Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Describe in detail about the psychological testing, Describe in detail abou...

Describe in detail about the Psychological Testing Psychological testing is the third source of information about the child, and the source most often equated with neuropsychol

Growth phase -stages in spermatogenesis, Growth Phase -Stages in spermatoge...

Growth Phase -Stages in spermatogenesis Growth phase is characterized by the acquisition of the structural and functional characteristics of distinct sex cells. Also here is a

What is the significance of axial skeleton, What is the significance of Axi...

What is the significance of Axial skeleton? The bones which make up skeleton of the main body axis of vertebrates. It comprise the cranium, vertebral column, and rib cages, How

Photosynthesis and cellular respiration, what cell organelle does photosynt...

what cell organelle does photosynthesis take place in?

Explain the term - muscle contraction headache, Explain the term - Muscle C...

Explain the term - Muscle Contraction Headache This is one of the most common headaches. It is also known as tension or nervous headaches. They result from sustained contractio

Explain heterozygous individual and homozygous individual, What is the ge...

What is the genetic condition in which the heterozygous individual has different phenotype from the homozygous individual? This situation is called lack of dominance and it can

How cells of neoplastic tumors obtain oxygen and nutrients, Q. How do cells...

Q. How do cells of neoplastic tumors obtain oxygen and nutrients and release wastes? In the neoplastic tumors a phenomenon called as angiogenesis occurs. The Angiogenesis is th

Which is the other adnexal gland of the digestive system, Besides the liver...

Besides the liver which is the other adnexal gland of the digestive system that releases substances in the duodenum participating in extracellular digestion? The other adnexal

State the process of rna editing, Which of the following is a true statemen...

Which of the following is a true statement regarding the process of RNA editing? A. RNA editing changes the sequence of the mRNA message thereby permitting for enhance in prote

Guess the number of different haploid cells, A diploid cell contains four p...

A diploid cell contains four pairs of homologous chromosomes designated C1 and C2, M1 and M2, S1 and S2, and W1 and W2. Predict the number of different haploid cells that could be

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd