Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define about the growth and development in children, Define about the Growt...

Define about the Growth and development in children? Growth and development in children can be studied under the following heads: . • Changes in physical development and bod

Foods for phenylketonuria patient, Q. Foods for phenylketonuria patient? ...

Q. Foods for phenylketonuria patient? The majority of foods for a PKU patient should come from the bottom half of the pyramid. As you may have observed, this contains the pheny

Name the molecules make active transport through membranes, Which are the m...

Which are the molecules that make possible active transport through membranes? Active transport is made by exact membrane proteins. These proteins are called "pumps" because

Why nutrition is important for health, Why Nutrition is important for healt...

Why Nutrition is important for health Nutrition is one of the basic components of  life. It is an essential part of health care. You already know that good nutrition  is essent

Define light source of microscope, Define Light Source of Microscope? I...

Define Light Source of Microscope? It is either mirror or electric illuminator present at the base. Identify the mirror in Figure. Some microscopes have reversible mirror with

Kinds of succession - ecology, Kinds of Succession - Ecology The ecolo...

Kinds of Succession - Ecology The ecological succession can be broadly classified into two kinds, on the basis of the nature of the habitat. Figure: Kinds of Success

Explain the feeding process for preschoolers, Explain the Feeding process f...

Explain the Feeding process for Preschoolers? The word preschool children, you may be aware, is used for children less than six years of age. After the first year, there is a s

Explain calvin cycle, Calvin cycle (the aka Calvin-Benson Cycle or the Car...

Calvin cycle (the aka Calvin-Benson Cycle or the Carbon Fixation) is the series of biochemical, enzyme-mediated reactions during which the atmospheric carbon dioxide is reduced an

Ribosomes, Ribosomes - It is also known as Protein factory, Engine ...

Ribosomes - It is also known as Protein factory, Engine of the cell. Ribosomes are smallest cell organelles (150 x 250 Å). Unit membrane less cell organelle. Ribo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd