Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Nuclear transfer method: Nuclear transfer will extend the range of species in which gene targeting will be possible and thereby provide better models to test treatments for human
comparitive table to explain the differences between the animals in chordate classes
State the term - Focal Seizures A focal seizure begins in one place and then spreads. As for example in a Jacksonian focal seizure, the attack begins with jerking movements in
Define method Used for Capsular Staining - Anthony Staining Method? Another method used for capsular staining is Anthony staining method, devised by E.E. Anthony in 1931. The m
Explain the Equilibrium Dialysis? Equilibrium dialysis is a useful technique for studying the binding of a small uncharged solute species (a ligand) to a macromolecule. The mac
discovery of two light phase in photosynthesis
Historically what were the two main evolutionary theories? The two major evolutionary theories were darwinism and lamarckism.
What is the relevance of knowing about GI of foods? Let us see how this index is helpful in prescribing therapeutic diets. You would realize that the dietary GI provides an ind
Explain about the Energy Requirements in elderly? Based on the Benedict - Harris equation for men and women, the daily energy requirements can be calculated. For Men: 66 t
#question.what is the mechanism of circulatory system .
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd