Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
How emulsion are formed The most common method of preparing an emulsion is by mechanically dispersing one liquid phase in another by formation of small droplets. This takes pla
binomial nomenclature
Why are the tropical forests also known as stratified forests? In the tropical forests tall trees of several species have their crowns forming a superior layer under which dive
State the term - neuropsychologists Disorders of speech, language, reading, writing, and mathematical abilities are understood in terms of linguistics and the psychology of lan
Intergenic: Amongs the two genes; for example intergenic DNA is the DNA found amongs two genes. The term is frequently used to mean non-functional DNA (or at least DNA with no kno
Colluvial These are the soils formed from the material transported by the pull of gravity. Fragments from cliffs or steep rocky slopes become dislodged from time to time and ma
What are gonads? What are the male and the female gonads in humans? Gonads are the organs that make gametes. They have the germ cells that undergo division and generate gametes
Explain citric acid cycle In the citric acid cycle, the oxaloacetate is first condensed with acetyl CoA, and then regenerated as the cycle is comp!eted. But these react
Q. Explain about Spring Model ? The spring model depicts elasticity. A force is applied in terms of load onto the spring as illustrated in the figure 8.6. When the force is app
Q. Conditions Necessary for Outbreak of staphylococcal food? The following conditions are necessary for an outbreak of staphylococcal food poisoning: 1. The food must conta
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd