Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain the bioavailability of nicotinic acid, Explain the Bioavailability ...

Explain the Bioavailability of Nicotinic Acid? We have already learnt earlier that niacin is provided in the diet primarily as the pyridine nucleotides-NAD and NADP. In additio

Orbital shaker, How I can optimize shake flask culture?

How I can optimize shake flask culture?

Why dna ligase is needed to complete the replication, Which of the followin...

Which of the following best defines the reason why DNA ligase is needed to complete the replication of internal chromosomal segments? A. DNA ligase is able to delete the last n

Phases of cell cycle, The cell goes through many discrete phases before and...

The cell goes through many discrete phases before and after cell division. From this understanding, scientists then identified the four characteristic phases of the cell cycle:

Explain the function of myosin and albumin, What are respectively some rema...

What are respectively some remarkable functions of myosin, CD4, albumin, keratin, immunoglobulin, reverse transcriptase, hemoglobin and insulin? Myosin is a protein that when a

Lymphatic obstruction leading to heart failure?, A 62 year old white male d...

A 62 year old white male develops pitting edema of both feet. Put on Lasix and metoprolol. Develops hallucinations and confusion. Tapered off. Dies 3 weeks later of lymphatic o

Signs and symptoms of acute glomerulonephritis, Signs and Symptoms ...

Signs and Symptoms Decreased urine output  Bloody or brown colour urine  Edema Malaise  Mild headache  Gastrointestinal disturbances

Explain vulvovaginal candidiasis, Vulvovaginal candidiasis  Vulvovagina...

Vulvovaginal candidiasis  Vulvovaginal candidiasis is not sexually transmitted, but is often found incidentally in women with STIs. Many remedies are available for vulvovaginal

Proestrus - estrous cycle, Proestrus - Estrous cycle This precedes the...

Proestrus - Estrous cycle This precedes the next heat and is characterised by functional involution of the corpora lutea and preovulatory swelling of the follicles. Fluid coll

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd