Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain about the Adequate Intake (AI)? If sufficient data are not available to establish an EAR and hence RDA, the AI is derived instead. The AI is derived from observations o
In the aerials competition in skiing, the competitors speed down a ramp that slopes sharply upward at the end. The sharp upward slope launches them into the air, where they perform
Over the past decade, the conceptual understanding of heart failure has changed significantly. Several large clinical trials have demonstrated that non-pharmacological and pharmaco
What are the effects of acid precipitation on ecosystems?
Describe Basic steps in genetic engineering
Most proteins made by ribosomes on the RER (rough endoplasmic reticulum) are glycoproteins, which is they hold short chains of carbohydrates (oligosaccharides) covalently related t
Name a system that accomplishes that necessity and explain how that system accomplishes that necessity.
In Reggie's case, he fractured the proximal end of his right femur, an integral component of his hip. Name the joint disorders that Reggie is more a risk of in (a) the short term a
I nclusion body hepatitis (IBH) A disease of chickens characterized by acute mortality, often with severe anemia, is caused by an adenovirus. A number of different serotypes h
Dissolved Gases and Alkalinity Dissolved Gases The marine environment serves as a gigantic reservoir of dissolved oxygen and carbon dioxide, which respectively help reg
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd