Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Hydrochory - Dispersal of Seeds Plants that grow in or along the bank of water bodies often utilize water as an agency for dissemination of fruits and seeds. Coconut, Cocos nu
Define Importance of Nutrition in Human Body? Nutrition is increasingly being recognized as an important determinant, which modulates the biological process of ageing. Poor nut
State the term - rCBF In rCBF, the participant inhales a small amount of a radioactive gas such as xenon, which is absorbed into the bloodstream and thus transported around the
Why is VeggieTales such a consistently high-quality program?
Zebrafish are raised in fish tanks with one family per tank. The mutation spadetail is a recessive lethal. A stock tank for spadetail was made by crossing two carriers. The fish in
Define interaction of vitamin k with Calcium? Since vitamin D functions have an impact on calcium metabolism, an inter-relationship exists between vitamin IS-dependent proteins
wolves are predators for hares the wolf population increases what happenes next?
Soil pH and Nutrient Availability Soil pH is the most important factor which governs the availability of nutrients in soil. All the nutrients are absorbed by plants in their io
Monoclonal Antibody is an antibody with quite specific and often unique binding specificity which is secreted by the biologically cloned line of plasmacytoma cells in the absence
Healthy Person H takes a new drug named ANTICAMPCOLLDUCT that blocks the production of cyclic AMP (cAMP) in collecting duct epithelial cells in response to vasopressin binding to V
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd