Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Submission of evidence items to the forensic laboratory requires that a specific "Evidence Submission Request Form" be completed. What information should be included on the form?
Starch gelatinization Undamaged starch granules are insoluble in cold water but can imbibe water reversibly i.e. they can swell slightly and then return to their original siz
Hypothermia : Hypothermia reduces the metabolic requirements of the body thereby reducing oxygen consumption. It also preserves high-energy phosphate stores of the body. At norma
Hypothermia As the blood passes through the oxygenator, hypothermia machine allows the blood to cool to the required temperature. Generally, the temperature is brought dow
Name the alloys which are commonly used The most commonly used alloys are Ti-6Al-4V and Ti-6Al-4V extra low interstitial (ELI). Commercially pure Titanium comes in different gr
what is atp explain in detail?
Q- fever Q-fever or query fever is primarily a disease of animals transmitted to human through inhalation. It is also known as Balkan influenza, Abattoir fever or Coxiellosis. It
Explain the Secondary structure of proteins The secondary structure of a protein involves the way that the chain of amino acid either twists or folds back upon itself to form a
Explain Monascus species Most of the reports of food colourants from microbial sources involve Monascus species, particularly Monascus purpureus, followed by Rhodotorula speci
What are the final digestion products of (a) protein, (b) fat, (c) starch? a) Proteins are digested to amino acids, b) fats are digested to fatty acids and glycerol,
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd