Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain nutritional effects of hemicelluloses, Nutritional effects Of Hemic...

Nutritional effects Of Hemicelluloses Hemicelluloses are classified under the category of soluble dietary fibers.  Hemicellulose is an indigestible complex carbohydrate that ab

Osmoregulation in marine non-chordate metazoans, Osmoregulation in Marine N...

Osmoregulation in Marine Non-Chordate Metazoans Studies on the osmotic pressure of body fluids of marine organisms have displayed that their internal osmotic pressure is more

Hearing, HEARIN G  - Sound waves struck ear drum, it starts vibratio...

HEARIN G  - Sound waves struck ear drum, it starts vibrations, these vibrations are carried to MIS → f. ovalis → S. vestibule →  Hellicotrema → S. Tympani → f. rotundus → mi

What are the major features of the meristematic cells, What are the major f...

What are the major features of the meristematic cells? And why do these cells need to have a high mitotic rate? The Meristematic cells have very thin cell walls, a well-central

What is molecular formula of the compound, A solid compound was found to co...

A solid compound was found to contain 42.11% C, 51.46%O and 6.43% H by weight. The molecular weight of the compound was 341. What is the molecular formula of the compound?

Explain coiling of garden pea tendrils, Coiling of garden pea tendrils arou...

Coiling of garden pea tendrils around any support is an example of: 1. Thigmotaxis 2. Thigmonasty 3. Thigmotropism 4. Thermotaxis Thigmotropism

Do moulds grow better where it is warm or cold, Do moulds grow better where...

Do moulds grow better where it is warm or cold? This time put single culture dish in a warm dark place and the other in a cold dark place. Study the dishes after a some days.

Of which type of defense cell do worm infections, Q. Of which type of defen...

Q. Of which type of defense cell do worm infections stimulate the multiplication? The main leukocytes that generally participate and multiply in the defense against worm infect

Succession, why succession more likely to occur on valley floor than steep ...

why succession more likely to occur on valley floor than steep slopes

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd