Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain the minimum requirement of nutritional needs, Explain the Minimum R...

Explain the Minimum Requirement of nutritional needs? Minimum nutrient requirement is defined as the 'lowest amount of the nutrient ji-om the diet that will prevent clinically

Etiology and clinical features - neurological disorder, Define Etiology and...

Define Etiology and Clinical Features that causes neurological disorder? The cause of this neurological disorder can be mechanical or paralytic. The mechanical cause is primari

What is histone methyl transferases, Histone methyl transferases (HMTs) hav...

Histone methyl transferases (HMTs) having a protein domain called SET. This domain is responsible to adding methyl groups to histones. Which of the following is a false statement r

Meiosis different from mitosis, All of the following make meiosis different...

All of the following make meiosis different from mitosis, EXCEPT A. Meiosis comprises two separate divisions. B. Meiosis only occurs during embryonic development. C. Chromosome num

Show the examples of arthropods, Q What are the few examples of arthropods?...

Q What are the few examples of arthropods? Ants, crabs, cockroaches, shrimps, flies, spiders and scorpions are examples of arthropods.

How can the binding of two amino acids, Q. How can the binding of two amino...

Q. How can the binding of two amino acids for the peptide formation be explained? A peptide is formed when a carbon from the carboxyl group of one amino acid is connected to th

Define the dietary management for underweight, Define the Dietary Managemen...

Define the Dietary Management for Underweight? We just read about the etiological factors that may lead to undernutritioin and weight loss. Whatever may be the cause, all under

Explain the nutritional management of eating disorders, Explain the Nutriti...

Explain the Nutritional Management of Eating Disorders? Good nutritional management of patients with eating disorders requires attention to a number of areas. It is important t

Define functions of manganese, Define Functions of Manganese? Like othe...

Define Functions of Manganese? Like other micro minerals, Mn also functions in mammalian enzyme systems. It can function both as an integral part of metalloenzymes and as an en

Interactions between minerals, Interactions between minerals Copper de...

Interactions between minerals Copper deficiency has been identified as a serious problem for grazing ruminants. A deficiency may be due to low concentrations of Cu in forage a

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd