Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
In humans, maleness or femaleness is determined by a pair of sex chromosomes called X and Y. (a) What is the genotype for males? (b) What is the genot
Q. Describe the phylogenetic system of classification? 1) Hutchinson believed in Monophyletic origin of Angiosperms from a hypothetical group, which he' named, as Proangiosperm
Which type of genetic disease can be identified from the visual analysis of the number of chromosomes present in a karyotype? The counting and the identification of chromosomes
Ultrasonography: Ultrasounds are sound waves with a frequency of higher than the upper range of human hearing i.e., approximately 20,000 cycles per second (20 kilohertz).
Describe the theory of Darwin's? Most scientists today accept the theory that living organisms have evolved according to the concept that was first proposed by Charles Darwin i
In 1809, Maggiolo described a process of fabricating and inserting gold roots into freshly extracted sockets. The implant was constructed from the three pieces of gold which were s
Non-viral vectors Viral vectors are highly efficient but when it comes to large scale production at the commercial level, non-viral serve as a better choice. These methods p
what is Cytokinesis in cell reproduction? Cytokinesis: Mitosis is usually followed by cytokinesis, the division of the cytoplasm and cell membrane. Cellular organelles are no
The first step should be to determine the status of dehydration. We have already talked about the mild, inoderate and severe dehydration. In mild to moderate cases fluid, electroly
Diagnosis of diabetes mellitus which included history taking, symptoms and signs and various tests which can be done to diagnose a case of diabetes. Diabetes Mellitus (DM) or diabe
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd