Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain ancient greeks and romans - plant classification, Explain History o...

Explain History of Plant Classification - Ancient Greeks and Romans? Hippocrates, "The Father of Medicine" (460-377 B.C.) is reputed to have been one of Democritus 's disciples

Are the xylem and the phloem made of living cells, Are the xylem and the ph...

Are the xylem and the phloem made of living cells? The cells that constitute the xylem ducts are dead cells killed by lignin deposition. The cells of the phloem are living

Bovine spongiform encephalopathy (bse), B o vi n e spongiform encephalo...

B o vi n e spongiform encephalopathy (BSE) Bovine spongiform encephalopathy (BSE) is a transmissible, neurodegenerative, fatal brain disease of cattle characterized by post

In the phase when the cell is not dividing interphase, Q. In the phase when...

Q. In the phase when the cell is not dividing interphase is there activity within the cell nucleus? In the interphase there is intense metabolic activity in the cell nucleus th

Agro industrial-potassium, Potassium Potassium, the third most abundan...

Potassium Potassium, the third most abundant mineral in the body, is the major cation in intracellular fluid. Forages are excellent source of potassium, usually containing 1 t

Define the dietary sources and chemical forms, Define the Dietary Sources a...

Define the Dietary Sources and Chemical Forms? Isoflavones and coumestans are the most common compounds. Soybeans and soyfoods are the most important sources, containing approx

What is a population, Q. What is a population? In the Biology a populat...

Q. What is a population? In the Biology a population is a set of individuals of the same species living in a given place and in a given time.

What are the main human diseases caused by virus, What are the main human d...

What are the main human diseases caused by virus? Between diseases caused by virus are common cold, flu, mumps, variola (considered eradicated nowadays), rubella, AIDS, measles

Phylum Coelenterata, What are the classes in Phylum coelenterata?

What are the classes in Phylum coelenterata?

Hormones secreted by parathyroid gland, Hormon e . The chief cells of the ...

Hormon e . The chief cells of the parathyroids secrete a hormone called parathyroid hormone (PTH) or parathormone or also called Collip's hormone after the name of its discove

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd