Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Iron deficiency Iron plays an essential role in oxygen transport in the body as a constituent of haemoglobin where nearly 60% of the body iron is found. Apart from oxygen tran
Crustacea The Crustacea show a great morphological diversity of appendages which may be grouped into three categories, cephalic, thoracic and abdominal. Their appendages are c
Pinocytosis: - The ingestion of dissolved materials by endocytosis. The cytoplasmic membrane invaginates and pinches off placing small droplets of fluid in a pinocytic vesi
"Height" is an example of a gene, but "Short" is an example of...
In Drosophila, these genes occur on chromosome 4. H - wild type (normal) h - hairy F - wild type f - frizzled E - wild type e - vest
Q. Role of Carbohydrates in dyslipidemia? It is important to know about these carbohydrates, as they all differ in their digestive properties. The rate of absorption is variabl
Implementation of Nursing Care Provide Bed Rest and Comfort Your major role as a nurse is to provide bed rest to the child and assist the child and parents to understa
Explain Vegetable dehydration It reduces the natural water content below the level critical for the growth of microorganisms (12-15%), without being detrimental to important nu
Q. What is a nutrient? A nutrient is every substance used in the metabolism and which is obtaining from the diet. For example, essential amino acids and vitamins are nutrients.
Q. Is the interphase of mitosis different from the interphase of meiosis? The interphase mitosis that proceeds is similar to the interphase that precedes meiosis. In them the m
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd