Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Theories are import because they can be used to a. Test research hypothesis b. Develop questions which will facilitate more effective research c. Conduct more meaningful and useful
explain parasitism.
Q Does RNA molecule have two polynucleotide chains like the DNA? Only DNA has two polynucleotide chains. The RNA is formed by just one polynucleotide chain.
MOSAI C THOERY - It was given by W. Roux. He studied the development of frog's egg. He destroyed one cells by a hot needle out of 2-cells formed as a result of first cleava
What is the energy source used in active transport through biological membranes? The energy essential for active transport (against the concentration gradient of the transporte
A horticulturist keeps Chrysanthemum plants in short-day conditions during long-day season. State its effect on flowering. Specify the role of phytochrome included. Explain glom
Q. What are few mechanisms by which pathogenic bacteria cause diseases? And why is this knowledge important? Pathogenic bacteria have characteristics called as virulence factor
Which of the following statements is true? Answer Viruses are distict from cells by the absence of a lipid membrane around them. Viruses are parasites that require the cell's metab
Describe five different types of gateway vectors that are available, what different functions they can perform, and for what purpose. e.g. (1) Vector pXXX, (2) function - expre
Illustrate the term - Digestive caecum. A blind-ended pouch which extends from main digestive tract. Digestive ceca may be the sites for final digestion of ingested food or may
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd