Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
How does a plasma membrane regulate movement of molecules into and out of a cell?
What is Placoid scale? Elaborate in detail. Scales characteristic of cartilaginous fish. Formed from the dermis, scale is anchored in that layer by a basal plate composed of de
Q. Why is there a sense of pressure change inside the ear when someone goes down a mountain? The pressure inside the middle ear is maintained equal to the external ear so to th
male sex organs
Define Practical Preparation - Qualitative Test for Monosaccharides? 1. Wear your labcoat. Make sure your hair is tied and you have no loose clothing. These can be dangerous in
Define the Dietary and Lifestyle Modifications - Obesity? The management of obesity basically comprises the following three- pronged approach. a) Dietary modifications b)
Question Write a short note on the following: 1 Gram staining 2 Embden-Meyerhoff-Parnas pathway 3 Interferons 4 Probiotics 5 Pasteurization 6 Endospores
Q. What is the association between sunrays and vitamin D? Vitamin D or calciferol is synthesized in the skin by the action of the ultraviolet range of sunrays upon precursor mo
Determine the term - Epilepsy In epilepsy, a person suffers from recurrent seizures of various types that register on an electroencephalogram and are associated with disturbanc
Proteins of Animal Origin - Milk: Milk: A value of 3.5% protein is often considered as an average for milk. Milk protein has traditionally been divided into 2 classes - casei
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd