Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Monkeey Opsin Evolution, Why does having three color receptors (a.k.a. opsi...

Why does having three color receptors (a.k.a. opsins) lead to a more complex color perception than just two?

From which germ layer epidermis and nervous system originate, Q. From which...

Q. From which germ layer do the epidermis and the nervous system originate? What are other organs and tissues made from that germ layer? Epidermis and nervous system have the s

Computer architecture help required, I need help in pipeline processing in ...

I need help in pipeline processing in computer architecture.

Why is drosophila a convenient animal study of linked genes, Why is drosoph...

Why is drosophila a convenient animal for the study of linked genes? The fruit fly drosophila is appropriate for the study of Genetics because it presents many distinct traits

Which germ layer originate liver and the pancreas, Q. From which germ layer...

Q. From which germ layer do the liver and the pancreas originate? What are other organs and tissues made from that germ layer? The pancreas and the liver are originated from th

Salivary analyse works on foods, Explain how salivary amylase works on food...

Explain how salivary amylase works on foods like crackers

Organism to present a large intestinal surface, Q. After digestion the next...

Q. After digestion the next step is absorption done by cells of the mucous membrane of the intestine. For this task a large absorption surface is an advantage. How is it possible i

History of cell biology, HISTORY OF CELL BIOLOGY Scientific knowledge gro...

HISTORY OF CELL BIOLOGY Scientific knowledge grows with the development of new tools and techniques for studying various physical and biological processes. This is true also of t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd