Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
List the four basic points to be kept in mind when advising food exchange. To develop the food exchange list points to keep in mind are: a) Group similar foods in one group.
Explain Microtube and Hedstorm file removal technique A Hedstorm file was then passed down the length of the tube until it engaged itself tightly between the obstruction an
Coelom - Metazoa True coelom is a body cavity which arises within the embryonic mesoderm so that the cavity lies between the body wall (integument; ectoderm) and guts (endoder
Admission Information The physician and nurses are the primary source of facts concerning the purpose of therapeutic plan and expected outcome of hospitalization. The informa
Do plants placed under an environment drier than the habitat where they are used to living have a reduction or an increase in the time during which their stomata remain open? I
What do enzymes do, and how? How is enzyme activity regulated in cells? How do ATPases u se ATP to make reactions go?
Infectious bovine rhinotracheitis (IBR) The disease is caused by a Bovine Herpesvirus -I belonging to the family Herpesviridae and subfamily Alphaherpesvirinae. It is a DNA vi
Describe Class Diplopoda and Chilopoda in detail? Members of the Subphylum Crustacea and the Subphylum Uniramia have one major characteristic in common. Both groups have biting
Planning of Nursing Care Provide supportive and symptomatic treatment. Provide bed rest. Encourage diet restriction, Implementation of Nursing Care
The bacteria that cause dental cavities in humans break down sugars, releasing what chemical which causes tooth destruction? a) Acids b) Bases c) Enzymes d) Monosaccha
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd