Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
How is the respiratory system of beings of the phylum Annelida characterized? Respiration in annelids can be cutaneous or branchial. Cutaneous respiration happens due to the r
The vertebral bodies are much larger in the lower back than the neck. What is the functional significance of this structural difference?
Use the rules of probability to predict the ratios of progeny expected from two parents who are heterozygous for albinism. Note: Albinism is recessive to normal skin color. 1) What
B o v i ne viral diarrhoea Bovine viral diarrhoea (BVD) and mucosal disease (MD) are clinically dissimilar disease syndrome yet have a common viral etiology. The acute dise
Q. What are the consequences of shifting the chemical equilibrium of the formation of bicarbonate from water and carbon dioxide towards the consumption of products of the reverse r
Which of the following are bound to hemoglobin when hemoglobin is in the R-state? Choose all that apply. 1. Fe2+ 2. CO2 3. 2,3-bisphosphoglycerate 4. Fe3+ 5. Oxygen
Q. How different is the growth according to the biotic potential of a viral population from the growth according to the biotic potential of a bacterial population? The growth c
Explain Biochemical investigation Biochemical investigations: These help to reveal nutrients and metabolites in blood and /or urine, and/or faeces that indicate an infectio
What is Stem cell therapy Most defects / diseases treated by stem cell therapy are not genetic in origin so the therapy will have no impact on gene pool in terms of change in f
Q. What are the Yeasts? Like mold, the term "yeast" is commonly used but hard to define. As used here it refers to those fungi which are generally not filamentous but unicellul
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd