Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Phospholipids exhibit important biological functions. They are: a) increase the rate of fatty acid oxidation b) act as inorganic ion carrier across the membrane c) hel
Water is considered a universal solvent because- Select one: a. it can dissolve polar and non-polar compounds b. it can dissolve both positively and negatively charged ion
Enumerate the term - Clinical neuroscience Clinical neuroscience concerns the study of clinical populations both to well understand neuroanatomy and to test psychological theor
Various cases are now known where variant tissues splice the main RNA transcript of a single gene by instead pathways, where the exons which are lost and those which are
Determine about the term - heterogeneous mixture The solid phase made up of soil and other source material for nutrients, is a heterogeneous mixture. Each nutrient source contr
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
As with food crops, the "discovery, domestication and cultivation" of ornamental plants have a long history. There is indication that lilies were cultivated in China for both medi
Explain what is tooth formula? Ans) Formulae of tooth is (2, 1, 3, 2)
biting mechanism in snakes
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd