Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

The effect of light on the growth of stems, The effect of light on the grow...

The effect of light on the growth of stems (a)  Plant some seeds that grow rapidly like as oats, radish, bean or mustard seeds in two flower pots. When the seedlings are about

Autoregulation of coronary blood flow, The ability to maintain myocardial p...

The ability to maintain myocardial perfusion at constant levels in the face of changing driving presence is termed autoregulation. In normal cases, autoregulation is maintained at

Effects of long term malnutrition on adults, Effects of long term malnutrit...

Effects of long term malnutrition on adults In adults, once the stored carbohydrates and fats are used up, the body starts using proteins to generate energy. These protei

Examine multiple variation parameters for a genomic region , Determine SNP ...

Determine SNP variation among the aligned DNAs for a genomic region.   See below for how to count SNP variation.  The output file (Your_name_snp.txt) should have two

Do echinoderms have an excretory system, Q. Do echinoderms have an excretor...

Q. Do echinoderms have an excretory system? How is excretion done in these animals? Echinoderms do not have an excretory system their excretions are eliminated by diffusion.

Developmental biology, a recent topic for my developmental biology assignm...

a recent topic for my developmental biology assignment

Biological diversity of an ecosystem, Q. Is monoculture a system that contr...

Q. Is monoculture a system that contributes to great biological diversity of an ecosystem? The Monoculture implies that in a large area a single crop (only one species of plant

Concept of universality of the genetic code, Q. What is the concept of univ...

Q. What is the concept of universality of the genetic code? What are the exceptions to this universality? The genetic code is universal because the rules of protein codificatio

Define modes or techniques for chromatographic separation, Define Modes or ...

Define Modes or Techniques for Chromatographic Separation In practice, chromatographic separation may take one of these modes or techniques:   Paper chromatography (in w

What is bidirectional superior cavopulmonary shunt, What is Bidirectional S...

What is Bidirectional Superior Cavopulmonary Shunt-Bidirectional Glenn Shunt ? Hospital mortality is between 5 and 10 per cent. Early palliation is very good with arterial sat

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd