Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is the MN blood system? What is the pattern of genetic inheritance of the MN blood system? A MN blood system is a third (in addition to the ABO and the Rh) system of blood
(i) Area uses or permit exposure to radiation should be Marked' Restricted Area 'or Radiation zone etc. (ii) Avoid x-rays of chest and lower back in routine physic
Why Fish and Sea Foods are important for human Body? They are rich sources of proteins (20-25%) of a high biological value. Dry fishes contain more (60%) proteins since most of
show me the schamatic diagram of chrysomoeba?
sturucture explain
Induction of antimicrobial substances Phytoalexins are antimicrobial substances produced by plants in response to pathogen. They accumulate at the site of infection. For exam
Q. Medical Management of mitral regurgitation? Vasodilator therapy to reduce afterload may be beneficial in patients with chronic mitral regurgitation, but there is no evidence
how many chromosomes in human
While describing normalising selection it was said that in uniform environments selection limits the variability of populations and evolves a genetic homeostasis. The type of selec
Define the Disturbances in Fluid Balance? The correct functioning of cells and tissues depends on appropriate concentrations of nutrients; so any abnormal loss or accumulation
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd