Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain Temperate Deciduous Forests-Taiga and tundra? Temperate deciduous forests are typified by the type of forests predominantly found in the eastern and northeastern Unit
The heart is drained by vessels that travel in the interventricular and atrioventricular grooves. One set runs in the anterior part of the atrio-ventricular groove. The vessels of
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
State the term - Halsted Reitan varies with the particular test Scoring for the Halsted Reitan varies with the particular test, such that individual scores may be expressed in
What is Machined implant Machined implant has irregular surface roughness from approximately 10μm grooves and ridges in the machining direction. The roughness of implants can
why lymph is called the middel man of the body
Quantitative Methods - Therapeutic diets Quantitative Methods: These are often essential for constructing Lherapeutic diets. The two ways by which this could be done are as
What is Large Intestine in human biology? Food undigested in the small intestine is passed on by peristalsis into the large intestine, or colon. The intestine is composed of ci
What is Pressure Support Ventilation (PSV)? In a spontaneously breathing patient, each breath may be augmented with a preset level of pressure. The extent of support depends o
what is the effect of insuline in body ?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd