Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is a goiter? What is endemic goiter? How this problem is socially solved? Goiter is the abnormal enlargement of the thyroid gland the goiter appears as a tumor in the a
whats ur clear definition of virus
Reducing Pollution - Conservation of wildlife As you already know, pollution of various kinds has affected the survival of living beings, particularly the wildlife in various
EYE HISTOR Y - Steva n described it first. Study of eye is ophthalmology. Instrument used to examine interior of eye is ophthalmoscop e . SHAP E - More o
Mesophytes These plants grow in moist habitats and well-aerated soils. They prefer soil and air of moderate humidity but fail to swive in areas with water-logged soils or oveta
mendal laws
How is the genetic determination of sex established in humans? In the diploid genome of human beings there are 46 chromosomes, 44 of them are autosomes and two are sex chromoso
Define Incision - Endodontic Surgery Incisions are accomplished by using one of four scalpel blades: No. 11, No. 12, No. 15, and No. 15-C Horizontal incision should be m
Degree of dispersion of protein solution is decreased. It is decreased because of certain reasons:- Association: refers to changes occuring at subunit or molecular leve
Define General protection in the Laboratory? You are required to wear a laboratory coat at all times in the laboratory. It is sensible to buy one of good quality and to launder
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd