Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain the Bioavailability of Nicotinic Acid? We have already learnt earlier that niacin is provided in the diet primarily as the pyridine nucleotides-NAD and NADP. In additio
Habit and habitat
How I can optimize shake flask culture?
Which of the following best defines the reason why DNA ligase is needed to complete the replication of internal chromosomal segments? A. DNA ligase is able to delete the last n
The cell goes through many discrete phases before and after cell division. From this understanding, scientists then identified the four characteristic phases of the cell cycle:
What are respectively some remarkable functions of myosin, CD4, albumin, keratin, immunoglobulin, reverse transcriptase, hemoglobin and insulin? Myosin is a protein that when a
A 62 year old white male develops pitting edema of both feet. Put on Lasix and metoprolol. Develops hallucinations and confusion. Tapered off. Dies 3 weeks later of lymphatic o
Signs and Symptoms Decreased urine output Bloody or brown colour urine Edema Malaise Mild headache Gastrointestinal disturbances
Vulvovaginal candidiasis Vulvovaginal candidiasis is not sexually transmitted, but is often found incidentally in women with STIs. Many remedies are available for vulvovaginal
Proestrus - Estrous cycle This precedes the next heat and is characterised by functional involution of the corpora lutea and preovulatory swelling of the follicles. Fluid coll
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd