Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Describe in brief about retina, Describe in brief about retina The reti...

Describe in brief about retina The retina is a highly complex layer of nervous tissue. The photoreceptors are rods and cones for scotopic and photopic vision respectively. The

Epigenetics, how does epigenetic controls transcription?

how does epigenetic controls transcription?

Describe the general examination of clinical examination, Describe the gene...

Describe the general examination of clinical examination? It is always to better to ask the patient to help himself/herself in setting on to the examination table and rename so

Historical example of management of renewable resources, Define Historical ...

Define Historical example of management of renewable resources? There are fundamental and well developed applications of mathematical and quantitative approaches to the managem

Glanders, Glanders The glanders is caused by Burkholderia mallei (previous...

Glanders The glanders is caused by Burkholderia mallei (previously known as Malleomyces mallei) and it is a serious contagious disease of equines. Infected equidae are the reservo

Define vacuum production and thermal processing - canning, Define Vacuum pr...

Define Vacuum production and Thermal processing - Canning? Vacuum production - This can be obtained by filling the heated product into the can, by heating the can and content

Explain about the commercial sterility, Explain about the Commercial Steril...

Explain about the Commercial Sterility? It is important to remember that bacterial destruction is a logarithmic function, complete destruction not probable to make food commerc

Name two food additives needed to keep food wholesome, a) Name two food ad...

a) Name two food additives needed to keep food wholesome, and say what they do. b) Name two food additives (or types of additive) which are not necessary for keeping fo

Pisces, I have an assignment about Pisces in zology can you creat it

I have an assignment about Pisces in zology can you creat it

Explain oxidation-reduction potential, Oxidation-reduction  Potential (ORP)...

Oxidation-reduction  Potential (ORP) ORP is related to the concentration of oxidizers or reducers in a solution, and their activity or strength. It provides an indication of th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd