Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Plants - Slow Moving Waters Plant life is abundant in this habitat and includes rooted vascular plants such as pond weeds and grasses, firmly attached aquatic mosses and multi
WHAT IS IMPORTANT VALUE INDEX OF PLANT
can u show the different activities on the topic
Q. Can you explain Secondary Metabolites? Secondary metabolites or secondary plant products are those macromolecules that lack nitrogen and arc of restricted occurrence and the
Materials Handling and Storage Material handling is a very significant process in working place. The materials are handled in not finished, semi finished and finished states.
Explain Risk Assessment Risk Assessment : The scientific evaluation of known or potential adverse health effects resulting from human exposure to food borne hazards
Define the role of riboflavin in Drug and lipid metabolism? Flavoproteins catalyze dehydrogenation reactions, as well as, hydroxylations, oxidative decarobxylations, deoxygenat
Distribution Coefficient - Terminologies used in Chromatography? During the purification or separation of the biomolecules it should be kept in mind that two important factors
Studying leaf arrangements Observe as many growing plants as possible by looking down on them from above. Draw sketches of the dissimilar patterns of leaf arrangement.
Changes in the conformation of molecules - Qualitative Changes You may recall that linear chain of amino acids of a protein folds into a characteristic structure. Acidic resid
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd