Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
HISTORY OF THE CELL Term "Cytology" was given by Hertwig , he also wrote a book on " Cell and Tissue ". Father of cytology = Robert Hooke. Father of Modern cytology
Duck plague (duck virus enteritis) Duck plague is the most serious disease caused by a herpes virus (Anatid herpes virus). Though antigenically homogenous, differences in virul
What is Saliva Saliva is the colourless viscous fluid. It helps in swallowing the food by lubricating the food and the neutral pH of saliva prevents the decalcifica
Hemicellulose In plant cell walls, the most abundant compound present is α-cellulose with long fibers embedded in a matrix of cementing compounds (matrix polysaccharides). Thes
#question.which annelids shws bioluminescence .
Define hypertension, discuss its causes and explain its effects on the body. What role, if any, does medical imaging play in hypertensive patients? Explain and give examples.
What is the formula for photosynthesis? H 2 O + 6CO 2 + Light Energy ----> C 6 H 12 O6+ 6O 2 6 molecules of water + 6 molecules of carbon dioxide --->1 molecule of glucose
Q. Of what substance is the plant cell wall made? Of which monomer is it made? The plant cell wall is made of cellulose. Cellulose is a polymer whose monomer is glucose. There
show me the schamatic diagram of chrysomoeba?
What is the MN blood system? What is the pattern of genetic inheritance of the MN blood system? A MN blood system is a third (in addition to the ABO and the Rh) system of blood
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd