Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Why does having three color receptors (a.k.a. opsins) lead to a more complex color perception than just two?
what are the role of microbes in human welfare
Q. From which germ layer do the epidermis and the nervous system originate? What are other organs and tissues made from that germ layer? Epidermis and nervous system have the s
what is agar shake method
I need help in pipeline processing in computer architecture.
Why is drosophila a convenient animal for the study of linked genes? The fruit fly drosophila is appropriate for the study of Genetics because it presents many distinct traits
Q. From which germ layer do the liver and the pancreas originate? What are other organs and tissues made from that germ layer? The pancreas and the liver are originated from th
Explain how salivary amylase works on foods like crackers
Q. After digestion the next step is absorption done by cells of the mucous membrane of the intestine. For this task a large absorption surface is an advantage. How is it possible i
HISTORY OF CELL BIOLOGY Scientific knowledge grows with the development of new tools and techniques for studying various physical and biological processes. This is true also of t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd