Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Agro industrial-post-partum anoestrus, Post-partum anoestrus Reproduct...

Post-partum anoestrus Reproductive efficiency among animals greatly depends upon detection of estrus. This is even more important in reference to small herds managed under tro

Explain fungal infections, Fungal Infections Intravenous infusion of am...

Fungal Infections Intravenous infusion of amphotericin B deoxycholate  frequently causes fever and chills, and sometimes headache, nausea, vomiting, hypotension and tachypnea,

Coevolution of prey-predators, Predation is a process by which one organism...

Predation is a process by which one organism (predator) eats another organism (prey). If the prey population is abundant, the predator population also becomes abundant. If the pred

What is an etiological agent of disease, Q. What is an etiological agent of...

Q. What is an etiological agent of disease? The etiological agent of disease is the agent that causes the disease. It may perhaps a living being, substance or environmental fac

What are all possibilities of genotypes and phenotypes, What are all possib...

What are all possibilities of genotypes and phenotypes formed in the combination of alleles responsible for the production of factor VIII? Considering the alleles X and Xh, whe

Objective of the law of contract, The law of contract is that the branch of...

The law of contract is that the branch of law which determines the circumstances in which promises made by the parities to a contract shall be legally binding on them. Its rules de

Asexual reproduction - its prevalence and significance, Asexual Reproductio...

Asexual Reproduction - Its Prevalence and Significance Having studied the several aspects of asexual reproduction in the non-chordates we can now make a few generalizations.

Causes of mitral regurgitation, Q. Causes of Mitral Regurgitation? Mitr...

Q. Causes of Mitral Regurgitation? Mitral regurgitation is the most common valvular abnormality seen in clinical practice. Different disease processes leading to mitral regurgi

What is dyslipidemia or hyperlipidemia, Q. What is Dyslipidemia or Hyperlip...

Q. What is Dyslipidemia or Hyperlipidemia? It has been known for over five decades now that dyslipidemia is associated with increased severity and prevalence of atherosclerosis

Explain the buccal perforations, Buccal Perforations Buccal concavitie...

Buccal Perforations Buccal concavities in the bone can result in some threads of the implant being exposed. Where these are very circumscribed and covered with thick and well-

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd