Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Difference between hemoglobin and oxyhemoglobin, Q. How different are hemog...

Q. How different are hemoglobin and oxyhemoglobin? Where is it expected to find a higher concentration of oxyhemoglobin, in peripheral tissues or in the lungs? Oxygen-bou

How antigen react against future infection by same agent, Q. How can an org...

Q. How can an organism that once underwent contact with an antigen be immunized against future infections by the same agent? This phenomenon is called as immune memory when an

1408 final exam Eastfield University, I need the Answers for the final exam...

I need the Answers for the final exam for biology it''s a one hundred question test if you can help i would appreciate it

What is splitin first heart sound, What is Splitin first heart sound ? ...

What is Splitin first heart sound ? In complete RBBB, due to delay of tricuspid closure, the split is wide. In complete LBBB, due to delay of mitral closure the S I is single.

Role of fat or lipids in metabolism, ROLE OF FAT OR LIPIDS - Made up...

ROLE OF FAT OR LIPIDS - Made up of fatty acids & glycerol. Linked by ester bond. Maximum quantity of energy is librated. Helpful in temperature regulation. As stored f

What do you meant by medical transcriptionist, Question 1: Describe the...

Question 1: Describe the process of hearing. The ear consists of three basic parts - the outer ear, the middle ear, and the inner ear. Discuss the process of hearing

Give an account of attenuated vaccines, Question 1 Write short note on ...

Question 1 Write short note on inflammatory response 2 Give an account of attenuated vaccines 3 What is innate immunity? Explain its characteristic features 4 What adjuvants? E

Explain tb in pregnancy, TB in pregnancy Treatment of TB should be init...

TB in pregnancy Treatment of TB should be initiated in pregnancy when there is moderate to high suspicion of disease because active infection during pregnancy poses a risk to t

hormonal control of osmoregulation, This process involves the regulation o...

This process involves the regulation of the concentration of the body fluids through control of water content and salt content of the blood. If a person loses water from their bloo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd