Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Determine the Food Source for Phosphorus? Phosphorus is widely distributed in food. Food phosphorus is a mixture of both organic and inorganic forms although the relative amoun
Define Applications of Isolated Soybean Proteins in Meat products? The major application of ISP in connection with meat and related products is based on the use of texturized I
THYMU S - It is derived from the endoderm of the embryo. Structur e . The thymus gland is located in the upper part of the thorax near the heart. It is a soft, pinkish, b
What are the main symptoms of the pulmonary and of the intestinal phases of the ascaris infestation? In the pulmonary stage the ascaris infestation causes cough, hemoptysis, dy
write a note on mode of nutrition
Cytoplasmic bridge formed during the conjugation of paramoec: The two paramoecia that undergo conjugation are called conjugants. During conjugation, the two conjugants com
Q. Describe Coronary Spasm? Usually spasm develops at the site of subcritical or critical stenoses, but it may also occur in angiographically normal coronary arteries, the so c
Describe Arteriovenous Continuous Murmur? Arteriovenous Continuous Murmur : These can be congenital as in coronary artery fistula entering RA/RV/PA, sinus of valsalva to rig
what is sunandini
What is polymorphism
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd