Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
taxonomy of phylum echinodermata
THE PHYSIOLOGY OF LACTATION
Explain about the Connecting models and data? Perhaps the most dramatic change in quantitative environmental biology in recent years has been the burgeoning progress in the dir
Q. Do sponges have circulatory, nervous and excretory systems? Sponges do not have a nervous system neither excretory system nor circulatory system.
Autoradiography is the process to detect radioactively labeled molecules (which commonly have been separated in an SDS-PAGE or agarose gel) based on their ability to develop an im
How Age affects the BMR? The BMR per unit weight also varies with age, being higher in children and lower in the elderly. The loss of FFM with ageing is associated with a decli
Q. Explain about Myocardial Infarction? It is an initial acute phase of cardiovascular disease caused by the blockage of a coronary artery supplying blood to the. Heart shows t
Q. What are the three major types of RNA? What is meant by heterogeneous RNA? Messenger RNA, or mRNA, transfer RNA, or tRNA, and ribosomal RNA, or rRNA, are the three main type
what is the modes of reproduction
Q. How different are fecundation in chondrichthyes and in osteichthyes? In chondrichthyes fecundation is internal by resources of copulation. In osteichthyes fecundation genera
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd