Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. How are the three major arthropod classes characterized according to the presence of antennae? Crustaceans have two pairs of antennae insects have one pair arachnids don't h
During digestion, the role of pancreatic lipase is to: -digest cholesterol into dimethlyalpyrophosphase -inhibits interactions between lipids and bile salts -hydrolize TG
Do all mammals have a placenta? Mammals of the monotreme group (echidnas, platypus,) are oviparous, egg-laying, and they do not have a placenta. Mammals of the marsupial group
Define Supplementation for prevention of vitamin A deficiency? Administration of large doses of vitamin A to children at risk has been the most popular approach to control nutr
Concept of Production - Ecosystems The ecosystems are unable to function, unless there is a constant input of energy from an external source that is sun. Solar energy enters t
Quantification of Tricuspid Regurgitation Echocardiography and right ventricular angiogram can quantify tricuspid regurgitation. Echo Quantification Trivial: Non susta
Define Stripping Perforation - Types of Root Perforation It is latral perforation caused by over instrumentation through a thin wall of the root. Most common on the in
What is the main theory opposed to evolution? The major theory that opposes the evolution theory on the description of how species emerged (phylogenesis) is fixism.
Q. Conditions required for Mimicking Pericardial Effusion? In 2DE few conditions can mimic PE. a) Pericardial fat-Mostly localized anteriorly. Absence of fat in the posterio
Doppler echocardiogaphy is based on the Doppler effect, which was described by the Austrian phy$icist Christian Doppler in 1842. The Doppler effect states that sound frequency
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd