Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Digestion of various disaccharides of the diet, Digestion of various disacc...

Digestion of various disaccharides of the diet The enzymes from brush border membrane of small intestine complete the digestion of various disaccharides of the diet and the pro

Explain the health economics, Explain the Health Economics? Health econ...

Explain the Health Economics? Health economics concentrates on application of the principles and rules of economics in the sphere of health. In broad terms, it includes analysi

Define adverse effect - itraconazole, Adverse Effects  The most common ...

Adverse Effects  The most common adverse effects of itraconazole are dose-related nausea and abdominal discomfort. Rash and serious hepatic toxicity can happen. The drug can ca

Which is the brain region responsible for the coordination, Which is the br...

Which is the brain region responsible for the coordination and equilibrium of the body? In the central nervous system the cerebellum is the main controller of the motor coordin

Show six bad listening habits, Discuss six bad listening habits. Which do y...

Discuss six bad listening habits. Which do you think is the biggest challenge for you personally?

Hemicryptophytes - classes of life form, Hemicryptophytes - Classes of Life...

Hemicryptophytes - Classes of Life Form In this case the perennating buds or organs are situated at the soil surface where they are protected by soil and fallen leaves. These

Synthesis of soluble proteins on the surface of lens, How is synthesis of s...

How is synthesis of soluble proteins taking equatorial part on the surface of lens? Synthesis of soluble proteins taking equatorial part on the surface of lens as follows: 1

Phylum labyrinthomorpha - protozoan, Phylum Labyrinthomorpha - Protozoan ...

Phylum Labyrinthomorpha - Protozoan Trophic stage, ectoplasmic network with spindle shaped or spherical nonamoeboid cells. Small group living on algae; mostly marine or estuar

Why do plants need to exchange gases with the environment, Why do plants ne...

Why do plants need to exchange gases with the environment? Plants require to do gas exchange because they create aerobic cellular respiration (like animals) and they need to ge

Crossing over, is crossing over of chromosomes is a method?

is crossing over of chromosomes is a method?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd