Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain Recovery or Anabolic Phase of Stress Response? When wounds are closed and infection has resolved, repletion of lean tissue and fat stores along with restoration of stre
What is an Erlenmeyer flask and how is it used? It is same to a beaker, except that it gets narrower at the top. It is use to hold liquids and do reactions in it.
COMMO N EYE DEFECTS - 1 . Glaucoma - Pressure of aquous humour is increased, retina is degenerated. 2 . Presbyopia - Due to non etastic cilliary muscles,
Define the Recommended Dietary Allowances of Vitamin K? Recommended dietary intakes have not been suggested for different age groups or gentler. The safe levels of intake have
Tick-Borne Encephalitis (TBE ) TBE occurs in Scandinavia, Western and Central Europe and countries of the former USSR, mainly in rural forested areas. Risk is greatest from Apri
Q. Described Microbiology of Air? Ans. You would realize that air, by nature, does not contain a natural flora of microorganisms. All that comes into air is by accident and i
i want to online research biology projects
Determine the term Memory - Psychological tests The acquisition, reaction, and retrieval of new information is a domain of much importance in infants and young children at risk
What are the affinities of pteridophytes with gymnosperms?
Define Stolon - Types of Hyphae? Microscopically, hyphae are aseptate and coenocytic. There are 3 kinds of hyphae: (a) Stolon - These grow horizontally on substratum surfa
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd