Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain microbiological apparatus and equipments, Explain Microbiological A...

Explain Microbiological Apparatus and Equipments? It provides an orientation to the various basic equipments, i.e., instruments, tools, glassware and miscellaneous items used i

What is the binding between two amino acids called, What is the binding bet...

What is the binding between two amino acids called? The chemical bond among two amino acids is called a peptide bond. Protein Structure Review - Image Diversity: peptide bo

Illustrate about the principle of context, Illustrate about the Principle o...

Illustrate about the Principle of Context A third principle guiding the neuropsychological assessment of children is that environment contexts help to constraint and determine

Major renal processes that combined produce urine, Q. What are the three ma...

Q. What are the three major renal processes that combined produce urine? Urine is made by the occurrence of three processes in the nephron that are tubular resorption, glomerul

Future challenges of management of renewable resources, Define Future chall...

Define Future challenges of management of renewable resources?   In response to past shortcomings in a few fisheries management, and to dealing with other conservation goals

Determine the nutritional needs of humans, Determine the nutritional needs ...

Determine the nutritional needs of humans? In the previous unit, we saw how involvement in sport or vigorous activities can affect the body's nutrient needs. In this unit, we w

Impact changes in diet in management of diabetes mellitus, Impact of change...

Impact of changes in diet in the management of diabetes mellitus Changes in diet are an essential component of comprehensive diabetes care and treatment.  In this section you w

State the classification of nervous system, State the Classification of ner...

State the Classification of nervous system Neurological disorders can be categorised according to the primary location affected, the primary type of dysfunction involved, or th

Define the enzyme deficiency or defects, Define the Enzyme deficiency or de...

Define the Enzyme deficiency or defects? A food sensitivity or intolerance can occur when the body has difficulty in digesting a particular food and therefore reacts against it

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd