Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Regulation of hmp pathway, Regulation of HMP Pathway The following fact...

Regulation of HMP Pathway The following factors play an important role in regulation of HMP pathway: a)  The first  reaction of this pathway catalysed by glucose-6-phosphate

Dna replication at biochemical level, Although there is much talk in the ne...

Although there is much talk in the news about stem cell research, the public and policymakers need to understand how basic body cells work to transmit information and replicate to

Palliative and corrective procedures for cyanotic congenital, Palliative Pr...

Palliative Procedures   i)  This consists of enlarging the existing for a men ovale by putting a baloon through the defect (baloon septostomy) so that interatrial mixing of blo

Permeability, Permeability Permeability is the ability of a soil to tra...

Permeability Permeability is the ability of a soil to transmit water or air. Permeability or infiltration rate is measured in terms of the rate of water flow through the soil i

Duck plague (duck virus enteritis), Duck plague (duck virus enteritis) ...

Duck plague (duck virus enteritis) Duck plague is the most serious disease caused by a herpes virus (Anatid herpes virus). Though antigenically homogenous, differences in virul

C dna amplification, Steps of C dna amplification 1.  Smart-pcr amplif...

Steps of C dna amplification 1.  Smart-pcr amplification of cdna is the technique which initiates with the change of mrna to cdna utilizing mmlv-rt, mutated in the rnase h dom

How poor selection of food causing the underweight, How Poor Selection of F...

How Poor Selection of Food causing the Underweight? Poor Selection of Food: Poor selection of food along with irregular eating habits may be responsible for insufficient food

Tautomeric shifts, The original DNA sequence when ,transcribed and translat...

The original DNA sequence when ,transcribed and translated would yield five successive valine residues. But the altered sequence would correspondingly read one aspartate and four s

Dna replication, DNA Replication Deoxyribonucleic acid (DNA) is the car...

DNA Replication Deoxyribonucleic acid (DNA) is the carrier of genetic data for all living creatures. An organism's genome, made of DNA, encodes the genetic blueprint for buildi

Define fat needs in nutrient requirement, Define Fat needs in Nutrient Requ...

Define Fat needs in Nutrient Requirement and Dietary Management? As we have learnt earlier on enteral and parenteral feedings; administration of lipids should be carried out ca

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd