Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Show the Signs and symptoms of implant failure? Signs and symptoms of implant failure are : 1. Horizontal mobility beyond 0.5 mm or any clinically observed vertical move
Platinum color in foxes is produced by heterozygous genotype Ss, and silver foxes are the genotype SS. The genotype ss is lethal, and the fox dies in early embryonic development. I
Q. Why is AIDS difficult to prevent by vaccination? It is not easy to produce a vaccine against AIDS because the HIV is a highly mutant virus. In approximately every replicatio
Determine Water-soluble vitamins needs of school children and adolescents? The suggested requirements are given in Table 15.2 (ICMR 1990). Thiamine is computed as 0.5 mg/1000 K
Determine the term -Stolon. In a number of colonial cnidarians, ascidians, and lophophorans, a cord of tissue connects different zooids of colony to each other. Buds on stolon
Q. What do you mean by Hypertension? Hypertension is one of the major risk factors for cardiovascular disease. It is the most common public health problem and often referred to
Explain the Faecal Coliforms - Microbiological Study of Water? The faecal coliforms include a wide range of bacteria, many of which are not primarily the intestinal bacteria. T
Placenta - Human Development We had said previous in the unit that in the second week of development a primitive uteroplacental circulation is established. Early in this stage
Rehabilitation Phase for nutritional treatment - Neuro Trauma? Once the patient stabilizes and starts recovering, be sides nutritional replacement, there is a need to assess fu
ARM BONES - Each arm contain 30 bones as : humerus in upper arm, radius ulna in forearm, 8 carples in wrist, 5 metacorples in plam, 14 phalnges in fingers. HUMERU
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd