Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Each of the three NADH molecules formed per turn of the cycle yields 3 ATPs and the one FADH2 yields 2 ATPs by oxidative phosphorylation (whereas some measurements indicate in whic
In chemistry and particularly in biochemistry the fatty acid is a carboxylic acid with a long aliphatic tail (chain) that is either saturated / unsaturated. Many obviously occurrin
What are some things that have algae in them? Yeast is considered Algae.
Define Essentiality of Nitrogen for Growth of Micro-Organism? Nitrogen is an essential atom in certain cellular macromolecules, e.g. amino acids, purines, pyrimidines, enzymes,
What are the processes involved in the preparation of plant tissue for free hand sectioning?
Health Hazards with poor management of Bio-medical waste Health hazards associated with poor management of Bio-medical waste are: - Injury from sharps to staff and waste han
feeding habit of branchiostoma?
What Food items include in clear liquid diet - Clear, fat free soups/broths - Light coffee, tea (without milk or cream) - Strained fruit juices - Tender coconut wa
To be in good health, we need to take food. Energy is provided by food to carry out activities in day to day life. In the same way, a diabetic patient also needs healthy food for e
Explain Regulation of Water Balance for Cells in the kidneys? Cells in the kidneys respond to low blood pressure by releasing an enzyme called renin, which in turn causes the k
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd