Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Symptomatic patient: Symptomatic patient (class 11, 111 or IV) with severe MR and normal left ventricular function (EF > 0.6) and end systolic dimension of LV
What is Etherification The act or process of making ether; specifically, the process by which a large quantity of alcohol is transformed into ether by the agency of a small am
Define Placental secretion of oestrogens During pregnancy? Placental secretion of oestrogens increase with progression of pregnancy. Oestrogens perform many functions. They sti
What is mucoperiosteal flap Silk is easy to handle, ties with a slip knot, and is relatively inexpensive compared with other nonabsorbable suture materials currently available.
Define Quantitative or Analytical Method for Estimation of Nitrogen and Protein? You may recall reading earlier that proteins contain nitrogen along with carbon, hydrogen and s
how vagina is inserted in cock
Heteromorphic Types - Intra specific Incompatibility Plants of the same species produce flowers that differ in morphology. This involves two (distyly) or three (tristyly) morp
Explain Taxonomists as Synthesisers? Your study of the earlier units of taxonomy, in particular its history must have made you aware that the field of taxonomy has changed cons
Alterations occurring in egg The quality, flavour, composition and functional properties of eggs are adversely affected more rapidly and to a greater extent by the speed and co
What is Neurological Complications of Congenital Heart Disease ? Neurological complications contribute substantially to mortality and morbidity from congenital heart disease.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd