Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Procedure for quantitative determination of viable microbes, Explain for Pr...

Explain for Procedure Quantitative Determination of Viable Microbes? Now carry out the exercise following the steps included herewith: 1. Label the diluent tubes from 10 -1

Complete metamorphosis, Complete Metamorphosis In all Endopterygota i...

Complete Metamorphosis In all Endopterygota insects, where wings and other structures develop internally, (in invaginate imaginal epidermal pockets) such as beetles, wasps, b

What gases was the earths primitive atmosphere, Before the emergence of lif...

Before the emergence of life of what gases was the earth's primitive atmosphere constituted? The earth's primitive atmosphere was basically produced of methane, hydrogen, ammon

Why physiological systems known as integrative systems, Q. What are the phy...

Q. What are the physiological systems known as integrative systems? Why is this designation justified? The integrative systems are the endocrine system and the nervous system.

Illustrate morphological evidence, Q. Illustrate Morphological Evidence? ...

Q. Illustrate Morphological Evidence? Morphology is the study of structure and form of plants and animals usually dealing with the organism and its component organs. Morphologi

Determine energy density of human milk, Determine Energy Density of Human M...

Determine Energy Density of Human Milk? The energy density of human milk depends on the relative proportions of protein, fat and the principal carbohydrate, lactose. Lactose co

Define the agar shake tube method, Define the Agar Shake Tube Method Th...

Define the Agar Shake Tube Method The agar shake tube method is useful for isolation of anaerobic microorganisms. What are anaerobic microorganisms? You may recall the theory c

Conditions associated with increased need for vitamin a, Define Conditions ...

Define Conditions associated with increased need for Vitamin A? Conditions and populations associated with increased need for vitamin A includes young children  particularly  t

Explain denaturation and coagulation, Explain Denaturation and coagulation ...

Explain Denaturation and coagulation Denaturation and coagulation of the proteins are considered to be the chemical changes, since they involve the unfolding of proteins, whic

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd