Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
While discussing the Darwinian premise of natural selection we observed that the term selection is synonymous with non-random reproduction, and that the success of the survivors is
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Absence of Passive Fit of the Prosthesis A passive fit of the prosthesis reduces long term stresses in the superstructure, implant components and the bone adjacent to the impla
Define the Spatial processes? Environmental and integrative biology cuts across a wide array of spatial scales, and theoretical approaches that take into account these widely v
Stored Metabolites - Seed and Fruit In a large majority of seeds food is stored in the cells of the endosperm. In coconut, wheat and castor bean for example, it is the endospe
Q. How is the ovulation date estimated with the control of the woman's body temperature? One method to estimate the exact ovulation day is daily control of the body temperature
Define Assessment of Chromium Status? No specific tests are currently available, which could help us to determine chromium status. Another reason being the chromium content of
What do carbon chains have in common with a skeletal system?
What is the role of radiographic evaluation in implant treatment? Radiographic examination is very different with implants than with teeth. Radiographs are frequently used in i
Define the Sources of Vitamin E? Vitamin E is present in almost all foodstuffs. It is found in wheat germ, corn, nuts, seeds, olives, spinach, asparagus and other green leafy v
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd