Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Briefly describe about the micro minerals, Briefly Describe about the Micro...

Briefly Describe about the Micro Minerals? The last unit focused on the macro minerals. Now in this unit we will study about the micro minerals, namely, iron, zinc, copper, sel

How does the presence of exoskeleton, Q How does the presence of exoskeleto...

Q How does the presence of exoskeleton describe the general small size of arthropods? Since they have periodic ecdysis and exoskeleton, the growth of arthropods is limited to a

Explain phylum ascomycetes, Phylum Ascomycetes 1) Sexual reproduction i...

Phylum Ascomycetes 1) Sexual reproduction is by conjugation and is followed by the formation of ascospores inside a sac called ascus. 2) The asci may be grouped together to

Define effect of fat on quality and quantity of human milk, Define effect o...

Define effect of Fat on quality and quantity of human milk? Fat content of milk appears to be subject to variability as compared to other constituents. The average fat content

Define meiosis, Give two examples in each case of organs or tissues in whic...

Give two examples in each case of organs or tissues in which you would expect  (a) meiosis,  (b) mitosis to be taking place   a) Meiosis is likely to

What is the explanation for the bleeding, Q. What is the explanation for th...

Q. What is the explanation for the bleeding that accompanies menses? The hemorrhage that accompanies menses occurs because the endometrium is a richly vascularized tissue and t

Golgi apparatus, GOLGI APPARATUS Camillo Golgi in 1898 discovered a retic...

GOLGI APPARATUS Camillo Golgi in 1898 discovered a reticular structure in the cytoplasm of nerve cells with the help of metal impregnation technique using silver nitrate for whic

Determine the occurrence of vitamin B12, Occurrence of vitamin B 12 Vi...

Occurrence of vitamin B 12 Vitamin B 12 is one of the cobalamin, a group of active principles widely occurring in nature. Vitamin B 12 is present especially in liver, kidney

Describe how many bones are there in human foot, Describe how many bones ar...

Describe how many bones are there in human foot The human foot is a great mechanical marvel. It has 26 bones, 29 joints, and 42, various ligaments, a sensitive and protective s

Taxonomy, what arachnid is beneficial

what arachnid is beneficial

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd