Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is the typical shape of a population growth curve, Q. What is the typi...

Q. What is the typical shape of a population growth curve? How can the biotic potential be represented in the same way graphically? A usual population growth curve number of in

The control group should be identical, If you have a control group for your...

If you have a control group for your experience, which of the following statements is true? A. The control group should be identical to each test group with the exception of one va

Bacterial motility, What morphological structure is responsible for bacteri...

What morphological structure is responsible for bacterial motility?

Centrosome, structure of centrosome and work

structure of centrosome and work

Diastolic pressure, Palpate the radial or brachial artery pulsation while i...

Palpate the radial or brachial artery pulsation while inflating the cuff to a level of 30 mm Hg above the point at which the brachial or radial artery pulsation disappears. Reinfla

Animal physiology, what are the animals with respiratory organs?

what are the animals with respiratory organs?

How much time is required for a single cell, How much time is required for ...

How much time is required for a single cell of Detoxivicatium completeium to grown into a population large enough to fill the volume of the earth?

Spleen, SPLEEN Largest lymph gland, also with myeloid tissue is an i...

SPLEEN Largest lymph gland, also with myeloid tissue is an important specialized reticuloendothelial organ in vertebrates, as the site of erythropoiesis. Splenic tissue i

Most important allosteric effector of glycolysis in liver, Name the most im...

Name the most important allosteric effector of glycolysis in the liver. Fructose-2,6-bisphosphate  is the most important allosteric effector of glycolysis  in the liver

Male reproductive system - semen, SEMEN - Sperms and secretion of acces...

SEMEN - Sperms and secretion of accesory glands collectively known as seminal fluid or semen. It is milky, semi-solid in nature having particular smell. pH : 7.35 - 7.5. Spe

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd