Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Risk analysis - animal studies, Animal studies Most toxicological data ...

Animal studies Most toxicological data for risk assessment are derived from the animal studies and  it  is, therefore, essential that these studies be conducted following widel

Role of biotic factors inducing senescence, Role of Biotic Factors Inducing...

Role of Biotic Factors Inducing Senescence Besides environmental and endogenous factors, biotic factors also play a role in inducing senescence. For example, due to an attack

Define hormonal responses to injury, Define Hormonal Responses to Injury? ...

Define Hormonal Responses to Injury?  A number of hormonal changes take place in patients following injury. There is a marked rise in the counter regulatory hormones, viz., glu

Procedure for morphological characteristics of yeast cells, Procedure for M...

Procedure for Morphological Characteristics of Yeast Cells? Now carry out the exercise following the steps enumerated herewith: (1) Label the clean, non-greasy slide. Put fe

What will phenotypical feature actually manifested depend, For an individua...

For an individual having a genotype formed of two different alleles that condition different varieties of the same phenotypical trait, upon what will the phenotypical feature actua

Respiration - metabolism of pollen tubes, Respiration - Metabolism of Polle...

Respiration - Metabolism of Pollen Tubes In the unpollinated pistils of Hippeastrum hybridum very high O 2 , tension exists from stigma down through most of the style. During

What is the main theory opposed to evolution?, What is the main theory oppo...

What is the main theory opposed to evolution? The major theory that opposes the evolution theory on the explanation of how species emerged (phylogenesis) is fixism.

Nematodes, how nematodes adapt to their mode of feeding

how nematodes adapt to their mode of feeding

Mitral valve repair-indications for surgery, Mitral Valve Repair :  When...

Mitral Valve Repair :  Whenever possible, the valve has to be repaired rather than replaced. Preoperative investigations and a TEE done on the operating table will help the surg

What is the mn blood system, What is the MN blood system? What is the patte...

What is the MN blood system? What is the pattern of genetic inheritance of the MN blood system? A MN blood system is a third (in addition to the ABO and the Rh) system of blood

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd