Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain nutritional and functional role of calcium, Minerals :- Calcium    ...

Minerals :- Calcium      Food Source      Dairy products, leafy vegetables, tofu, fish bones green Nutritional/Functional role Essential nutrient: Deficiency lead

What happens to the parent cell, What is produced at the end of the cell cy...

What is produced at the end of the cell cycle? how do they compare to each other and to the parent cell? What happens to the parent cell?

Explain normal nutrition - a base of therapeutic diet, Normal nutrition: a ...

Normal nutrition: a base of therapeutic diet Normal nutrition is the foundation upon which the  therapeutic modifications are based. The primary principle of diet nutrition the

Twins, how twins are produced and why

how twins are produced and why

Define placental secretion of oestrogens during pregnancy, Define Placental...

Define Placental secretion of oestrogens During pregnancy? Placental secretion of oestrogens increase with progression of pregnancy. Oestrogens perform many functions. They sti

What are the structures that form the external ear, What are the structures...

What are the structures that form the external ear? What is its function? The internal ear comprises the pinna, or auricle, and the auditory canal. Its function is to conduct t

Explain about coping mechanism, Q. Explain about Coping mechanism? Copi...

Q. Explain about Coping mechanism? Coping mechanism is defined as the skill used to reduce stress. In other words, these are consciously used skills. Overuse of coping mecha

Sporogenous tissue, Sporogenous Tissue The primary sporogenous cells (...

Sporogenous Tissue The primary sporogenous cells (PSCs) result after the periclinal division of the archesporial cells. The PSCs may undergo mitotic divisions and increase in

Explain the five kingdom systems, The five kingdom systems To cope up w...

The five kingdom systems To cope up with above discussed problem a number of alternative classificatory schemes have been suggested with more than two kingdoms. The one which h

Oogenesis., write breif notes on oogenesis

write breif notes on oogenesis

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd