Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Which are the groups of living beings that form the protist kingdom? The protist kingdom includes algae and protozoans. (Two groups of fungi with similar characteristics to
Q. Explain Lane Eynon Method procedure? You will be carrying out the procedure in two steps using Lane Eynon Method. Step 1 It involves the standardization of copper s
G L YCOGEN Polymer of a-D-glucose. It has 5000-30000 units of a-D-glucose. Glycogen is glucosan homopolysaccharide which is the major reserve food of animals, fungi and
Define the effect of Vitamins (A, D, K and B-Complex) on athletes? Vitamins A, D and K have been found to have no ergogenic effects. Ingesting large doses of these vitamins hav
Signify the term - opercular gill. The gill found in bony fish. Operculum is the outer covering of the gill. When it's drawn away from the body, it pulls water inside the bucca
Do sea urchins have teeth? Sea urchins have a teeth-like structure juxtaposed to the mouth and made of five teeth linked to ossicles and muscle fibers. This structure, called a
Q. After the morula stage what is the next stage? What is the morphological feature that defines this stage? In the blastula stage the compactness is lost and an internal cavit
Organisation of the Marine Ecosystem The oceans like lakes, exhibit zonations. First describe the various zones or regions of the oceans and then later deal with the biota occ
What is biological control? Biological control is a natural process to control the size of animal, microorganism or plant populations. Biological control is based on the knowle
what is the mode of nutrition for worms?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd