Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain why Meat products causes diabetics Diabetics can have meat products in case they eat non-vegetarian food. Baking, roasting or grilling is preferable to frying. Patient
taxonomy research cat
WHAT IS RECAPITULATION THEORY OF EMBRYOLOGY?AND WHAT IS EMBRYOLOGY
Echinococcosis (hydatidosis) Echinococcosis, also called hydatidosis, is a global problem particularly in countries where sheep and cattle raising forms the major animal husba
Describe about the role of plant breeding in crop improvement?
Cell Determination Cell determination is a process through which portions of embryonic genome are selected for expression in particular embryonic cells. Determination to follo
Protoplasmic - Level of body organization Organisms which are made of just one cell are the simplest and the most primitive creatures called unicellular organisms. Their level
Q. What are the lateral lines of fishes? The lateral lines of bony fishes are sense organs that extend along both sides of the animal body they make contact with the environmen
what is a limited resourse needed by all cells?
Q. Why is the concept of a single gene as ultimateunit of inheritance inadequate to provide a unitary explanation for protein synthesis, recombination and mutation? Answer:
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd