Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Feeding management Feeding management deals about the in-house management in which the feed consumption pattern is well understood in the sheds and suitable alterations are made
During mitotic anaphase is there separation of homologous chromosomes or separation of identical chromatids? In the anaphase of mitosis the identical chromatids separate and co
What is the main means by which autotrophic beings obtain energy? The major means by which autotrophs obtain energy is photosynthesis (There are also chemosynthetic autotrophs)
mode of action of wbcs types
Q.Explain Chemical changes due to spoilage A food item may have apparently looked safe and wholesome for you to eat, but the rumbling and grumbling in your stomach at night may
Define requirements of Vitamin A for infants? As for vitamin A deficiency, requirement of vitamin A is the most easy to meet as it is abundantly present in green and yellow veg
Define Needle selection for Suturing 1. Needle with a reverse cutting edge "the cutting edge is outside the curve" is preferable, because it prevents tearing, 2. Conventiona
Phosphorylation of glucose Glucose is converted to glucose-6-phosphate since phosphorylated intermediates do not readily penetrate cell membrane and this commits glucose t
Q. Where does most of the water resorbed after glomerular filtration go? What are the other substances resorbed by the nephron tubules? Only 0.5 to 1% of the glomerular filtrat
Define Observation or Inference for fehling's test? An insoluble reddish brown precipitate of cuprous oxide will be obtained. The reddish brown precipitate indicates the presen
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd