Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Consider two species of organisms, species A and species B. Species A has a population in a community. Another population species B arrives into the same community, rather suddenly
Q. Important Herbaria? The herbarium is a place where dried and mounted specimens are stored according to any recognised system of classification. Special attention is paid tow
What is Glands? The central nervous system controls much of the endocrine system through the hypothalamus. The hypothalamus directs many of the body's functions through the "ma
Define the factors effect the Quantity of Human Milk? A large healthy baby who can vigorously suck will induce and obtain much more milk from its mother than a small, sickly or
Cori Cycle Skeletal muscles have some mitochondria, yet are competent of vigorous activity. as a output, the little stores of oxygen are rapidly depleted, causing the muscle ti
A decrease in parasympathetic discharge to the heart leads to A. an increase in the conductance of F-channels in SA node cells. B. a decrease in the conductance of potassium
why they are called protozoa
what is non conventional feed
Q. Define Alcoholic Cardiomyopathy? In a case of dilated cardiomyopathy alcohol cardiomyopathy is suspected if there is history of alcohol intake of 100g/day for more than 10
Define Vitamin and Mineral requirements for preterm and low birth weight? Care to be taken for calcium and phosphorus intake in preterm infant. Due to inefficient sodium conser
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd