Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What benefits can commensalism offer to a species, Q. What benefits can com...

Q. What benefits can commensalism offer to a species? The Commensalism may involve obtainment of food (for instance, the innocuous bacteria of the human gut), shelter or suppor

Explain in detail about male reproductive system, Explain in detail about M...

Explain in detail about Male Reproductive System The male reproductive organ consists of the following:  A pair of testes, held in scortum; produces spermatooa and testoster

When should eat a salad with lettuce, When you eat a salad with lettuce, cr...

When you eat a salad with lettuce, croutons, hard-boiled egg, bacon bits, and salad dressing, which one of those ingredients will be broken down the least by your digestive system?

Explain complex or undefined media, Explain Complex or Undefined Media? ...

Explain Complex or Undefined Media? Here, the exact composition of the medium is not known. It contains some complex components of plant and animal extracts whose exact chemica

Significance of apomixis, Significance of Apomixis Apomixis offers th...

Significance of Apomixis Apomixis offers the possibility of indefinite multiplication of especially favorable biotypes without any variation due to segregation or recombinati

What is the function of lh in the menstrual cycle, What is the relationship...

What is the relationship between the estrogen level and the LH level in the menstrual cycle? What is the function of LH in the menstrual cycle and when does its blood concentration

What are deciduous trees, What are deciduous trees? Deciduous trees are...

What are deciduous trees? Deciduous trees are plants that lose their leaves in a period of the year. In the case of the deciduous trees of the temperate forest the fall of the

Lateral roots - root apex, Lateral Roots - Root Apex Lateral roots no...

Lateral Roots - Root Apex Lateral roots normally arise at a definite distance behind the tip from areas close to or opposite the points of xylem star. So, a triarch root can

Explain the sub-culturing, Explain the Sub-Culturing? Microbiological s...

Explain the Sub-Culturing? Microbiological studies require microorganisms in pure form, i.e., a single type of microorganisms should be present in a culture. Maintenance of the

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd