Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Health Effects related to Probiotics? Several lines of evidence support the conclusion that normal gut microflora are involved in resistance to disease, especially gastr
Q. What are Diastolic Compressive Forces? Coronary perfusion pressure equal to pressure gradient between the coronary arteries and the pressure in LV in diastole. When coronary
Define reagent required and methodology for Barfoed Test? Reagents - Solutions of glucose, fructose, galactose, lactose, maltose, sucrose and starch - Barfoed's reagent
How to use microorganisms to control diseases
How did Pasteur's experiment vary from Spallanzani's experiment? Instead of sealing the flask in the experimental group after boiling, Pasteur used a flask with a curved neck,
classificationof algae
Human lungs A pair of spongy, elastic and bag like structures of lungs is present in the chest cavity, one on either side of the heart. Lungs are enclosed by a double lay
Define Chain and Ring forms and anomerism? Many simple sugars can exist in a chain form or a ring form. The ring form is favoured in aqueous solutions, and the mechanism of rin
B u f fa l o- p o x The disease is caused by an orthopox virus, closely related to the vaccinia virus. It is not clear whether it should be considered
In a neuron with a resting potential of -65 mV, the distribution of which ion across the neuronal membrane represents the LEAST potential electromotive force (EMF)? A. Potassium
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd