Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Analyze the similarities and differences between chemosynthesis and photosynthesis. Determine what you believe is the most significant step in regard to harnessing energy within ea
Maximum and minimum range of an animal with the factors of Ph Salinity Pressure Relative human
Explain the Acoelomates - Animals without a Body Cavity? The simplest group of animals that has bilateral symmetry and a solid body (acoelomate) is the Platyhelminthes. Phy
Derived Proteins These are not naturally occurring proteins and are obtained from simple proteins by the action of enzymes and chemical agents, heat, mechanical shaking, UV or
Q. How do the muscles of the legs and of the feet contribute to the venous return? The muscles of the legs mainly the muscles of the calves compress and contract the deep veins
Define influence of polyphenols on Carbohydrates? Binding of proteins may indirectly affect carbohydrate absorption. Inhibition of amylolytic enzymes and subsequent reduction o
Define Reagents for Preparation of Phosphate Buffers? Buffer solutions of pH4, pH7 and pH 9.18 phosphate buffer solution: 0.1 M disodium hydrogen phosphate or Na 2 HPO 4
Q. What are the classes into which the phylum Arthropoda is divided? What are the three major ones and some of their representative species? The three main classes of arthropod
Q. Can Diseases be etiological factor for diabetes? Diseases: In aging, a very important cause of diabetes could be an underlying disease. Diabetes occurs secondary lo some ot
Explain Kashin Beck disease caused by selenium deficiency? Kashin Beck disease was identified to affect growing children in parts of Siberian Russia and China. It is characteri
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd