define management of canal blockage canal calcification, Define Management ...

Define Management of Canal Blockage Canal Calcification Diamond coated instrument rt 1 designed for better visibility and cutting efficiency a) Very powerful for efficient

Define regulation of water balance, Define Regulation of Water Balance? ...

Define Regulation of Water Balance? The input of water, as well as, its loss can be highly variable due to individual habits and environmental factors; in spite of this, the to

What are the communication process steps, Q. What are the Communication pro...

Q. What are the Communication process steps?Communication process steps: 1. Rapport Building 2. Finding the Problem 3. Planning 4. Implementation of the Plan 5. Ter

Management of respiratory failure, Management Goals Improve ...

Management Goals Improve oxygenations and ventilation to restore the person/s Pa 2 O 2 and PaCO 2 , to their previous levels.  Understand the underlying cause.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd