Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is the structure of the adult fern within which cells undergoing meiosis can be found? In these plants meiosis takes place within structures known as sorus (plural, sori),
Packaging Compound feeds, whether in mash or pellet form, are packed in bags or stored in bins. Bags may be filled directly from mixers, pellet coolers or holding bins and wei
What are cytochromes? Cytochromes are proteins of the internal mitochondrial membrane that are specialized in electron transfer and participate in the respiratory chain. Energi
How does a population differ from a community? A population having of all members of a single species that live in an area, while a community consists of all organisms of any s
What is the generic function of leukocytes? What are leukocytosis and leukopenia? The generic function of leukocytes is to contribute in the defense of the body against strange
Specify the things needed for a nurse-led primary health care practice relating to childhood obesity. In particular, you need to do the following two things: (a) Indicate:
Reproductive health disorders to dairy livestock accounts to a loss of about Rs 30,000- 50,000 crore annually to the nation. Better herd management can minimize the occurrence of d
Explain the Modern Trends in Animal Taxonomy? Earlier you learnt how taxonomy is interrelated to other biological fields. You also learnt how information is used from other f
Viscosity and Plasticity of colloidal particle Various degrees of viscosity and plasticity are encountered in colloids. Viscosity may be described as resistance to pouring.
Question 1 List any five differences between DNA and RNA 2 What is tandemly repeated DNA? Describe its types 3 What is rolling circle replication of DNA? How does it take place
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd