Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Show some examples of migratory animals, Q. What are some examples of migra...

Q. What are some examples of migratory animals? Instance of the migratory animals are southern right whales from Antarctica, that procreate on the Brazilian coast; the migrator

What is g-protein, Which of the following is true for a G-protein? A. A...

Which of the following is true for a G-protein? A. After the ATP-ase of the alpha subunit of a G protein converts the ATP bound to the alpha subunit to ADP and inorganic phosph

Complete feed system in ruminants, Complete feed system in ruminants C...

Complete feed system in ruminants Complete feed system for feeding dairy animals is a departure from conventional individual rationing method. It involves the self-feeding of

Skeleton, what are the biological significance of skeleton

what are the biological significance of skeleton

What are the methods of foams, What are the methods of foams? There are...

What are the methods of foams? There are two basic methods in  the formation of foams i.e. a) whipping and b) condensation.

Which cardiac muscle is microscopically, State two ways in which cardiac mu...

State two ways in which cardiac muscle is microscopically similar to skeleton muscle.

What is the other name given to the sex chromosomes, Q What is the other na...

Q What is the other name given to the sex chromosomes? What is the function of the sex chromosomes? Sex chromosomes are also known as allosomes the other chromosomes that are n

What are functions of the epithelium, Q. What are some functions of the epi...

Q. What are some functions of the epithelium? The epithelial tissues can perform protection, covering and impermeability against the environment, for instance, in the skin, res

Cold hardiness and cold acclimation, Cold Hardiness and Cold Acclimation ...

Cold Hardiness and Cold Acclimation In connection with cold response we would like to introduce two terms- cold hardiness and cold acclimation. Cold-hardiness ref

Filaments of a sarcomere in a skeletal muscle is decreasing, When the overl...

When the overlap between the thin and thick filaments of a sarcomere in a skeletal muscle is decreasing, the A. total length of the I band minus the length of the H zone is dec

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd