Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Determine the viscosity of solutions, Viscosity Viscosity, as you may ...

Viscosity Viscosity, as you may already know, is associated with fluid flow.  It is the internal friction which tends to bring to rest portions of the fluids moving relative to

Glycogenesis, Glycogenesis :   This  is an anabolic process  in which  gluc...

Glycogenesis :   This  is an anabolic process  in which  glucose is polymerized  into glycogen by the   sequence of  reactions.  Since glycogenesis occur  in all  body  cells .but

Iron deficiency anaemia, Iron Deficiency Anaemia   This is the most com...

Iron Deficiency Anaemia   This is the most common nutritional and haematologic disorder  in infancy and chhildhood in developing countries. It is caused by lack of sufficient i

What is aquatic biodiversity, Q. What is aquatic biodiversity? Biodiver...

Q. What is aquatic biodiversity? Biodiversity found on Earth today is the result of 3.5 billion years of evolution. Until the emergence of humans, the Earth supported more biod

Necessity of transport in phloem, Necessity of Transport in Phloem Lea...

Necessity of Transport in Phloem Leaves produce photoassimilates and support various tissues including roots. The excess photoassimilates and metabolites stored in specialised

Define microscopy and physiological analysis, Dr. Herbert discovers a cell ...

Dr. Herbert discovers a cell and he is convinced it is a plant cell. However, as a student of his genetics class, you do not agree with him. You do not believe in microscopy and ph

What is glands, What is Glands? The central nervous system controls muc...

What is Glands? The central nervous system controls much of the endocrine system through the hypothalamus. The hypothalamus directs many of the body's functions through the "ma

Exceptions to the cell theory, Exceptions to the Cell Theory Viruses, ...

Exceptions to the Cell Theory Viruses, however, are not the only exception to the Cell Theory as formulated earlier. This has led scientists to take a much broader view of the

Admission information - nursing, Admission Information   The physician ...

Admission Information   The physician and nurses are the primary source of facts concerning the purpose of therapeutic plan and expected outcome of hospitalization. The informa

Subcellular particle, Name the subcellular particle where the electron tran...

Name the subcellular particle where the electron transport chain is located. Mitochondria is  the subcellular particle where  the electron transport chain is located.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd