Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Develop questions which will facilitate effective research, Theories are im...

Theories are import because they can be used to a. Test research hypothesis b. Develop questions which will facilitate more effective research c. Conduct more meaningful and useful

Rna molecule have two polynucleotide chains like the dna, Q Does RNA molecu...

Q Does RNA molecule have two polynucleotide chains like the DNA? Only DNA has two polynucleotide chains. The RNA is formed by just one polynucleotide chain.

Theory of embryology - mosaic thoery, MOSAI C THOERY - It was given by...

MOSAI C THOERY - It was given by W. Roux. He studied the development of frog's egg. He destroyed one cells by a hot needle out of 2-cells formed as a result of first cleava

What is the energy source used in active transport, What is the energy sour...

What is the energy source used in active transport through biological membranes? The energy essential for active transport (against the concentration gradient of the transporte

Explain glomerular filtration in human nephrons, A horticulturist keeps Chr...

A horticulturist keeps Chrysanthemum plants in short-day conditions during long-day season. State its effect on flowering. Specify the role of phytochrome included. Explain glom

By which mechanisms pathogenic bacteria cause diseases, Q. What are few me...

Q. What are few mechanisms by which pathogenic bacteria cause diseases? And why is this knowledge important? Pathogenic bacteria have characteristics called as virulence factor

Cellular machinery for the replication of nucleic acids, Which of the follo...

Which of the following statements is true? Answer Viruses are distict from cells by the absence of a lipid membrane around them. Viruses are parasites that require the cell's metab

Describe five different types of gateway vectors, Describe five different t...

Describe five different types of gateway vectors that are available, what different functions they can perform, and for what purpose. e.g.  (1) Vector pXXX, (2) function - expre

Illustrate the term - digestive caecum., Illustrate the term - Digestive ca...

Illustrate the term - Digestive caecum. A blind-ended pouch which extends from main digestive tract. Digestive ceca may be the sites for final digestion of ingested food or may

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd