Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Determine the diversity of biological evolution, Is crossing over important...

Is crossing over important for the diversity of biological evolution? Sexual reproduction and recombination of linked genes (crossing over) are, with mutations, the main instru

Do moulds grow better where it is dark or light, Do moulds grow better wher...

Do moulds grow better where it is dark or light? This time leave one culture dish in a warm place where it receives light all the time. Place the other dish in a warm dark plac

Show metabolic rate of aerobic organisms, Q. Why can be the consumption of ...

Q. Why can be the consumption of molecular oxygen indicates the metabolic rate of aerobic organisms? Molecular oxygen (O 2 ) consumption has direct relation to the cell metabol

Diplotene and diakinesis, Diplotene: The paired chromosomes repel eac...

Diplotene: The paired chromosomes repel each other and begin to separate. Separation however, is not completed, because homologous chromosomes remain united by their point

Nitrogen assimilation, The next step in the nitrogen cycle is the assimilat...

The next step in the nitrogen cycle is the assimilation of inorganic nitrogen in the type of ammonia into organic nitrogen-having compounds. Total organisms assimilate  ammonia  by

Determine the floor of nose and nasal spine, Floor of nose and Nasal spine ...

Floor of nose and Nasal spine Although variable, the nasal floor is typically situated 5-9mm below the level of inferior turbinates. The inferior piriform rim is used as a guid

General examination - heart failure, The patient will appear anxious and dy...

The patient will appear anxious and dyspnoeic. Patients in chronic heart failure are usually malnourished and even cachectic. Chronic passive venous congestion may produce exophtha

Synthesis of polyamine, Synthesis of Polyamine As the name of this cla...

Synthesis of Polyamine As the name of this class of compounds suggests, polyamines have several amino groups replacing hydrogen usually in alkyl chain e.g., putrescine is 1, 4

What is the function other than protection of the ribs, What is the functio...

What is the function, other than protection, of the ribs? The ribs help to alter the volume of the thorax during breathing movements.

How much nacl can be made using 30g of nacl, How much of a 10% w/v of nacl ...

How much of a 10% w/v of nacl can be made using 30g of nacl? Please show all steps.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd