Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Modes of NO - 3 reduction Accordingly, there are the following three basic modes of NO - 3 reduction. Directly dependent upon photosynthesis as in cyanobacter
Tularaemia The disease is known by different names like deer fly fever, rabbit fever, Ohara’s disease or tularensis. It is an acute, febrile, granulomatous infection, caused b
evolutionary effect of Oracle clinical applications in Pharmaceutical industries
How does the vegetal stratification of an ecosystem influence the biological diversity? The vegetal stratification of an ecosystem, as the strata of the Amazon Rainforest, mak
Polysaccharides are vast chains of sugar units joined together. The chains should be branched or linear depending on the polysaccharide. In animals, excess glucose is stored as
Illustrate the theory of Goldman according to corneal transparency. Goldman's Theory: The fibrils are small in relation to light and do not interfere with light transmissi
Group Psychotherapy: Definition Group psychotherapy is a treatment of psychological problem in which two or more patients interact in the present of a psychotherapist.
What is a population? The population is a set of individuals of the same species found in a given place in a given time.
Which of the processes results in the most ATP production within a cell?
Q. What do you mean by Congenital Long QT Syndrome? There is a rare group of young patients who suddenly pass out due to a spontaneous ventricular tachycardia and often have fa
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd