Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What are the typical vegetation and the typical fauna of the temperate forests? In the temperate forest deciduous trees predominate. Mammals are originated in great number, as
Enumerate about the colour vision defects Acquired colour vision defects can occur afkr damage to the optic nerve or macula and in some cases, because of blue blindness in old
Timing and number of doses It has been common practice to give antibiotics at the time of anesthesia induction, which results in adequate serum and tissue levels of the drugs;
Describe how you would prepare 200 ML of a 0.25 Msoluation of NaOH from a 3 M stock solution?
Vertebrate Eye - Adult Eye There are no main differences in the structure or composition of the eyes among different vertebrates. This should be clear to you from the diagram
how is the heart initiated for its function
Historically how has the origin of life on earth been explained? The mainly recurrent explanation for the phenomenon of life on earth is the mythological. The People from vario
Explain the several terms ATP, NAD, and FAD ? Adenosine Triphosphate (ATP) is an ester, an organic compound formed from a reaction between carboxylic acid and an alcohol. ATP i
State the types of brain trauma? There are two main types of brain trauma a) open head injury and b) closed head injury
Q. How many chromosomes does a human normal diploid cell have? How many chromosomes does a human normal haploid cell have? How many are the sex chromosomes within each of them?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd