Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. How is it structurally explained that the motor activity of the left side of the body is controlled by the right cerebral hemisphere and the motor activity of the right side of
wine turns sour beause of the action of which bacteria? aerobic or anerobic?
Q. What do ypu know about Conduction Disturabances? During exercise there is an increase in the sympathetic drive and a withdrawal of vagal tone. Sympathetic enhancement of con
Run off Some of the rainfall is soaked into the soil and excess water flows over the land surface along the natural slope of the area. Run off is the main source of water for l
Q. Foods for Growth in microorganisms? Microorganisms differ in their ability to use various nitrogenous compounds as a source of nitrogen for growth. The primary nitrogen sour
How can you see a DNA by size if it too small to see with a microscope
Give the salient features of phylum protozoa
Define Requirements of Fluid in Postoperative Nutritional Care Extensive fluid losses may occur through vomiting, haemorrhage, diesis, excudate, fever and sweating after a surg
Explain the Importance of Biochemical Tests? Specific series of biochemical tests have been developed for fast identification of microorganisms in laboratories. These biochemic
Two typical characters of the Hemichordata that can be observed and used to identify them are: i) Soft, worm-like or short unsegmented body. ii) Body is divided into a (i) pr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd