Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is the difference among systole and diastole Systole and diastole are the two stages into which the cardiac cycle is separated. Systole is the stage when the contraction o
How can i design an experiment to compare the heat output by two different types of germinating seeds?
Exercise Stress or emotional upset Medications Aspirin, non-steroidal anti-inflammatory drugs(NSAIDs), beta- blockers(including eye drops), cholinergic dr
Health Hazards with poor management of Bio-medical waste Health hazards associated with poor management of Bio-medical waste are: - Injury from sharps to staff and waste han
Write about 25 parasites of protozoans? And writ the class family and full history about these parasites?
Define Water of hydration and Bound Water - Water Found in Food? Water of hydration: This moisture is chemically bound to the constituents of the material and in most cases w
Explain the Toxicity of nicotinic acid? Although therapeutically useful in lowering serum cholesterol, administration of chronic high oral doses of nicotinic acid can lead to h
What is ventilation A. An increase in the hydrogen ion concentration in the interstitial spaces of the brain stem leads to an increase in the duration of the respiratory cy
Regeneration - Development Biology Regeneration has, intrigued scientists for several generations and has resulting in voluminous literature on the subject beginning from the
parasexual reproduction
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd