Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What are imago and nymph? Nymphs are larvae of hemimetabolic insects (like grasshoppers). They are very similar to the adult insect although smaller, In holometabolic insect
Q. What are the examples of secretory cells? Endocrine and exocrine pancreatic cells, parathyroid and thyroid endocrine cells, adenohypophysis, adrenal and pineal endocrine cel
S t r a tegic and tactic control of parasitic diseases The reduced performance of the animals in terms of decreased milk yield, draught power, breeding performance, poor bo
Transgenic Animal Over the centuries, animals with new combinations of genes have been produced using conventional breeding methods by means of careful selection of particular
Denaturing Gel is an agarose or the acrylamide gel run under conditions which destroy the secondary or tertiary protein or RNA. For protein, this generally means the inclusion of
Cytokines activate inflammatory cells like neutrophils and eosnophils.IL-5 is important in activation of eosnophils, IL-4 enhances IgE production by B-cells. IL-4, Il-5, IL-6, TNF-
Extracted chlorophyll pigments If we take chlorophyll molecule in a test tube and provide 2 CO and water and expose the mixture to sunlight, glucose is not formed. If we
Question 1 Explain pharmacokinetic parameters observed in plasma concentration time curve Question 2 What is Gas Chromatography? Mention the quantitative applications of gas
Q. Which are the three parts of the small intestine? The small intestine is divided into three portions: duodenum, ileum and jejunum. Q. By generally dividing food into car
What are the characteristics of cardiac muscle that allow it to be highly resistant to fatifue?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd