Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Respiratory system in living organisms, Respiratory System in Living Organi...

Respiratory System in Living Organisms Respiration is a necessary physiological process in all living organisms by which they obtain energy for carrying out all the metabolic

Explain dextrins, Dextrins Dextrins are also polymers of D-glucose held...

Dextrins Dextrins are also polymers of D-glucose held by a(l,4) glycosidic linkages. Dextrins are,  in  fact,  formed due to partial hydrolysis of starch by  enzymes such as sa

Study of food texture, Q. Study of food texture? We learnt earlier that...

Q. Study of food texture? We learnt earlier that texture is observed in terms of tactile sensations i.e. finger feel and mouth feel. Finger feel is sensed before ingestion, by

Define precautions for check the presence of rhodamine b, Define Precaution...

Define Precautions for Check the Presence of Rhodamine B? 1. Sample should be clean and dry. 2. Dispose off the paraffin oil carefully, so that it does not contaminate food/

Guiding and overseeing actions of consciousness, Q. Guiding and overseeing ...

Q. Guiding and overseeing actions of Consciousness? Guiding and overseeing actions: Consciousness connects brain and body states with external occurrences. In order to functio

Procedure for morphological characteristics of yeast cells, Procedure for M...

Procedure for Morphological Characteristics of Yeast Cells? Now carry out the exercise following the steps enumerated herewith: (1) Label the clean, non-greasy slide. Put fe

Osmoregulation in protozoans, Osmoregulation in Protozoans Osmoregulat...

Osmoregulation in Protozoans Osmoregulation or water balance in protozoa is accomplished by contractile vacuoles. One to several contractile vacuoles may be present within the

How to calculate the raw score for each scale, How to calculate the raw sco...

How to calculate the raw score for each scale The raw score for each scale is the sum of the 0, 1 and 2 item scores. Thus, the higher the score, the poorer the performance. Th

Explain gastric bypass - surgical management for obesity, Explain Gastric B...

Explain Gastric Bypass - surgical management for obesity? Surgery is the current 'gold standard' for bariatric surgical procedures. It involves use of a stapling device to crea

How plants classify to photoperiodism-based flowring, How do the plants cla...

How do the plants classify according to their photoperiodism-based flowering? According to their photoperiodism-based the flowering plants classify as long-day plants, those th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd