Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain the Transcription Factor of Zinc? Zinc is an important structural component of DNA- binding proteins also known as 'transcription factors'. These transcription factors
Explain the process of Absorption of Fats? After digestion, only 25% of triglycerides are broken completely to glycerol and fatty acids. Major digestion product is 2-monoacylgl
Suggest a mechanism that would allow a plant to grow better if it had intermorph neighbors than if it had intramorph neighbors. Think about the degree of genetic similarity between
what are the main functions of lungs and heart
What is root cap? Root cap is a protective structure located in the tip of the growing root. It defends the meristematic tissue of the root forming a cap that surrounds the tip
How does the Cornea work, I heard that it is like a motor, however i''m not too sure... because a motor is in vehicle and has piston, and the Cornea is in our eyes and... Well does
Explain the Sub-clinical Protein Energy Malnutrition? You have already learnt that clinical forms of PEM represent only a small proportion of the total cases of PEM in a commun
Ask question what is classification of livibg thingsMinimum 100 words accepted#
What are nymph and imago? Nymphs are larvae of hemimetabolic insects (like grasshoppers). They are very same to the adult insect although smaller. In holometabolic insects (lik
Explain the Economics in Nutrition? We mentioned earlier that nutritional problems affect the productivity of the individual, which, in turn affects the productivity of the nat
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd