Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain the Dietary Modifications - Obesity? The dietary modifications serve as a guide for the obese to make healthy food choices. The first step towards prescribing a diet fo
How we write assimgment about mycobiology of mycoplasma in detail
Calculation of Maximum Crop Yield Percent It was pointed out previously that 1 Baule of any growth factor is equal in effect on growth to the effect of 1 Baule of any other fa
Describe 5 ways that a microorganisms directly or indirectly affects our lives.
Q. What do you understand by Haemagglutinins? Haemagglutinins are the globulin type of proteins which are present in the seeds of plants like double bean, field bean, white be
What are the main features of the meristematic cells? Why do these cells require to have a high mitotic rate? Meristematic cells have very thin cell walls, small vacuoles, a w
Aeromonas associated zoonotic disease Aeromonas causes gastrointestinal infections and extra intestinal infections such as cellulitis, wound infectiopn, peritonitis, endocardi
what are the theories of animal classification
What is the typical biological function of the connective tissues? How is this function associated to the main features of its cells? The typical function of the connective tis
what diseases are caused by trypanosoma and entameoba histolytica
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd