Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Where is the patient most likely to experience, The most recent blood work ...

The most recent blood work of a patient with a diagnosis of acute myelogenous leukemia (AML) reveals thrombocytopenia. Where is the patient most likely to experience abnormal bleed

Epithelial cells of the kidney proximal tubule, Which of the following is t...

Which of the following is true for the epithelial cells of the kidney proximal tubule? A. The sodium-glucose co-transporter in the luminal membrane is responsible for the net f

Describe about human eye and how it is working., The human eye is an organ ...

The human eye is an organ which reacts to light for various purposes. As a conscious sense organ, the mammalian eye permits vision. Cone and Rod cells in the retina allow conscious

Define the maintenance of weight loss, Define the Maintenance of Weight Los...

Define the Maintenance of Weight Loss? Once an individual has managed to lose weight to a desirable level, it must not be assumed that the weight loss will be maintained automa

Centrolecithal egg, which type of cleavage takes place in centrolecithal eg...

which type of cleavage takes place in centrolecithal egg

List a few applications of starches in the food industry, List a few applic...

List a few applications of starches in the food industry. A few applications of starches in the foods industry include thickener, a fat sparing agent, adhesive, binder,

Types of fertilization, TYPES OF FERTILIZATION - On the basis of site o...

TYPES OF FERTILIZATION - On the basis of site of fertilization, it is of two types - 1. External fertilization        2. Internal fertilization 1 .       EXTERNAL FERTILIZ

Mollusca, family ,genus, class order , species of mollusca

family ,genus, class order , species of mollusca

What is mean by stability study, Stability studies are req. for the product...

Stability studies are req. for the product stable at their desire time as per specification , which give the expiry date and quality as per the manner.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd