Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Protein Synthesis with DNA The central dogma of modern biochemistry is totally based on the coded information holded within deoxyribonucleic acid (DNA). Double stranded DNA is
Q. What structure of the eye produces tears? Lachrymal gland, which is a part of larger lachrymal apparatus, produces tears that flow over anterior surface of the eye. Most of
BASIC PRINCIPLES OF EMERGENCY PSYCHIATRY: Nurses handling psychiatric emergencies should keep the following principles in mind: The initial approach to a clienvpatien
What is biotechnology? Biotechnology is the application of biological knowledge to get new techniques, materials and compounds of pharmaceutical, medical, agrarian, industrial
Exercise- Heat Production During physical activity heat production by exercise can to some extent substitute for heat generated by shivering. However, exercise also tends to
Define the Etiology for Bulimia Nervosa? Bulimia nervosa is a multifaceted disorder with psycologic, physiologic, developmental and cultural components. There may be a genetic
Autogamy - Patterns of Sexual Reproduction It is known to take place in many ciliate protozoans including Paramecium. Autogamy involves same nuclear behavior like in conjugati
Why is the determination of the blood types of the donor and of the recipient important in transfusions? Red blood cells have dissimilar antigens in the outer surface of their
Explain about the freeze drying Method? The Techniques of freeze-drying have been developed over the past half-century for the purpose of preserving certain biological material
Biological Conduits : Freeze dried arterial, bovine MA, human umbilical vein, cryo preserved umbilical vein or artery and omniflow sheep collagen tube grafts also have poor
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd