Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Describe the basic working of cerebral hemisphere, Q. How is it structurall...

Q. How is it structurally explained that the motor activity of the left side of the body is controlled by the right cerebral hemisphere and the motor activity of the right side of

Bacteria, wine turns sour beause of the action of which bacteria? aerobic o...

wine turns sour beause of the action of which bacteria? aerobic or anerobic?

What do ypu know about conduction disturabances, Q. What do ypu know about ...

Q. What do ypu know about Conduction Disturabances? During exercise there is an increase in the sympathetic drive and a withdrawal of vagal tone. Sympathetic enhancement of con

Run off-water cycle, Run off Some of the rainfall is soaked into the so...

Run off Some of the rainfall is soaked into the soil and excess water flows over the land surface along the natural slope of the area. Run off is the main source of water for l

Foods for growth in microorganisms, Q. Foods for Growth in microorganisms? ...

Q. Foods for Growth in microorganisms? Microorganisms differ in their ability to use various nitrogenous compounds as a source of nitrogen for growth. The primary nitrogen sour

Gel electrophore, How can you see a DNA by size if it too small to see wit...

How can you see a DNA by size if it too small to see with a microscope

Zoology, Give the salient features of phylum protozoa

Give the salient features of phylum protozoa

Define needs of fluid in postoperative nutritional care, Define Requirement...

Define Requirements of Fluid in Postoperative Nutritional Care Extensive fluid losses may occur through vomiting, haemorrhage, diesis, excudate, fever and sweating after a surg

Explain the importance of biochemical tests, Explain the Importance of Bioc...

Explain the Importance of Biochemical Tests? Specific series of biochemical tests have been developed for fast identification of microorganisms in laboratories. These biochemic

Characters of the hemichordata, Two typical characters of the Hemichordata ...

Two typical characters of the Hemichordata that can be observed and used to identify them are: i) Soft, worm-like or short unsegmented body. ii) Body is divided into a (i) pr

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd