Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain about picaridin, Picaridin Laboratory and field studies docume...

Picaridin Laboratory and field studies documenting the efficacy of picaridin. No published data are available on the efficacy of the 7% solution now available in the US. Insec

C dna amplification, Steps of C dna amplification 1.  Smart-pcr amplif...

Steps of C dna amplification 1.  Smart-pcr amplification of cdna is the technique which initiates with the change of mrna to cdna utilizing mmlv-rt, mutated in the rnase h dom

Describe in detail about retina, Describe in detail about Retina The r...

Describe in detail about Retina The retina is a highly complex layer of nervous tissue. The photoreceptors are rods and cones for scotopic and photopic vision respectively. Th

Explain the groups of diabetes food pyramid, Explain the groups of diabetes...

Explain the groups of diabetes food pyramid The six groups of diabetes food pyramid are shown in Figure below. 1) Fat, oils and sweets (smallest group) 2) Milk 3) Mea

Discuss the role of dental implants in orthodontic anchorage, Q. Discuss th...

Q. Discuss the role of dental implants in orthodontic anchorage? The increasing popularity of dental implants has led to its use for orthodontic anchorage. Conventional means o

Determine lamellar compaction and remodeling, Lamellar compaction and remod...

Lamellar compaction and remodeling (6 to 18 weeks) A remodeling phase is initiated in which hematopoietic-derived osteoclastic cells form cutting cones will remove the establis

What do you understand by abdomen, In organisms that have undergone tagmosi...

In organisms that have undergone tagmosisthe trunk often develops into two tagma, oneinvolved in locomotion and one that is notlocomotory. The tagma not involved in locomotionis re

Explain fish actomyosin, Fish actomyosin Fish actomyosin has been found...

Fish actomyosin Fish actomyosin has been found to be quite labile and easily changed during processing and storage. During frozen storage, the actomyosin becomes progressively

Why is this area more vulnerable to damage than others, A small family was ...

A small family was traveling in the car when a minor accident happened. The children in the back seats were wearing lap belts, but still sustained numerous bruises about the abdome

Explain the de bakey type i dissection, Explain the De Bakey Type I Dissect...

Explain the De Bakey Type I Dissection? De Bakey Type I Dissection :  Initial steps of the operation are same as previously described. Provision for deep hypothermic ci

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd