Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

How vaginal infections cause, How Vaginal infections cause Sulfonamide ...

How Vaginal infections cause Sulfonamide creams, other ''broad-spectrum'' vaginal preparations, and currently available preparations of Lactobacillus  species or dairy products

Investigation of aortic regurgitation by surgical therapy, Q. Investigation...

Q. Investigation of aortic regurgitation by Surgical Therapy? The recommendation for Aortic valve replacement is only for those patients with Severe AR. If patients with mild A

Explain fungal infections, Fungal Infections Intravenous infusion of am...

Fungal Infections Intravenous infusion of amphotericin B deoxycholate  frequently causes fever and chills, and sometimes headache, nausea, vomiting, hypotension and tachypnea,

Annelids - regeneration in invertebrates, Annelids - Regeneration in Invert...

Annelids - Regeneration in Invertebrates Between the segmented worms both the polychaetes and oligochaetes have remarkable powers of regeneration. Leeches totally lack this ca

What is plutonium reprocessing, What is plutonium reprocessing? Why is it a...

What is plutonium reprocessing? Why is it a big environmental issue? Plutonium is the highly radioactive chemical element produced from uranium by nuclear plants. Plutonium can

Ethylene - dormancy, Ethylene - Dormancy Ripening of fruits involves a...

Ethylene - Dormancy Ripening of fruits involves a chain of cellular events like: Rise in the rate of respiration, Breakdown of higher carbohydrates into carboxylic

Food chain - ecosystem, Food Chain - Ecosystem In a food chain, the fo...

Food Chain - Ecosystem In a food chain, the food energy is transformed from a given source through a series of species, each of which eats the one before itself in the chain.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd