Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
PHYSIOLOGY AND BIOCHEMISTRY - Ample and concrete evidence of organic evolution are obtained from the functional activity and chemical composition of animals. J.B.S. Hald
TYPES OF DISEASE communicable Caused by infective agents disease
have any picture this expiriment at record?
What are some diseases caused by abnormal GH secretion by the hypophysis? In childhood deficient GH secretion might be lead to delayed growth and in severe cases to nanism (dwa
What is Sporocyst? Specify. A stage in the life cycle of trematode flukes. Sporocyst develops from the mericidium found in intermediate host. Every sporocyst contains the germ
how can i read role od fungi as saprophyte?
Protonephridia and Metanephridia Nephridia take place in two major forms - the protonephridium and metanephridium. Protonephridia are found in flat worms. The protonephridial
Define Gastrointestinal tract - Excretion of Zinc in Humans? Majority of zinc is lost from the body in faeces. Endogenous zinc in the form of enzymes or metallo-proteins is sec
Osler's nodes are small, tender subcutaneous nodules that develop in the pulp of the digits or occasionally more proximally in the fingers and persist for hours to several days. Th
Tonicity and the plant cells. Complete the experiment and answer the questions. Table 7.3: Potato type: Potato A: Beginning displacement (ml) = Ending displacem
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd