Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Hormon e . The chief cells of the parathyroids secrete a hormone called parathyroid hormone (PTH) or parathormone or also called Collip's hormone after the name of its discove
Q. Define Lipoprotein Metabolism? Lipoproteins serve to transport absorbed dietary fat and endogenously synthesized cholesterol and triglyceride. Nevertheless, it is possible t
Define Body Composition Assessment Methods - Underwater Weighing? Underwater weighing or hydrostatic weighing is one of the most common body composition methods used in laborat
Q. How are the epithelial tissues classified? The epithelial tissues are classified according to the shape of the cells that form it epithelial cells may be columnar, cuboidal,
All Solid Semi-Solid Wastes Arising From Human And Animals Activities, Except Human Excreta And Sullage (Liquid Wastes From Bathrooms, Kitchens Etc.) are discarded as useless or un
Polyarthritis 1) Gonococcal - Therapeutic trial of pencillin may help in diagnosis of gonococcal infection. 2) Viral infections such as rubella and hepatitis B may have
Based on the simplified two-gene model for eye colour, explain using genotypes how two blue-eyed parents could produce a brown-eyed child. In what ways is genomic imprinting sim
Q. Explain Rodent Control and pests? In any food establishment, varieties of insects, pests and rodents pose a big threat to the maintenance of hygienic surroundings. They
Q. How different are the swimming strategies in chondrichthyes and in osteichthyes? Why do sharks need to agitate their body to swim while bony fishes do not? Bony fishes have
BASICS OF ENVIRONMENT We live in two world one is natural world of animals, plants, air, water and soil that was present since the evolution of earth. The other world is of soc
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd