Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
How do you prevent food borne infection? Prevention of Food borne infections: Avoid consumption of contaminated foods and water Eat properly cooked foods Wash
Define r and K Strategists? Ecologists have identified two major types of reproductive strategies among species. Characteristic patterns can be seen among species relating the
HYPOTHALAMUS - Hypothalamus develops from the ectoderm of the embryo. Location and Structure. It lies below or inferior to the thalamus. The hypothalamus is connected to t
Q. Engler and Prantl's System of Classification? Adolf Engler, Professor of Botany, University of Berlin, Germany, proposed a phylogenetic system of classification in a book en
State the process of metabotropic receptors Consider a system that contains two neurons and one cardiac SA node cell in a culture dish bathed in normal physiological saline. A
Nursing Assessment Hypospadias can be observed by nurse or parents at birth. The child presents with abnormal pattern of voiding and presence of chordae. The stream of ur
Define colonization of the gut - probiotic effect? It is not clear how probiotics influence the flora and produce a beneficial effect. However, colonization of the gut appears
Impoundments - Lentic Ecosystems We have so far discussed natural lakes. In addition to these there are a number of lakes both small and large artificially created by man cal
Consider the evolution of metabolic pathways. Some biologists believe that these pathways evolved from?
Denaturing Gel is an agarose or the acrylamide gel run under conditions which destroy the secondary or tertiary protein or RNA. For protein, this generally means the inclusion of
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd