Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Planning the Nursing Care Provide preoperative and post operative nursing care to child Assist in therapeutic management of child. Provide comfort. S
Unsaturated fatty acids show different types of isomerisms. We have already learnt about the.concept of isomerism in the last unit. You would realize that fatty acids with s
Dyslipidemia is an important correctable factor for Coronary Artery Disease. There is a strong, independent, continuous, and graded relation between total cholesterol (TC) or low-
Factors affecting lipid oxidation Temperature In general, the rate of oxidation increases as the temperature is increased. Temperature also influences the relation betw
Explain Non-Glycerides in Edible Oils? You may be aware of the fact that the glyceride fraction (an ester of glycerol and fatty acids that occurs naturally as fats and fatty oi
Give two examples of chemical reactions which are catalysed by enzymes in the course of brewing. In the course of brewing, enzymes in the grain catalyse the conversion of star
Nucellus - Seed In a large majority of flowering plants the nucellus is gradually utilized by the endosperm or embryo. In leguminous seeds, for example, the nucellus degenerat
What is pollen? Pollen grains are the male gametophytes of the phanerogamic (flowering) plants. Thus within the pollen grains the male gametes of these plants are produced by m
Determine fat-soluble vitamins Recommended for Infant? ICMR (1990) does not give recommendations for vitamins D, E and K. As you already know, vitamin D is expected to be met
Q. What is Atherosclerosis? Atherosclerosis is an arterial lesion characterized by patchy thickening of the intima (innermost coal of artery) comprising of fat and layers of co
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd