Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain enzymes, Explain Enzymes Enzymes are the proteins that  act  ...

Explain Enzymes Enzymes are the proteins that  act  as  catalysts,  speeding the  rate  at which biochemical reactions proceed but not altering  the direction or nature of th

Energy absorbed by plants to be used in photosynthesis, Q. What is the path...

Q. What is the path followed by the energy absorbed by plants to be used in photosynthesis? The energy source of photosynthesis is the sun, the central and unique star of our p

What is the role of heart in human body, What is the role of heart in human...

What is the role of heart in human body? The heart is the main pump that circulates the blood and fluid within the body. The heart, beats at 72 times per minute, and pumps abou

Define dietary management of cancer patients, Define Dietary Management of ...

Define Dietary Management of Cancer Patients and Feeding Problems Related To Cancer Therapy? We took an overview about the general nutritional requirements of cancer patients.

Explain the determination of nicotinic acid, Determination of Nicotinic aci...

Determination of Nicotinic acid The chemical methods of assay are based on colour reactions of pyridine. Nicotinic acid and nicotinamide are converted by cyanogen bromide into

What is cross contamination, Q. What is cross contamination? Cross cont...

Q. What is cross contamination? Cross contamination is the passage of micro-organisms from one person to another via any route direct or indirect.

Nutritional deficiency, Iron deficiency should be treated with supplemental...

Iron deficiency should be treated with supplemental iron. • Osteoporosis should be treated with calcium and vitamin D supplements. • Depending on individual factors, patien

Pollen tube structure, Pollen Tube Structure The pollen tube in the s...

Pollen Tube Structure The pollen tube in the stigma is filled with cytoplasm containing numerous mitochondria and dictyosomes. The number of dictyosome cisternae is reduced i

Define heterochromatin, Heterochromatin: Compact, gene-poor areas of a gen...

Heterochromatin: Compact, gene-poor areas of a genome, which are enriched in the simple sequence repeats. As it may be impossible to clone, heterochromatin is generally ignored wh

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd