Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
The effect of light on the growth of stems (a) Plant some seeds that grow rapidly like as oats, radish, bean or mustard seeds in two flower pots. When the seedlings are about
The ability to maintain myocardial perfusion at constant levels in the face of changing driving presence is termed autoregulation. In normal cases, autoregulation is maintained at
Effects of long term malnutrition on adults In adults, once the stored carbohydrates and fats are used up, the body starts using proteins to generate energy. These protei
Determine SNP variation among the aligned DNAs for a genomic region. See below for how to count SNP variation. The output file (Your_name_snp.txt) should have two
Q. Do echinoderms have an excretory system? How is excretion done in these animals? Echinoderms do not have an excretory system their excretions are eliminated by diffusion.
a recent topic for my developmental biology assignment
Q. Is monoculture a system that contributes to great biological diversity of an ecosystem? The Monoculture implies that in a large area a single crop (only one species of plant
Q. What is the concept of universality of the genetic code? What are the exceptions to this universality? The genetic code is universal because the rules of protein codificatio
Define Modes or Techniques for Chromatographic Separation In practice, chromatographic separation may take one of these modes or techniques: Paper chromatography (in w
What is Bidirectional Superior Cavopulmonary Shunt-Bidirectional Glenn Shunt ? Hospital mortality is between 5 and 10 per cent. Early palliation is very good with arterial sat
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd