Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Respiration in animal, what is respiration in animals ,its functions ,types...

what is respiration in animals ,its functions ,types of respiration

Diet, heating a food sample with Benedict''s solution is a test for...

heating a food sample with Benedict''s solution is a test for...

Describe about the primary prevention - food allergy, Describe about the Pr...

Describe about the Primary Prevention - Food Allergy? Let us further, dwell on measures we could adopt in primary, secondary and tertiary prevention. Current research in primar

Minerals and reproduction, Minerals and reproduction The mechanism of mine...

Minerals and reproduction The mechanism of mineral-reproduction interactions is not fully understood because  of the complexity of neuro-hormonal dialogue. Some minerals act direc

Define the recommended dietary allowances of vitamin k, Define the Recommen...

Define the Recommended Dietary Allowances of Vitamin K? Recommended dietary intakes have not been suggested for different age groups or gentler. The safe levels of intake have

Female reproductive disorders-dystocia, Dystocia Dystocia or difficult...

Dystocia Dystocia or difficult calving is a condition where help is required as providing traction, repositioning of fetus, foetotomy or caesarotomy. Generally, ease of calvin

Explain briefly pinocytosis , Unlike the phagocytosis, that is a regul...

Unlike the phagocytosis, that is a regulated form of endocytosis carried out by a small number of cell category, pinocytosis is a constitutive process which happens continuously in

Diversity, WHAT IS PANDA BAO BAOLOGY.?

WHAT IS PANDA BAO BAOLOGY.?

Translation in eukaryotes, Transcription in eukaryotes, a much more complex...

Transcription in eukaryotes, a much more complex procedure than in prokaryotes. In the eukaryotes, translation and transcription take place in several cellular compartments that ar

Male reproductive system - urethera, URETHRA - It is common duct as ...

URETHRA - It is common duct as sperms & urine both pass from it. It receives juices of prostatic gland & cowper's gland. Urethra is 20 cm long, passes through the peni

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd