Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Texturization Proteins constitute the basis of structures and texture in several foods, whether these come from living tissue (myofibrills in meat or fish) or from fa
Which of the following pairs of functional groups CANNOT react with each other by a dehydration reaction? Select one: a. Carboxyl;Hydroxyl b. Carboxyl;Sulfhydryl c. Pho
Lauric Fats Fats of this group are derived from certain species of palm, such as coconut. The fats are characterized by their high content of lauric acid (40 - 50%), moderate
make a project on heterotrophic nutrition in plants
Diagnosis Clinical signs: In most of the cases in initial stages like bacterial infections there is leucocytosis with neutrophilia, which at later stages of the disease may c
Q. Does pH affect the enzyme activity? The concentrations of hydrogen ions in solution affect the enzyme activity. Each enzyme has utmost efficiency under an optimum p H . S
Define Types of Indicators? Macro indicators are used at strategic levels while micro indicators are used at performance levels. From the previous sections it is clear that man
DNA
Define the Energy Cost of Growth? The energy cost of growth has two components: 1) The energy needed to synthesize growing tissues; and 2) The energy deposited in these tis
What is Tricuspid Atresia: Surgery for Single Ventricle Physiology In tricuspid atresia, the right atrium fails to open into right ventricle through a right atrioventricular va
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd