Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
could you survive on a diet which contain no carbohydrates
Recent molecular analyses indicate that the artiodactyls, which include hippos and camels, are paraphyletic, whereas cetaceans are monophyletic and cetaceans and hippos form a clad
Q. Are the extraembryonic membranes the same in all vertebrates? The presence of each extraembryonic membrane differs according to the vertebrate class. In amphibians and fi
Why do cells of the nephron tubules present a great amount of mitochondria? The cells of the tubule wall have high number of mitochondria because lots of substances are resorbe
outline the process of yeast fermentation stating all enzymes involved
Types of Community On the basis of size and degree of relative independence communities may be divided into two types: i) Major Community: These are large-sized, well org
Onchology : This is the study of cancer. Oncology word meaning is mass, bulk & tumor. This is a branch of medicine which deals with tumors (cancer). The one who practices oncology
Psychology : This is the study of human mind. On other words Psychology is the science of behavior or mental processes. Its immediate aim is to understand the individuals or groups
Q. Is pollution always caused by humans? In the most cases pollution is caused by human activity. Other species and some abiotic factors though can also pollute an ecosystem. F
What are mycorrhizas? How does each participant benefit in this ecological interaction? Mycorrhizas are mutualist ecological interactions among fungi and some plants roots. Fun
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd