Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain Osmotic Pressure Osmosis, as you may already know, refers to the flow of solvent into a solution, or from a more dilute solution to a more concentrated solution, when t
Mitral Valve Repair : Whenever possible, the valve has to be repaired rather than replaced. Preoperative investigations and a TEE done on the operating table will help the surg
Explain about the Oesoplzageal Carcinoma? Management of patients with oesophageal carcinoma includes surgery, radiation and combination chemotherapy. Radiation to the lower nec
Q. Explain about Maple Syrup Urine Disease? Maple Syrup Urine Disease (MSUD) is a group of inherited metabolic disorders of three branched chain amino acids (BCAA) namely leuci
FUNCTION S OF POLYSACCHARIDES Chitin is a structural component of fungal cell wall and exoskeleton of insects, crustaceans and some other arthropods. Peptidoglycan o
poor metabolism phenotype will have
Give a short explanation of what UPS really means and why it is so important to health practitioners and consumers/patients.
Person X is a healthy human who has volunteered to take experimental drug Y. Person X has a normal dinner at 6 PM on April 1 and then does not eat for 12 hours. At 5 PM on A
Determine the major foot problem in diabetic patient The American Diabetic Association (ADA) has estimated that 50% of the limbs with foot ulcers can be saved if both the heal
Explain the Recommended Dietary Allowance for nicotinic acid? There are various factors and which niacin requirements depend. These are energy Utilization, body size and dietar
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd