Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Shape and size of protiens Fibrous proteins for example: keratin in hair, actin and myosin in muscles, and collagen. Globular proteins, for example enzymes and antibo
Molecular Biology Transgenesis: pro-nuclear injection of isolated gene into fertilised egg cell, cell divides to form embryo, then embryo implanted into surrogate.
Endocrine System In endocrine system ductless gland or specialized cells release chemicals called hormones into the circulating blood. These hormones influence the functions of
Determine the Structure of Enzymes Since all enzymes are proteins, you will realize that knowledge of protein structure is clearly a pre-requisite to any understanding of enzym
Isomerization of dihydroxyacetone phosphate Isomerization of dihydroxyacetone phosphate: Triosephosphate isomerase interconverts dihydroxyacetone phosphate and glyceralde
What are the two main groups into which flowering plants are divided? Angiosperm plants are separated into a) Monocotyledonous (monocots) and b) Dicotyledonous (dicots
Evolution of Photosynthesis and Aerobic Respiration It is assumed that the earlier form of the bacteria utilised H 2 S for the preparation of food. The following reaction shows
What do enzymes do to a reaction? Indicate all that are correct. a. Lower the activation energy b. Reverse the equilibrium c. Lower the equilibrium d. Increase the reac
Soil – plant – animal relationship The plants derive the minerals from soil, and the animals from the plants / feed they consume and there is a dependent interrelationship bet
Q. What are the major morphological differences between monocot plants and dicot plants? The main separation criteria between monocots and dicots are: number of cotyledons (see
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd