Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Enzyme activity, Enzyme Activity Enzymes are biomolecules which catalyz...

Enzyme Activity Enzymes are biomolecules which catalyze (i.e. increase the rates of) chemical reactions. Almost all enzymes are proteins. In enzymatic reactions, the molecules

International organization and zoonoses, International organization and zoo...

International organization and zoonoses In 1962, the Food and Agriculture Organization and the World Health Organization created the Codex Alimentarius Commission (Codex) to e

Explain the term fasb and iasb, Discuss FASB and IASB. Comment on at least ...

Discuss FASB and IASB. Comment on at least two specific aspect of the two standard setting boards and their role in setting accounting.

Palliative care, Despite the technologic advances of recent years, many pat...

Despite the technologic advances of recent years, many patients with chronic heart failure are elderly and have multiple comorbidities. Many of them will not experience meaningful

What are the role of mr, MR means medical representative. Medical rep has t...

MR means medical representative. Medical rep has to sell products of pharma companies or drug manufacturers. He has to go to doctors and medical shops to sell drugs and promote dru

Briefly explain what is the leaf, Briefly explain what is The Leaf? In a ...

Briefly explain what is The Leaf? In a typical dicot, leaf primordia arise from the apical meristem, which is housed within the terminal bud on a shoot. The leaf cells are produc

What is the spontaneous generation hypothesis, What is the spontaneous gene...

What is the spontaneous generation hypothesis? The impulsive generation abiogenesis or hypothesys asserts that life on earth has come from nonliving material. For instance, t

What are zoonotic diseases, Q. What are Zoonotic Diseases? The World He...

Q. What are Zoonotic Diseases? The World Health Organization defines Zoonoses (Zoonosis, sing.) as "Those diseases and infections, which are naturally transmitted between verte

Phototropism, wich variables are controlled when conducting a phototropism ...

wich variables are controlled when conducting a phototropism experiment

Descriibe mechanical ventilation and cardiac performance, Descriibe Mechani...

Descriibe Mechanical Ventilation and Cardiac Performance During spontaneous breathing, the intrathoracic and intrapulmonary pressures are negative, while with mechanical venti

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd