Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
The symptoms and signs of endocarditis are often constitutional and, when localized, often result from a complication of IE rather than reflect the intracardiac infection itself. C
what is the effect of insuline in body ?
Define Body Composition - Geriatric Nutrition? After 30 years of age 1-2% decline in lean body mass annually is observed. The total body water, bone mass and lean body mass
Why is the number of bonds important in nucleic acids
After Purchasing The following points should be considered for after purchase facilities. Avail of any training the software engineer or vendor may provide, even if it
Rabies Rabies, a fatal zoonotic viral disease of dogs, cats, man and other mammals, causes an acute encephalomyelitis. The rabies virus belongs to the genus Lyssavirus in the
Radial artery: Carpentier used radial aartc14y us a conduit for CABG in 197 1. He had 30 percent early occlusion of the graft and it was given up. The mail1 problem was radi
Q. Why is carbon monoxide toxic for humans? Hemoglobin "likes" carbon monoxide (CO) much more than it likes oxygen. When there is carbon monoxide in the inhaled air it binds to
What type of colour blindness is most common in men? Red-green colour blindness is the most regular form of colour blindness in men.
Are fruits always the flesh part of the "fruits"? Is the edible part of the onion a fruit? In some so-called fruits the actual fruit is not the flesh part. For instance, the fl
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd