Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What happens to respiratory system in a man going up a hill?
Explain the energy flow of ecology? Energy flow: As you can see, energy flow is one way in an ecosystem. Energy is not recycled. The ultimate source of energy that powers eco
Pericardiocentesis It is removal of fluid form the pericardial sac. It is a specialized procedure done n ICU or cardiac cath lab or OT. A 16 or 18 gauge needle is inserted
How many grams of sodium dodecyl sulfate (mw = 288.37) would you dissolve in 80mLs of water to make a 20% solution of SDS?
Influence of Diabetes Mellitus : Diabetes causes micro vascular obstructive disease in heart, kidney, retina and peripheral nerves. Scrupulous rather than casual control of diabe
extracellular signals and their characteristics
Question 1: Describe the need for Harmonization in clinical trials? Brief on the Revised ICH terms of reference and explain the structure of ICH? Need for Harmonization i
Other Complications : Bioprosthetic valves have a tendency for degeneration, calcification or cusp perforation. Current models have overcome many of these problems. Calcification
The plasma membrane is the outer membrane of the cell it delimits the cell itself and a cell interior with particular conditions for the cellular function. As it is selectively per
What is the utility of fungi for some industries? Fungi are industrially used in the production of fermented beverage, cheese, bread etc. Some fungi are very significant for th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd