Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Who is fruits useful for diabetics patients, Fruits Diabetics should ha...

Fruits Diabetics should have fruits every day. Be careful to select fruits and fruit juices, citrus fruits, such as oranges, grapefruit should be included. Tell them to eat fru

Whta are radial loops , When the chromosomes  are depleted  of histo...

When the chromosomes  are depleted  of histones  they  are seem  to have  a central fibrous 'protein  scaffold'  or nuclear  matrix  to which the DNA is attached  in loops. Therefo

What is the most likely genotype of p1, In cats, curled ears (Cu) results f...

In cats, curled ears (Cu) results from an allele that is dominant over an allele for normal ears (cu). Black colour results from an independently assorting allele (G) that is domin

Procedure for quantitative determination of viable microbes, Explain for Pr...

Explain for Procedure Quantitative Determination of Viable Microbes? Now carry out the exercise following the steps included herewith: 1. Label the diluent tubes from 10 -1

Explain increases-decreases or shifts in demand terminology, Explain about ...

Explain about the increases or decreases or shifts in demand terminology. Market into equilibrium P 1 Q 1 , here demand D 1 equals supply S 1 • When price reduce fromP 1

Functions of citric acid cycle, Functions of Citric Acid Cycle The citr...

Functions of Citric Acid Cycle The citric acid cycle is an amphibolic pathway  i.e.  it  is involved in both anabolic and catabolic processes

Explain the working of pulmonary circulation, Explain the working of Pulmon...

Explain the working of Pulmonary Circulation? In pulmonary circulation, blood is pumped to the lungs, where carbon dioxide is exchanged for oxygen. Blood returning from the bod

Types of bone, TYPE S OF BONE - On the basis of its texture , a bone ...

TYPE S OF BONE - On the basis of its texture , a bone is of two types - Spongy or cancellous or tubercular bone and Compact or periosteal or dense bone.

Surface markings of the heart, The Upper Border of the Heart A:  Mark a ...

The Upper Border of the Heart A:  Mark a point on the lower border of the left second costal cartilage 1.2 cm away from the sternal margin. B:  Mark a point on the upper bord

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd