Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain the Occurrence of vitamin B 6 Vitamin B 6 activity is attributed to the 3 compounds-pyridoxol (pyridoxine), pyridoxal and pyridoxamine, generally comprised in the vit
Q. What are the three major renal processes that combined produce urine? Urine is made by the occurrence of three processes in the nephron that are tubular resorption, glomerul
why DNA copying is essential
Problem: Evaluation of disabilities due to occupational diseases (a) Describe the following terms: "impairment", "disability "and "handicap" (b) Show how the evaluation o
rRNA structure and synthesis assignment
Locomotion in Mollusca The major locomotor organ in Mollusca is the foot, which is a characteristic feature of these animals. In its simplest form the foot is a flit ventral
Define the Binge Eating Disorder? Binge eating disorder is probably the most common eating disorder. Binge eating you may recall we studied as an element of bulimia nervosa. In
Q. What are the antigen-presenting cells of the immune system? The antigen-presenting cells of the immune system also known as APC cells are cells that do digestion and phagocy
Transcription in eukaryotes, a much more complex procedure than in prokaryotes. In the eukaryotes, translation and transcription take place in several cellular compartments that ar
Define Emerging trends in the nutritional content of technologically? Increased concern about the nutritional content of technologically derived, advanced foods is expressed by
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd