Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What are the morphological, chemical and functional similarities and differences between peroxisomes and lysosomes? Similarities: Peroxisomes and lysosomes are small membran
How is energy transferred along a food chain? The energy flux beside a food chain is always unidirectional, from the producers to the decomposers.
Define Formula Concentration and Supplementation - Calorie Density? Formula Concentration can be done by decreasing the amount or water added in the mixing of the formula. Sta
Which of the following is true for a toe motor neuron that excites a toe muscle that moves the big toe in the left foot? A. All of the axon terminals of the toe motor neuron ar
Define Recommended Dietary Allowance for pyridoxine (RDA)? Average requirements for pyridoxine vary with age, sex and physiological conditions such as protein status, pregnan
Asteroid impacts: The hypothesis which links certain mass extinction events with the impact of the comet or asteroid, most particularly the mass extinction 65 million years which
What are universal donors and universal recipients concerning the ABO blood system? The Universals donors of the ABO blood type system are the individuals of the type O. The Ty
Q. How are solutions classified as per to their comparative tonicity? Comparative to another, a solution can be isotonic or isosmotic, hypotonic or hyposmotic or hypertonic or
What is the endocrine function of the placenta? The placenta is not a permanent gland of the endocrine system but it also has endocrinal function. The placenta produces estroge
ERRORS IN FERTILIZATION - 1. Polyspermy - When more than one sperms are fused in an ovum, this condition is called polyspermy. 2. Polygynae - During oogen
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd