Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain mitosis a synonym of reproduction, Q Why in few cases is mitosis a ...

Q Why in few cases is mitosis a synonym of reproduction? In some living beings asexual reproduction occurs by many means binary division, budding, grafting, schizogony, etc. In

What are analogies for a nucleolus, What are analogies for a nucleolus? ...

What are analogies for a nucleolus? If the nucleolus is the president of a factory then the nucleolus is the manager

Pporifera, write the general account of porifera

write the general account of porifera

Types of somatoform disorders, Types of Somatoform Disorders: Somatofo...

Types of Somatoform Disorders: Somatoform disorders are sub classified into the following categories. These include somatization disorder,  conversibtl  disorder, hypochondria

Explain homozygosity and heterozygosity, What is the difference between hom...

What is the difference between homozygosity and heterozygosity? Homozygosity happens when an individual has two identical alleles of a gene, for instance, AA or aa. Heterozygos

Nitrates and nitrites- preservative, Normal 0 false false f...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Discuss about sarcoplasmic reticulum, A healthy skeletal muscle fiber is is...

A healthy skeletal muscle fiber is isolated and has no external forces on it.  It has normal intracellular levels of ATP and is bathed in physiological saline.  Which of the follow

Digestive system - teeth, TEET H - Study of teeth is odontol...

TEET H - Study of teeth is odontology. Accumulation of oral bacteria & their products on teeth is plaque. Some acids are secreted by bacteria causing carries.

Why is carbon monoxide toxic for humans, Why is carbon monoxide toxic for h...

Why is carbon monoxide toxic for humans? Hemoglobin "likes" carbon monoxide (CO) much more than it likes oxygen. When there is carbon monoxide in the inhaled air it binds to he

Cell cycle, what is the process of cell cycle?

what is the process of cell cycle?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd