Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is nidation? In which phase of the menstrual cycle does nidation occur? Nidation is the implantantion of the embryo in the uterus and Nidation takes place around the 7t
dog
Describe Alternation of Generations? Alternation of Generations : In meiosis, four haploid daughter cells are formed from one diploid mother cell. The life cycles of sexuall
what is endosperm haustorium
Q. Definition of Osseointegration in microscopic biology? From a view point of macro and microscopic biology and medicine. Osseointegration of a fixture in bone is defined as t
In earthworms, when the ovaries mature, the clitellum secretes a viscous substance in the form of a girdle. This girdle hardens in to a cocoon around the clitellum. The ova are dis
The aqueous solution with the lowest pH is: Select one: a. 0.01 M HCl. b. 0.1 M acetic acid (pKa = 4.86). c. 0.1 M formic acid (pKa = 3.75). d. 0.1 M HCl. e. 10 t
How much ampicillin (sodium sal, mw=371.40) would you dissolve in 400 mL of water to make 80 mg/ml solution of ampicillin?
What are the three main types of trophic pyramids studied in Ecology? The three kinds of trophic pyramids studied in Ecology are the numeric pyramid, the biomass pyramid and th
Q. What do you mean by Insect control? The insects can breed and hide in garbage and other places where there is availability of waste materials. The cockroach lives and breed
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd