Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is Joints Joints are locations where two or more bones come together, or articulate. Bones are joined with varying degrees of rigidity. Joints may be fixed, as in the s
Gum Arabic Gum Arabic or Gum Acacia is the oldest and best known of the natural gums. Gum Arabic is the natural exudate produced by various species of the thorny Acacia trees
Define Mineralizations and formation of new bone? Vitamin D plays a role in the synthesis of a prominent non collage nous protein, osteocalcin, a vitamin K- dependent protein f
a. Which amino acid can form disulfide bonds? b. Which level of protein structure do disulfide bonds affect? How? c. Cytoplasmic proteins rarely form disulfide bonds, even if they
Can you help explain this question in fairly simple terminology? A certain sample of DNA has a Tm of 65oC, while another has a Tm of 58oC. What can you tell about the relative n
What are the Applications of Nicotinic acid Nicotinic acid is mainly used in the vitamin fortification of flour, macaroni and noodle products. Independent of its vitamin effic
Implementation of Nursing Care Administration of Appropriate Drugs If the surgery is not necessary or if it is postponed for some time then diuretics and digoxin are
Role of Biotic Factors Inducing Senescence Besides environmental and endogenous factors, biotic factors also play a role in inducing senescence. For example, due to an attack
Most of them happen on mucous membrane. Allergens enter the body by the process of inhalation or ingestion.
Functions of Gluconeogenesis The significance of gluconeogenesis include: 1) During starvation or during periods of limited carbohydrate intake, when the levels of liv
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd