Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
in what part of the human body aschelminthes found?
State the definition of Bio-medical waste 'Bio-medical waste' means any solid and/or liquid waste including its container and any intermediate product, which is generated durin
How does Respiration in animals
Chloroplasts Like mitochondria, chloroplasts are also distinctive organelles of eucaryotic cell. But they are found only in plant cells. Chloroplasts contain membranes forming
We are living in an unprecedented age of biological discovery and the application of biological knowledge. Programmed DNA sequencing delivered, in the year of 2001 over the 2.6
Explain in detail about the optic nerve The optic nerve contains more than one million axons that initiate in the ganglion cell layer of the retina. This structure originatcs a
Actinomyces Members of the genus Actinomyces are facultative anerobic, gram-positive, non acid-fast, non-spore forming, nonhaemolytic rods. All Actinomyces require rich media
Which one of the following structures between two adjacent cells is an effective transport pathway? 1. Plasmodesmata 2. Plastoquinones 3. Endoplasmic reticulum 4. Plasm
In the human body, the potassium ion can pass easily through cell membranes, yet the potassium ion concentration is higher inside many cells than it is outside these cells. Could t
Plants of Estuary The plants of the estuary are of four basic types: Phytoplankton, Marginal marsh vegetation, Mud-flat algae and Epiphytic plants
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd