Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Meaning of Counselling in diabetes mellitus? The word counselling is a very broad term which is used for helping others to overcome their particular difficulty. It has been
Explain about the Toxicity - fat soluble Vitamin? Because vitamin A is fat-soluble and can be stored, primarily in the liver, routine consumption of large amounts of vitamin A
What else is carried in the plasma? In addition to proteins, plasma having salts (ions), glucose, lipids and amino acids, hormones, carbon dioxide and urea
Explain the Failure to Management of Ledge Apical transportation or perforation: movement of the physiological foramen to a new iatrogenic location. Three types of apical tr
PURPOSES OF ASSESSING GROWTH AND DEVELOPMENT IN CHILDREN Before you assess the growth and development you should be aware of the purpose of monitoring. The purposes are a
Coelomoducts in Polyplacophora In Polyplacophora the coelomoducts divide in the region of coelomostome and the gonadal cavities become closed off from pericardial coelom. The
What is the connection between tissue fluid, plasma and lymph? Tissue fluid is plasma (minus its proteins) which has leaked out of the capillaries. Lymph is tissue fluid which
MECHANIS M OF FERTILIZATION - The process of fertilization complete into 5 steps - 1 . APPROACH OF SPERM TO OVUM For fertilization sperm & ova interaction is
Q. What is an open circulatory system? Open circulatory system is the one in which blood doesn't circulate only inside blood vessels but it also falls in cavities that irrigate
Barker’s in Utero Hypothesis The developmental origins of adult disease, often called as the ‘Barker hypothesis’ states that adverse influences early in development, particula
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd