Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Is the transportation of gases in tracheophytes made through the vascular tissues? The Carbon dioxide and The Oxygen are not transported through the xylem or phloem. These gase
Molybdenum Although molybdenum functions as a component for the enzymes xanthine oxidase, sulfite oxidase and aldehyde oxidase, requirements for it are not established. Molybdenum
Q. What is the special route that lipids follow during digestion? What are chylomicrons? Triglycerides emulsified by the bile within micelles suffer the action of lipases that
Photoorganoheterotrophs and Chemoorganoheterotrophs - Nutritional Types (1) Photoorganoheterotrophs - These microorganisms use light as a source of energy and organic compound
The main arena of various types of activities of a cell is: 1. Plasma membrane 2. Mitochondrian 3. cytoplasm 4. Nucleus Cytoplasm
PITUITARY GLAND (HYPOPHYSIS CEREBRI) - It develops from ectoderm of the embryo. The pituitary gland is located just below the hypothalamus. The pituitary gland is situate
what are the branches of applied biology?
Q. What do you mean by Binomial system in binomial nomenclature? In the previous sections we have outlined the concepts of binomial nomenclature at International level and the
MOSAI C THOERY - It was given by W. Roux. He studied the development of frog's egg. He destroyed one cells by a hot needle out of 2-cells formed as a result of first cleava
What about foam stability? Foam stability can be determined by two factors i.e. drainage and bubble size. The volume of the liquid drained due to gravitational forces when foam
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd