Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain Keshan disease caused by Selenium deficiency? It is a cardiomyopathy (disease of the myocardium, involving heart muscle) that was identified to affect children and wome
GOLGI APPARATUS It is a complex cyctoplasmic structure made up of smooth membrane saccules or cisternae, a network of tubules with vessicles and vacuoles, which take part i
Phylum Sarcdina 1) They move by means of pseudopodia (ralse feet) or similar structures. 2) They feed heterotrophically by phagocytosis. Some examples: Amoeba, Entamo
Define Endocrine Systems and Metabolism? As mentioned earlier, the main endocrine gland-pituitary gland secretion decreases. Another important feature in elderly is decline in
Human Impact on Nitrogen Cycle Human activities are profoundly affecting the cycling of nitrogen in nature. Over 30 x 10 6 metric tons/yr. of N 2 is fixed in the commercial
Alternative polyadenylation sites Exact pre-mRNAs hold more than single group of signal sequences for 3' end polyadenylation and cleavage. In some cases, the area of t
Explain the assessing and monitoring of peri-implant The parameters used for assessing and monitoring the peri-implant conditions need to be understood and applied judiciously
Filariasis Filariasis is a chronic infection caused by filarid worms. Around 10 species of Filaridae family are parasitic to man. Adult worms live in the tissues or body cavities
Q. Why does the urinary volume increase when alcoholic beverages are ingested? Alcohol inhibits the ADH (antidiuretic hormone) secretion by the hypophysis and Low ADH reduces t
How Parasitic infections are found? Parasitic infections are found throughout the world. With increasing travel, immigration, use of immunosuppressive drugs and the spread of A
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd