Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Can you explain Deoxynivalenol Mycotoxicosis? During 1987, an outbreak estimated to have affected over 50,000 people in the State of Jammu and Kashmir, was traced to the c
Ask question #Minimum 100 words accepted
Q. What is the special route that lipids follow during digestion? What are chylomicrons? Triglycerides emulsified by the bile within micelles suffer the action of lipases that
Q. Can you explain Bauhin? We got the first reference of binary use of species name in Pinax (1623), a publication of a Swiss physician and botanist Casper Bauhin (1560-1624).
Explain the Appearance of the Pupil The pupil should appear round and regular. The normal diameter is 2-4 mm. On stimulation by light, the pupil constricts, so as to redu
How did the industrial revolution in England offer an example of natural selection? One of the classic instances of natural selection is regarding the moths of industrial zones
ALL ABOUT AUTOCHORY?HOW IT WORKS
Q. How does the sodium-potassium pump present in the cell membrane work? What is the significance of this protein for the cell? The sodium-potassium pump is the transport prote
What is the evolutionary importance of the fruits for the angiosperms? The fruits have seeds and they can detach from the plant falling on the ground or can serve as food for a
What are typical structures of the seed? What is the endosperm? A typical seed is the composed of the embryo, endosperm and shell. Inside seeds of angiosperms there are one or
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd