Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What are the major natural plant hormones and what are their respective effects? The major natural plant hormones and their respective functions are the following- Auxins that
Why can crossing of an individual that manifests dominant phenotype with another that manifests recessive phenotype (for the same trait) determine whether the dominant individual i
Intracellular Digestion We all know that unicellular organisms do not have a separate alimentary canal system. All the functions of life are carried out inside a single cell.
character and classification of pigeon
Prophylaxis Many experts recommend that sexually assaulted adults and adolescents be given treatment to prevent sexually transmitted infections, including therapy for gonorrhea
Nudation - Processes in Succession The first step or requirement is the availability of the right kind of habitat, primary succession takes place in a bare area, that is, with
EXCRETION IN HUMAN -
Describe about the Secondary Prevention - Food Allergy? Secondary allergic preventive measures will focus on: Initiating prospective surveillance of infants, young child
Consumers Heterotrophs (other nourishing) are incapable of photosynthesis and depend on organic food derived from animals, plants or both. Consumers can be divided into two br
Which level of a gene, such as the ADH gene and its encoded product should have the highest homology among different species? Explain your answer. A. The genomic DNA sequences o
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd