Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Recovery of by-products: coal, Recovery of tar: the coke oven gas coming o...

Recovery of tar: the coke oven gas coming out from ovens is passed through a tower where liquid ammonia is sprayed. The tar and dust are removed and then recovered. Recover of

What is the tympanum, What is the tympanum? In which part of the ear is it ...

What is the tympanum? In which part of the ear is it located and what is its function? The tympanum (or ear drum) is a membrane located in the middle ear just after the auditor

What is emulsion, Emulsions  You may have eaten Mayonnaise. Some  of yo...

Emulsions  You may have eaten Mayonnaise. Some  of you may also know how it is made. Mayonnaise is a liquid in liquid  dispersion, in fact a true  emulsion.  A true emulsion re

Wetlands and estuaries, Wetlands and estuaries are transitional biomes. Lan...

Wetlands and estuaries are transitional biomes. Land that remains flooded either part of the year or permanently with fresh or salt water is known as wetland. The internationally a

Testes (testicles), TESTE S (TESTICLES) - 2 in number (Diarchic). P...

TESTE S (TESTICLES) - 2 in number (Diarchic). Pinkish in colour. Oval shaped. 4-5 cms long, 2.5 cm wide and 3 cm thick. Mesodermal. In embryonic stage attached to kid

What are the classes of lipoproteins in the blood, Q. What are the classes ...

Q. What are the classes of lipoproteins in the blood? Blood lipids (cholesterol, triglycerides and phospholipids) being insoluble in blood need a ship to travel in our body; it

How many asymmetric carbons ribose has, How many asymmetric carbons are the...

How many asymmetric carbons are there in ribose and glucose?

Define methods for determining ph - nutritional biochemistry, Define Method...

Define Methods for determining pH? There are two general methods for determining pH of a solution. One is the colorimetric method and the other most common method is the use of

What is cellulose, What is cellulose? Cellulose is a long-chain polymer...

What is cellulose? Cellulose is a long-chain polymeric polysaccharide carbohydrate, of beta-glucose. It creates the primary structural component of green plants. The primary ce

Explain the chemotherapeautic rinses, Explain the Chemotherapeautic rinses ...

Explain the Chemotherapeautic rinses Chemotherapeautic rinses:  The use of  0.12  per cent chlorhexidine has been proven to be of therapeutic significance in maintaining period

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd