Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Neurosurgery An antistaphylococcal antibiotic can decrease the incidence of infection after craniotomy. In spinal surgery, the infection rate after conventional lumbar discecto
Skin The skin or integument is the outer covering of the body and have appendages i.e. nails and hairs. The outer layer of skin is known as epidermis; the inner layer is dermis
Q. Explain Rodent Control and pests? In any food establishment, varieties of insects, pests and rodents pose a big threat to the maintenance of hygienic surroundings. They
Q. What kind of structure is the crystalline lens? What is its function? The crystalline is a converging spherical lens this natural lens has the function to project images of
Describe the term Humidification Dry gases result in the loss of ciliary activity of the mucosa of the airway and can lead to mucosal damage as well as causing the secretions
Hydrops allantois (Hydro allantois) This condition is uncommonly seen in dairy cattle and buffaloes. Accumulation of excessive allantoic fluid may be progressive after mid ges
A simple osmometer Remove the bottom from a small glass bottle about 2.5 cm in diameter. Fit a one-hole stopper tightly into the bottom and put a 50 cm length of glass tubing o
State in brief about the Zinc It is concerned with the functioning of sulphydryl compounds, such as cysteine, in regulation of redox potential within the cell. Zinc is somet
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Q. What is phosphorylation? What are various biological processes in which phosphorylation plays a critical role? Phosphorylation is the name given to procedure of the addition
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd