Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain the Minimum Requirement of nutritional needs? Minimum nutrient requirement is defined as the 'lowest amount of the nutrient ji-om the diet that will prevent clinically
Define Etiology and Clinical Features that causes neurological disorder? The cause of this neurological disorder can be mechanical or paralytic. The mechanical cause is primari
Histone methyl transferases (HMTs) having a protein domain called SET. This domain is responsible to adding methyl groups to histones. Which of the following is a false statement r
All of the following make meiosis different from mitosis, EXCEPT A. Meiosis comprises two separate divisions. B. Meiosis only occurs during embryonic development. C. Chromosome num
Q What are the few examples of arthropods? Ants, crabs, cockroaches, shrimps, flies, spiders and scorpions are examples of arthropods.
Q. How can the binding of two amino acids for the peptide formation be explained? A peptide is formed when a carbon from the carboxyl group of one amino acid is connected to th
Define the Dietary Management for Underweight? We just read about the etiological factors that may lead to undernutritioin and weight loss. Whatever may be the cause, all under
Explain the Nutritional Management of Eating Disorders? Good nutritional management of patients with eating disorders requires attention to a number of areas. It is important t
Define Functions of Manganese? Like other micro minerals, Mn also functions in mammalian enzyme systems. It can function both as an integral part of metalloenzymes and as an en
Interactions between minerals Copper deficiency has been identified as a serious problem for grazing ruminants. A deficiency may be due to low concentrations of Cu in forage a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd