Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain Adverse Effects of Oseltamivir Nausea and vomiting can occur. Taking the drug with food decreases the incidence of nausea. In juvenile rats, very high doses of osel
Write on spoilage of food products by fungi,nutrition,condition for growth,consequencies and prevention.
Define Nutrient and Storage protein - biological function of protein? These proteins store amino acids. Ovalbumin is the protein of egg white, employed as an amino acid source
Sinus Perforations The maxillary antrum can sometimes be inadvertently penetrated. Through careful pre-operative planning using radiographs, including axial scans, this compli
STRUCTURE Golgi body consists of :- (1 ) Cisternae These are plate like unbranched structure with dilated ends. One golgi body has 4-8 cisternae. Mono cisternal
Discuss the similarities and differences of transposable elements in E. coli, yeast, plants, and Drosophila.
Q. How to investigate aortic stenosis by Cardiac Catheterization? The indications are to confirm hemodynamics when the non-invasive tests are not conclusive or there is a disc
Explain about the Artificial Sweeteners? As a group, artificial sweeteners are classed as "non-nutritive". Thus, they provide sweet sensation to the tastebuds, with no increasi
Define Classification of foods based on pH? Of these, the nature of the food, primarily the pH of food, is the most significant determinant of how severely the food will be pro
Q. Explain the process of Degradation of Proteins? Proteins are composed of amino acids combined by peptide linkages. The native proteins are resistant to attack by microo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd