Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
detail study of coelenterata
Drawbacks of Fats and Sweets in diabetics Diabetics should eat less fats and sweets. Fats found in burger, cheese and butter etc. should especially be avoided. Even when a pat
Transport in Phloem The basic necessities of plants, water, are taken up by the roots. Another purpose served by the roots is to absorb water soluble mineral nutrients from th
what is the classification of vertibrates
What is competition? Which type of ecological interaction is competition? Competition is the ecological interaction in which the individuals explore the similar ecological nich
Describe the methods that are used for the isolation and identification of bacteria.(20 marks)
Electron Transport Inhibitors Several compounds, including specific drugs, chemicals and antibiotics have been known to inhibit the electron transfer reactions at specific
Q. Is the upward move of warm air good or bad for the dispersion of pollutants? An upward movement of warm air is a natural method of dispersion of pollutants. The air near the
Types of Cambium On the basis of the arrangement of the Fusiform cells as seen in tangential section, cambium is divided into: A) Storied/Stratified Cambium : The groups o
TYPE S OF LYSOSOMES (1 ) Primary Lysosomes or storage granules or protolysosome - The primary lysosomes are smaller in size, they contain hydrolytic enzyme in the form
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd