Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Respiration, lesson plan practical requirements

lesson plan practical requirements

Explain about microbial polysaccharides, Microbial polysaccharides Many...

Microbial polysaccharides Many microorganisms produce polysaccharides that either remain attached to the cell wall (capsular polysaccharides) or are  secreted into the extracel

In vivo imaging in psychiatry, In vivo imaging in psychiatry To illustr...

In vivo imaging in psychiatry To illustrate the ingenious applications to which in vivo imaging can be put, consider the use of PET in the study of hallucinations by Frith and

Detritus food chains, Detritus Food Chains Detritus food chains begin ...

Detritus Food Chains Detritus food chains begin with dead organic matter which is an important source of energy. A large amount of organic matter is contributed by the death o

Explain point mutations gene, Explain Point Mutations gene? Mutations ...

Explain Point Mutations gene? Mutations involving single genes occur by addition, substitution, or deletion of a single base in DNA. Such mutations, called point mutations, ca

Collibacillosis, C o l l i ba c i ll o si s It is commonly s...

C o l l i ba c i ll o si s It is commonly seen in newly born farm animals and occurs in septicaemic and enteric collibacillosis forms. E tiology: The disea

Role of fat or lipids in metabolism, ROLE OF FAT OR LIPIDS - Made up...

ROLE OF FAT OR LIPIDS - Made up of fatty acids & glycerol. Linked by ester bond. Maximum quantity of energy is librated. Helpful in temperature regulation. As stored f

Ingestion of foreign bodies, Ingestion of Foreign Bodies: As we know  ...

Ingestion of Foreign Bodies: As we know  that small children are curious and  innocence children are notorious for inserting various object into their orifices like mouth, nos

Reproduction, when pollen tube enters the embryo-sac,it has;

when pollen tube enters the embryo-sac,it has;

Streptococcal antibody test, In about 80 per cent of ARF patients, ASO titr...

In about 80 per cent of ARF patients, ASO titre is significantly raised. ASO titres vary with age, geographical area and other fevers, which influence frequency of streptococcal in

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd