Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain the intracellular perfusion fluid, At 1 AM, a healthy squid giant a...

At 1 AM, a healthy squid giant axon is placed in a bath of normal squid physiological extracellular saline and is internally perfused with normal squid intracellular saline.

Typical form or reparative regeneration - heteromorphosis, Typical Form or ...

Typical Form or Reparative Regeneration - Heteromorphosis Sometimes the part which grows back is not the same as that which was lost. The phenomenon is called Heteromorphosis.

Ecology, Benefits of energy pyramids

Benefits of energy pyramids

Encystment – protozoan, Encystment – Protozoan Encystment is character...

Encystment – Protozoan Encystment is characteristic of the life cycle of many protozoan. The protozoan secretes a thickened envelope (cyst) around itself and becomes inactive

Nutrition, list and explain the modes of nutrition

list and explain the modes of nutrition

Cromngnon skull, Subsequently many such fossils were known from France, Ita...

Subsequently many such fossils were known from France, Italy and middle East. All such fossils exhibited reduced brow ridges, steep forehead, high rounded cranial vault, short face

Explain the occurrence of vitamin C, Explain the Occurrence of Vitamin C ...

Explain the Occurrence of Vitamin C Vitamin C (ascorbic acid) is an active ingredient present in any animal or vegetable cell which occurs in the plant in free form and also bo

Fat cow syndrome, F a t cow syndrome Fat cow syndrome, also known as ...

F a t cow syndrome Fat cow syndrome, also known as fatty infiltration of liver, is a highly fatal disease in high yielding dairy animals that occurs a few days before or afte

Deficiency diseases-parturient paresis , Parturient paresis (milk  fever, h...

Parturient paresis (milk  fever, hypocalcaemia) Parturient paresis is an acute to peracute non-febrile disease, which occurs in diary cows and buffaloes usually around the t

Give detail explanation about swimming, Give detail explanation about Swimm...

Give detail explanation about Swimming Swimming is an excellent form of exercise. Swimming can improve the posture and circulation. It is a healthy activity. There are certain

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd