Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
how do mature sperm differ from those that are not fully developed
Q. Etiologic factor of diabetes? The precise etiology of diabetes is not known but multiple factors contribute to the disorder. These are reviewed herewith. Type I Diabetes
Q. Is the interphase of mitosis different from the interphase of meiosis? The interphase mitosis that proceeds is similar to the interphase that precedes meiosis. In them the m
Which of the structures are (a) in plant and animal cells, (b) in plant cells but not in animal cells? a) Plant and animal cells having cytoplasm, cell membrane, mitochondria,
At 1 AM, a researcher places a healthy squid giant axon in a bath of normal squid physiological extracellular saline and internally perfuses the axon with normal squid intracellula
An impermeable membrane separates a one liter solution of 1M NaCl in the left compartment from a one liter solution of 2M KCl in the right compartment. At 2 AM the membrane became
a) In what form do plants absorb calcium from the soil? b) List any two calcium deficiency symptoms in plants.
Q. What is the significance of water for enzymatic activity? Enzymes, Biological catalysts, depend on water to reach their substrates and bind to them. There is no enzymatic ac
44+(XXY) is in which syndrome?
Which of the recombination process(transformation, conjugation and transduction) would be most likely to occur in the natural environment?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd