Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain sympatric and allopatric speciation, Sympatric OR allopatric specia...

Sympatric OR allopatric speciation Sympatry The development of new species within a population. Two Hebe sp living in the same location but with different chromosomal numb

Explain the term antioxidants, Normal 0 false false false ...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Whta is restrictions enzymes, A restriction enzyme or restriction endonucle...

A restriction enzyme or restriction endonuclease is an enzyme which cuts DNA at particular recognition nucleotide sequences with Type II restriction enzymes cutting double-stranded

What are good pharmacovigilance process, Question 1: What are Good Phar...

Question 1: What are Good Pharmacovigilance Process and Good Post-Marketing Surveillance Process? How do they differ from each other? Define and illustrate briefly Good Post

Define the proteins requirement to avoid underweight problem, Define the Pr...

Define the Proteins requirement to avoid underweight problem? Proteins are required for tissue building, as well as, to take care of the daily wear and tear. Under weight indiv

Explain radial symmetry in classification animal kingdom, Explain Radial S...

Explain Radial Symmetry in Classification of the Animal Kingdom? All of the animals besides the sponges are considered to belong to the Eumetazoa, or the "true animals" because

Secondary induction, Secondary Induction The two primary inductive ev...

Secondary Induction The two primary inductive events that we have described so far are significant in the patterning of early embryo. But there are another such signaling eve

What are the pancreas, Pancreas Insulin (β cells) Promotes glucose en...

Pancreas Insulin (β cells) Promotes glucose entry in many cells, and in this way controls carbohydrate metabolism. Glucagon (α cells) Increases synthesis and release of

Illustrate the categories of alloplastic implant materials, Categories of a...

Categories of alloplastic implant materials The entire groups of possible alloplastic implant materials, regardless of their clinical applications fall into the following categ

Desscribe formation of sperm cells from germ cells, Q. Indicating the name ...

Q. Indicating the name and respective ploidy of each involved cell how can the formation of sperm cells from germ cells be described? The formation of spermatogenesis or sperm

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd