Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Enumerate the term - clinical neuroscience, Enumerate the term - Clinical n...

Enumerate the term - Clinical neuroscience Clinical neuroscience concerns the study of clinical populations both to well understand neuroanatomy and to test psychological theor

Why does the ingestion of vegetable fibers improve the bowel, Why does the ...

Why does the ingestion of vegetable fibers improve the bowel habit in people that suffer from hard stools? Some types of plant fibers are not absorbed by the intestine but play

Explain the decolourizing agent - stain technique, Explain the Decolourizin...

Explain the Decolourizing Agent - Stain Technique? 95% ethanol is used as a decolourizing agent. It has two functions - (1) It acts as protein - dehydrating agent, and (2

Causes of air pollution, Causes of Air Pollution We known about the c...

Causes of Air Pollution We known about the composition of atmosphere, its major and minor constituents. The composition of atmosphere has remained the same for thousands of y

Hydration control by active pump mechanisms in corneal, How is hydration co...

How is hydration control by active pump mechanisms responsible in the corneal hydration? Hydration Control by Active Pump Mechanisms: a) Na/K ATPase pump, which is more acti

Phylum porifera, harmful and beneficial usesa of phylum porifera

harmful and beneficial usesa of phylum porifera

Nursing responsibilities while administering immunization, NURSING RESPONSI...

NURSING RESPONSIBILITIES WHILE ADMINISTERING IMMUNIZATION Use one sterile syringe and needle for each injection.  Use only the diluent supplied along with measles and

What is end-to-end anastomosis subclavian flap aortoplasty, What is End-to-...

What is End-to-End Anastomosis with Subclavian Flap Aortoplasty ? The two operations can be combined as a single procedure. Medially end-to-end anastomosis is done between the

Biochemestry, what are peptides and poly peptides hormones

what are peptides and poly peptides hormones

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd