Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Phylum platyhelmenthiese, show heading wise characteristics of phylum platy...

show heading wise characteristics of phylum platyhelmenthiese

Explain the toxicity of vitamin e, Explain the Toxicity of Vitamin E? ...

Explain the Toxicity of Vitamin E? Vitamin E is relatively non-toxic. Adults tolerate doses as high as 100 to 1,000 IU per day. However, adverse effects such as muscle weaknes

Explain algae have cell wall, Algae have cell wall made up of: 1. Cellul...

Algae have cell wall made up of: 1. Cellulose, galactans and mannans 2. Hemicellulose, pectins and proteins 3. Pectins, cellulose and proteins 4. Cellulose, hemicellulo

Traditional meat products, Tr aditional Meat Products The rich heritag...

Tr aditional Meat Products The rich heritage of India contributes to wide range of traditional foods and has a role to play in health foods. Indigenous meat products are uniqu

Animal phylum that contains creatures with analogous organs, Q. Most insect...

Q. Most insects have wings. Which is the other animal phylum that contains creatures with analogous organs? Besides the phylum Arthropoda another animal phylum with flying crea

Define tracheal system in details., Define tracheal system in details. ...

Define tracheal system in details. Respiratory system found in insects and some spiders where air passes directly to the tissues through a series of tubules. Since oxygen tran

Determine the function of monomeric enzymes, Determine the fuction of Monom...

Determine the fuction of Monomeric enzymes Monomeric enzymes include, pepsin, like the pancreatic serine proteases, plays a role in the digestion of proteins eaten by mammals.

Explain the mortality and survivorship curves, Explain the Mortality and Su...

Explain the Mortality and Survivorship Curves? Mortality : Just as a population has a birth rate, so does it have a death rate. A populations rate of death, or the number of

Explain advantages and disadvantages of spread plate method, Explain Advant...

Explain Advantages and Disadvantages of Spread Plate Method? The advantages and disadvantages of spread plate method are highlighted next. Advantages   1. It is useful fo

Relate mitochondria organelles with eukaryotic cells, Relate Mitochondria o...

Relate Mitochondria organelles with eukaryotic cells Mitochondria are highly specialised organelles in eukaryotic cells. These perform the energy transducing process, and are o

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd