Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is the taxonomy of protozoa?
Q. What are the main biological functions of water? Water is the basic solvent for chemical reactions of living beings; it is the main means of substance transportation in the
Phosphorylation of glucose Glucose is converted to glucose-6-phosphate since phosphorylated intermediates do not readily penetrate cell membrane and this commits glucose t
Q. What is the structure of the central nervous system that regulates pulmonary respiration? The reaction is catalyzed by the enzyme carbonic anhydrase present in red blood cel
Explain Protein Deficiencies in Nutritional Care? A depleted amino acid pool leads to poor wound healing (dehiscence), delayed healing of fractures, anaemia, depressed pulmonar
Define Measuring Direct Aerobic Fitness (VO 2 max) For direct measurement of VO, max, the subject is asked to perform exercise for 12 to 15 minutes. A stationary bicycle or a
Biological Responses Controlled by Phytochrome Phytochrome responses are those which are controlled reversibly by red and far-red light. These can be broadly categorised as:
Describe PS with VSD in Tetralogy of Fallot's ? This group is also known as Tetralogy of Fallot's physiology. The classic example is Fallot's tetralogy characterized by: (1) Se
State the Lantern Test The patient names colours displayed in the lantern and the mistakes are analyzed. This is not the best method of testing because it depends on the natu
Define tracheal system in details. Respiratory system found in insects and some spiders where air passes directly to the tissues through a series of tubules. Since oxygen tran
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd