Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Temperature Stress We know that temperature alongwith water is an important influence on the geographical distribution and range of organisms. Every organism is restricted to a
Q. Definition of Osseointegration in microscopic biology? From a view point of macro and microscopic biology and medicine. Osseointegration of a fixture in bone is defined as t
OESOPHAGU S - Gullet opens in oesophagus. First organ of alimentary canal. After piercing diaphragm, it form stomach in abdominal cavity. No digestion in it. Food mov
Why did giraffes develop long necks? 1) Describe an experiment to test this hypothesis. Be explicit about the methods you will use, the setting, the time that the experiment wil
in what aspect are the cnidarians similar to the protozoans?
What are the factors responsible for corneal hydration? The factors responsible for corneal hydration are as follows: i. Stromal swelling pressure ii. Barrier function of
Define Protein as an energy source? Proteins contribute to the body's energy need. If diet does not furnish enough calories from carbohydrates and fats, proteins are catabolize
What is frog central nervous system Consider Neuron B in the frog central nervous system whose plasma membrane has a newly discovered ligand-gated ionotropic receptor, named th
what is surrogate motherhood
#question.why are active cells small .
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd