Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain factors influencing rs content of foods, Explain factors influencin...

Explain factors influencing rs content of foods? 1) Presence of sugar and lipids: Studies so far show that presence or addition of lipids and sugar reduces RS content. 2) Ca

Define nutritional requirements of fats and oils, Define Nutritional Requir...

Define Nutritional Requirements of Fats and Oils? As with the other macronutrients, we do compute requirements of visible fats too for all age groups and give guidelines for se

What do you mean by subxiphoid long axis sweep, Q. What do you mean by Subx...

Q. What do you mean by Subxiphoid Long Axis Sweep? This sweep begins with keeping the transducer at subxiphoid region, positioning directly posterior with marker pointing towar

Trends in human evolution, Before we further proceed to discuss the fossil ...

Before we further proceed to discuss the fossil history of the humans we shall briefly look into what distinguishes humans or genus Homo from his ancestors namely the apes. These d

The outside of the neuron to the inside, Which of the following require ATP...

Which of the following require ATP? The movement of potassium from the outside of the neuron to the inside? The movement of sodium into the neuron through a chemically gated

Explain about battery, Explain about Battery Battery:  Two electrodes ...

Explain about Battery Battery:  Two electrodes (zinc and carbon) placed in electrolyte (dilute sulfuric acid).  Chemical reactions in electrolyte force positive charges to

Antiarrhythmic therapy, Patients with heart failure have a high incidence o...

Patients with heart failure have a high incidence of both symptomatic and asymptomatic arrhythmias. About 10 per cent of patients have syncope or presyncope resulting from ventr

Infectious canine hepatitis, Infectious canine hepatitis The disease i...

Infectious canine hepatitis The disease is caused by type-1 canine Adenovirus in the family Adenoviridae. The disease appears in pups as peracute, acute, and mild. The clinica

Kangroo rat, Kangroo Rat Kangroo rat Dipodornys merriami, a native of ...

Kangroo Rat Kangroo rat Dipodornys merriami, a native of South-West America is a classical example of how small mammals survive in desert. It exhibits all the osmoregulatoryad

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd