Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is the life cycle type of bryophytes? As in all plants the life cycle of bryophytes is diplobiontic (alternation of generations). In bryophytes the lasting form is the hap
Systems Theory - Accident Causation The systems theory established extremely strong relationship between system and accident. A properly functioning system may avoid accidents
Neural Circuits The simple all are none activities of a single neuron can hardly provide the adaptability needed for the constant changes faced by the organism in its internal
Define Management and Nutritional Intervention using MNA - Undernutrition? A. For those categorized as well-nourished They need only be reminded of the importance
Explain in details Aerobic Respiration? The pyruvate produced in glycolysis is further broken down in most organisms. This process, called aerobic respiration, requires gaseou
Unacceptable Aesthetics The implant which has successfully integrated with bone may still be a failure if the Prosthesis which it is designed to support does not meet with the
Q. What is the importance of iron in diet? What is the disease caused by iron deficiency? Iron acts as a constituent of the hemoglobin molecule and of enzymes of the energetic
Explain the effect of Non Nutritional Factors pregnancy? The incidence of LBW is lowest and mean birth weight is highest in the state of Kerala, which is attributed to better
how vagina is inserted in cock
A patient has total destruction of all of the beta-islet cells of the pancreas. Prior to receiving treatment, this patient will have A. high blood plasma levels of glucose.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd