Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define fluorides metabolism, Define fluorides Metabolism? Soluble fluor...

Define fluorides Metabolism? Soluble fluorides, even at high intake levels are almost completely absorbed from gastrointestinal tract. These include aqueous solutions of fluori

Explain atazanavir, Explain Atazanavir Atazanavir (ATV, Reyataz) - Ata...

Explain Atazanavir Atazanavir (ATV, Reyataz) - Atazanavir (Medical Letter 2003; 45:89) is the first single-agent protease inhibitor with once-daily dosing. In clinical trials

Nitrates and nitrites- preservative, Normal 0 false false f...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Explain materials for root end filling- amalgam, Explain Materials for Root...

Explain Materials for Root End Filling- Amalgam a) Its radiopacity is the better than any other REF materials b) Greatest amount of leakage! c) Corrosion, and significant

Enumerate about the visual field examination, Visual Field Examination ...

Visual Field Examination Russel et. al include a formal visual field examination using a parameter as part of their assessment procedure. Tests in the expanded version include

Write down a dna palindrome, Write a DNA palindrome or inverted repeat of a...

Write a DNA palindrome or inverted repeat of at least 10 nucleotides in length.

Air pollution- introduction, Air pollution is complex in origin and varied ...

Air pollution is complex in origin and varied in effect. It is very crucial from the point of human health. Every human being inhales about 15-22 kg of air daily and air is pollute

Examine why humans not evolve with one central repository, Discuss why huma...

Discuss why humans not evolve with one central repository of DNA rather than having it replicated throughout the body?

Classifications of carbohydrates based on number of aldehyde, Define Classi...

Define Classifications of carbohydrates based on number of aldehyde? Classification based on the presence of aldehyde or ketone group Carbon atoms Aldos

Define the cell structure and function, Cell structure and function All...

Cell structure and function All organisms, whether simple or complex, plants or animals. are composed of cells. For example, a bacterium or an amoeba is made up of just one cel

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd