Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Ornithosis (psittacosis), Or nit h o s i s (psittacosis) This is ...

Or nit h o s i s (psittacosis) This is an important zoonotic bacterial infection and causes disease in humans and birds. Collectively, these conditions are called as chla

Explain procedure for performing the completed coliform test, Explain Proce...

Explain Procedure for Performing the Completed Coliform Test? Completed test is the last step in the Coliform test procedure which is described herewith. Conduct the exercise f

What is the lasting form in the gametophyte, Q. What is the lasting form in...

Q. What is the lasting form in the gametophyte, pteridophytes or the sporophyte? How can it be compared to bryophytes? The lasting form in pteridophytes is the diploid (2n) spo

Foods incriminated, Foods that are frequently incriminated in staphylococca...

Foods that are frequently incriminated in staphylococcal food poisoning include meat and meat products, poultry and egg products, egg, tuna, chicken, potato and macaroni, bakery pr

Mitosis, What is the role of mitosis in growth?

What is the role of mitosis in growth?

Does the fish heart pump venous or arterial blood, Q. Does the fish heart p...

Q. Does the fish heart pump venous or arterial blood? After oxygenation in the gills the arterial blood goes to the tissues so the fish heart pumps venous blood, the venous blo

Explain the bioavailability of thiamin, Explain the Bioavailability of Thia...

Explain the Bioavailability of Thiamin? Thiamin is readily available from the gut from food sources (as thiamin phosphate esters). Drugs and alcohol abuse may interfere with th

What are plasmids, What are plasmids? The Plasmids are circular DNA mol...

What are plasmids? The Plasmids are circular DNA molecules present in the genetic material of some bacteria. They may perhaps contain genes responsible for bacterial resistance

Categorisation of major brain functions, Categorisation of Major Brain Func...

Categorisation of Major Brain Functions As a framework, the major brain functions typically divided into modalities and domains. The major modalities are motor function and th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd