Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Difference between essential and natural amino acids, What is the differenc...

What is the difference between essential and natural amino acids? Ans) Significant amino acids are those that the organism is not able to synthesize and that require to be inges

Hypothalamus and pituitary, Hypothalamus and Pituitary The most obviou...

Hypothalamus and Pituitary The most obvious neuroendocrine link is between the hypothalamus and pituitary. The hypothalamus is a part of the brain which is connected to the pi

Phylum arthropoda, PHYLUM ARTHROPODA Definition and Introduction ...

PHYLUM ARTHROPODA Definition and Introduction Bilateral  and protostomial eucoelomate  eumetazoa with metamerically  segmented  and each  segment bearing a pair  of  join

International organization and zoonoses, International organization and zoo...

International organization and zoonoses In 1962, the Food and Agriculture Organization and the World Health Organization created the Codex Alimentarius Commission (Codex) to e

What are the main parts of ferns, What are the main parts of ferns? Fer...

What are the main parts of ferns? Ferns are constituted by small roots that come downwards from the rhizome (stem, often orizontalized). The fronds also arise from the rhizome.

Mitral flow velotity, The normal flow pattern cross-mitral valve is a tall...

The normal flow pattern cross-mitral valve is a tall E wave where is due to early rapid filling and small A-wave which is due to atrial contraction. E/A ratio >1. Pulmonary

Urea molasses mineral block (ummb) licks, Urea molasses mineral block (UMMB...

Urea molasses mineral block (UMMB) licks Development of urea molasses mineral block licks is another technology being increasingly used in several parts of India and such lick

Explain the bunsen burner, Explain the Bunsen Burner? It is a type of g...

Explain the Bunsen Burner? It is a type of gas burner that gives very hot flame by allowing air to enter at the base and mix with the gas. It is used - (a) For sterilizing i

State the aim of neuropsychological assessment, State the aim of Neuropsych...

State the aim of Neuropsychological assessment Neuropsychological assessments aim at specifying in as much detail as possible the functional deficits that exists in a manner th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd