Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Wheel organ of amphioxus.
Explain some Do's and Don'ts when working in Laboratory? 1) Always wear a lab coat when working a laboratory. 2) Ensure that no harm is caused to yourself or the people work
What are the biological troubles that molluscs face due to their soft body? Because molluscs have a soft body they are more fragile. They also have more complexity to support t
Production Efficiency - Ecosystem The maximum amount of solar energy harvested by plants is about 5 per cent but the average for green plants, on the whole is only a small fra
COMMON DISEASE OF CATTLE & BUFFALOES - 1 . Anthrax - Its symptoms are high temp, painless & warmthless swellings on different body parts. Bloody discharge from na
V apour Theory (i) It was proposed by a Greek philosopher Pythagoras in 500 B.C. (ii) Each organ of an animal body emitted some kind of vapour and that a ne
Q. What are the Symptoms of pectic ulcer? Increased gastric tone and painful hunger contraction when stomach is empty. Hunger contraction 1-3 hours after meals is the main com
Q. Define Bioactive materials? Bioactive materials: Certain glasses, ceramics, and glass-ceramics that contain oxides of silicon, sodium, calcium and phosphorus (SiO 2 , Na 2
The oxidation of substrates like free fatty acids (FFA), glucose, lactate and ketone bodies results in the energy of Adenosine triphosphate (ATP) and Creatine phosphate (CP). The s
Determine the types of blood There are three types of blood cells. They are Red Blood Corpuscles (RBC), White Blood Corpuscles (WBC) or leucocytes and blood platelets or thromb
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd