Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define gas liquid chromatography, Define Gas liquid chromatography? Thi...

Define Gas liquid chromatography? This is used for separating and identifying volatile compounds of fatty acids, hydrocarbons, sterols, amino acids and lipids, even from nanogr

Determine food sources of riboflavin - water-soluble vitamin, Determine the...

Determine the food sources of riboflavin? The food sources of riboflavin include: 1. Rich sources: Liver, dried yeast, egg powder, milk powder. 2. Good sources: Who

Define titrimetric estimation of carbohydrates, Define Titrimetric Estimati...

Define Titrimetric Estimation of Carbohydrates? The Fehling's Soxhlet method is the commonly used method for titrimetric estimation of carbohydrates. In the following section y

Cnidaria and protozoan, What are the advancement of cnidaria over protozoa

What are the advancement of cnidaria over protozoa

Urine examination of the diabetes patient, Q. Urine Examination of the diab...

Q. Urine Examination of the diabetes Patient? Generally when blood testing facilities are not available, urine is tested for the presence of sugar. A urine sample shows presenc

What are immunoglobulins, Q. What are immunoglobulins? Immunoglobulin i...

Q. What are immunoglobulins? Immunoglobulin is the alternate name given to antibody and Immunoglobulins are complex proteins containing a variable portion and an invariable por

Alimentary canal, how can we make an assignment for the subject alimentary ...

how can we make an assignment for the subject alimentary canal

Micro-organisms, Micro-organisms: The micro-organisms mixed up i...

Micro-organisms: The micro-organisms mixed up in aerobic absorption and their activities are the same as those found in nature. The organic compounds are oxidised to H

Is water a polar molecule or non-polar, Q. Is water a non-polar or a polar ...

Q. Is water a non-polar or a polar molecule? What is the consequence of that characteristic for the function of water as solvent? Water is made of two atoms of hydrogen attache

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd