Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Is fecundation in amphibians internal or external? In this aspect are amphibians evolutionarily proximal to fishes or to reptiles? In the majority of the amphibian species f
Define the effect of niacin deficiency on Nervous System? Delirium is the most common -mental disturbance in acute pellagra. Dementia is more frequently seen in the chronic cas
Structure of plasmodium
Class of Crustacea - Ostracoda Generally called mussel or seed-shrimps, Ostracoda include both fresh water and marine forms. The small crustaceans, computing a few mm have the
Q. Treatment and disposal technologies for health-care waste 1. Incineration 2. Chemical disinfection 3. Wet and dry thermal treatment 4. Microwave irradiation 5. L
Topical Route The medication in topical route is administered through ear, nose and eye. Drops are instilled into the nose, ear and eyes of the child in much the same way
Decomposers - Biotic Components Also known as saprotrophs. Mostly, these are microscopic and are heterotrophic in nature. Decomposer organisms obtain their energy and nutrient
WHAT IS SYMBIOTIC THEORY. PLEASE EXPLAIN THIS TO ME IN A VERY SIMPLE WAY.
What is the hydrogen ion concentration of stomach acid pH=1.6?
Individuals of the following genotype are crossed: aa BB Cc Dd (crossed with) Aa Bb Cc Dd A) How many different phenotypes are possible for the progeny? B) What are the chanc
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd