Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
S c inti g r ap h y or nuclear medicine: Scintigraphy was introduced in veterinary medicine in 1970s. It is highly sensitive and can detect bone dama
Q. Why is it said that during photosynthesis carbon dioxide is improved to form glucose? During photosynthesis carbon dioxide is energetically improve with hydrogen from water.
ENZYME INHIBITION Enzymes are often inhibited by the presence of suitable inhibitors. Much of current drug therapy is based on this. Basically, there are three major cla
Q. Bacteria - type of microorganisms? Many of us know bacteria only as "germs," invisible to naked eyes that can invade our bodies and make us sick. Few know that many bacteria
QUESTIONS: Write an analysis of the Chapter Twelve, the concluding chapter in ROLL AWAY THE STONE. It will be worth UP TO 50 points if you do it well. Submit it through the "Ex
Functional Properties of Starches Starch is a major source of energy (calories) in grains and tubers, and foods made from them. However, when starch is added to products as an
GROWT H CURVES - S-shaped or sigmoid - Described by Verhuhst in 1839. It shows 5 phases - (i) Lag phase (ii) Positive acceleration phase (iii) Exponent
Examples of cloning and molecular biology cloning may produce heterozygous individuals (as mother was heterozygous) and suggests a way to get pure breeding cats molecu
Explain Rectangular Full Mucoperiosteal Flaps - Endodontic Surgery a. Releasing and relaxing "vertical" incisions, with the Horizontal incision, b. Causes re
How are genetic diseases classified? The Genetic diseases classify into chromosomal abnormalities and genetic mutations. Between chromosomal abnormalities there are the aneu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd