Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What are the organs that are part of the female reproductive system? The organs that comprise the female reproductive system are the ovaries, the Fallopian tubes (or uterine t
What are the two groups of defense mechanisms of the body against foreign or harmful agents? What is the difference between them? The body has many defense mechanisms against f
What is genes Duplication ? Duplication of genes can happen when a portion of a chromosome breaks off and attaches itself to the end of its homologous chromosome, as seen below
Infectious bovine rhinotracheitis (IBR) The disease is caused by a Bovine Herpesvirus -I belonging to the family Herpesviridae and subfamily Alphaherpesvirinae. It is a DNA vi
What is vision? Why is vision important for life on earth? Vision is the ability of some living beings to perceive, to differentiate and to interpret luminous stimuli. Visio
Q. Habitat for the worlds species? Natural ecosystems provide habitat for the world's species. Forests, coral reefs and deep ocean bottoms house many species. Wetlands, through
significance of gastrulation
What are the tupes of Aortic Aneurysm Surgery? Types of Surgery : Technique of surgery and the approach depends on the site of thoracic or thoraco abdominal aortic aneuiysm.
The signals for parturition originate from: 1. placenta only 2. placenta as well as fully developed foetus 3. oxytocin released from maternal pituitary 4. fully develop
Explain the Infarct Exclusive Technique? Infarct Exclusive Technique : Left ventriculotomy is done through the infarcted area. No attempt is made to close the ventricu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd