Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Transportation of gases in tracheophytes vascular tissues, Is the transport...

Is the transportation of gases in tracheophytes made through the vascular tissues? The Carbon dioxide and The Oxygen are not transported through the xylem or phloem. These gase

Agro industrial-molybdenum, Molybdenum Although molybdenum functions as a ...

Molybdenum Although molybdenum functions as a component for the enzymes xanthine oxidase, sulfite oxidase and aldehyde oxidase, requirements for it are not established. Molybdenum

Can you illustrate chylomicrons, Q. What is the special route that lipids f...

Q. What is the special route that lipids follow during digestion? What are chylomicrons? Triglycerides emulsified by the bile within micelles suffer the action of lipases that

Define photoorganoheterotrophs and chemoorganoheterotrophs, Photoorganohete...

Photoorganoheterotrophs and Chemoorganoheterotrophs - Nutritional Types (1) Photoorganoheterotrophs - These microorganisms use light as a source of energy and organic compound

Explain various types of activities of a cell, The main arena of various ty...

The main arena of various types of activities of a cell is: 1. Plasma membrane 2. Mitochondrian 3. cytoplasm 4. Nucleus Cytoplasm

Pituitary gland, PITUITARY GLAND (HYPOPHYSIS CEREBRI) - It develops ...

PITUITARY GLAND (HYPOPHYSIS CEREBRI) - It develops from ectoderm of the embryo. The pituitary gland is located just below the hypothalamus. The pituitary gland is situate

Applied biology, what are the branches of applied biology?

what are the branches of applied biology?

What do you mean by binomial system in binomial nomenclature, Q. What do yo...

Q. What do you mean by Binomial system in binomial nomenclature? In the previous sections we have outlined the concepts of binomial nomenclature at International level and the

Theory of embryology - mosaic thoery, MOSAI C THOERY - It was given by...

MOSAI C THOERY - It was given by W. Roux. He studied the development of frog's egg. He destroyed one cells by a hot needle out of 2-cells formed as a result of first cleava

What about foam stability, What about foam stability? Foam stability ca...

What about foam stability? Foam stability can be determined by two factors i.e. drainage and bubble size. The volume of the liquid drained due to gravitational forces when foam

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd