Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Skeletons of radiolarians The skeletons of radiolarians and foraminiferans form a primary constituent of ocean bottoms where they form 30% or more of the sediment. It is calle
Explain the Torsional Failure - Root Canal Test a. Occurs when the tip of the rotating instrument blinds (locked) in the canal while the motor continues to rotate the shank of
If you wanted to create a synthetic organelle to test new drugs for toxicity, which natural organelle's function would you try to replicate?
Is monoculture a system that contributes to great biological diversity of an ecosystem? Monoculture means that in a large area a single crop (only single species of plant) is c
how autophagy help in converting a tadpole larva into adult amphibian
Define Nutritional Needs of the Elderly? In this, we learnt about the nutritional needs of the elderly, and in doing so we have also focused on many other aspects such as who d
Class Pycnogonida of Phylum Arthropoda Measures generally 3-4 mm; body chiefly made up of cephalothorax, abdomen being very small; generally four pairs of walking legs; long p
A dihybrid cross yields 320 F2 offspring. How many are expected to resemble the homozygous recessive parental?
Induction of hydrolases - Responses to Infection Plants do respond to attack by pathogens. To restrict their spread the cells synthesise and secrete enzymes to hydrolyse the c
Occurrence of vitamin B 12 Vitamin B 12 is one of the cobalamin, a group of active principles widely occurring in nature. Vitamin B 12 is present especially in liver, kidney
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd