Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is the respective importance of water, carbon and nitrogen for living beings? Water is the major solvent of living beings and it is essential practically for all biochemic
Q. Do plants present only sexual reproduction? There are asexual forms of reproduction in plants few naturally detached pieces of root, leaves or limbs develop into another com
P l e u r iti s It is the acute or chronic inflammation of the pleural membranes. It is characterized by pain during respiration, pleural effusion, and shallow rapid resp
Mylohyoid muscle Surgical manipulation at the crest of a severely resorbed ridge may injure the mylohyoid muscle. Manipulation of the tissues of the floor of the mouth for plac
Define Prevention of vitamin A deficiency? Since dietary inadequacy is the major cause for micronutrient deficiencies, the most rational approach to prevent these deficiencies
Bile salts or bile acids are polar derivatives of constitute and cholesterol the major pathway for the excretion of cholesterol in mammals. In the liver, the cholesterol is circul
write the general account of porifera
How does brain recognize difference between high and low c and soft and loud sounds?
D i a g no s i s Diagnosis, the key for successful management of the disease problem, refers to identification of the cause of a disease. The process of diagnosis requir
Question 1 What is antimicrobial resistance? List the reasons for antimicrobial resistance. Explain why antimicrobial resistance is a global concern. Add a note on various mechani
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd