Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
what is respiration in animals ,its functions ,types of respiration
heating a food sample with Benedict''s solution is a test for...
Describe about the Primary Prevention - Food Allergy? Let us further, dwell on measures we could adopt in primary, secondary and tertiary prevention. Current research in primar
Minerals and reproduction The mechanism of mineral-reproduction interactions is not fully understood because of the complexity of neuro-hormonal dialogue. Some minerals act direc
Define the Recommended Dietary Allowances of Vitamin K? Recommended dietary intakes have not been suggested for different age groups or gentler. The safe levels of intake have
Dystocia Dystocia or difficult calving is a condition where help is required as providing traction, repositioning of fetus, foetotomy or caesarotomy. Generally, ease of calvin
Unlike the phagocytosis, that is a regulated form of endocytosis carried out by a small number of cell category, pinocytosis is a constitutive process which happens continuously in
WHAT IS PANDA BAO BAOLOGY.?
Transcription in eukaryotes, a much more complex procedure than in prokaryotes. In the eukaryotes, translation and transcription take place in several cellular compartments that ar
URETHRA - It is common duct as sperms & urine both pass from it. It receives juices of prostatic gland & cowper's gland. Urethra is 20 cm long, passes through the peni
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd