Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What are the five human digestive secretions, What are the five human diges...

What are the five human digestive secretions? Which of them is the only one that does not contain digestive enzymes? The human digestive secretions such as: saliva, gastric jui

Interpersonal and behavioural psychotherapy, Individual Psychotherapy: ...

Individual Psychotherapy: It is conducted on one  to one basis.  It is effective when a therapeutic rapport develops between patient and  therapist. The common types of  indiv

Eczema and dermatitis, Eczema and Dermatitis: Eczema and Dermatitis ar...

Eczema and Dermatitis: Eczema and Dermatitis are a common problem  all over the world. Their incidence is 2-3  per cent of all medical problems seen  in practice (about 30 per

Direction of flow, Direction of flow--either towards or away from the trans...

Direction of flow--either towards or away from the transducer (positive or negative Doppler shifts). Timing-instantaneous velocity and direction of flow throughout the various

Define barrier layer cells (photocells), Define Barrier layer cells (photoc...

Define Barrier layer cells (photocells) They are the very simple of the detectors. It contains the bottom support layer of conductive metal like iron. A photosensitive layer of

Explain inhibition of cancer cell proliferation and growth, Explain Inhibit...

Explain Inhibition of cancer cell proliferation and growth? Vitamin D diminishes proliferation of abnormal intestinal, lymphatic, mammary and skeletal cells and provides a pote

Identical karyotypes and identical genomes, Q. Can two normal individuals o...

Q. Can two normal individuals of the same species with sexual reproduction have identical karyotypes and identical genomes? And how is the human karyotype usually represented?

Importance of intestinal bacterial synthesis - vitamin k, Define Importance...

Define Importance of Intestinal Bacterial Synthesis as a Source of Vitamin K? Intestinal microflora synthesizes large amounts of menaquinones, which are potentially available a

Movement of body parts, MOVEMENT OF BODY PARTS - Movement of appenda...

MOVEMENT OF BODY PARTS - Movement of appendages bring about locomotion. Perapodia, setae in Annelida, jointed legs in Arthropoda, flat foot in mollusca, tube feat in sta

Illustrate about components of an angioplasty system, Q. Illustrate about C...

Q. Illustrate about Components of an Angioplasty System? 1) Guiding catheter: The ideal guiding catheter must have a lumen diameter i.e. at least twice that of the diagnostic c

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd