Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
The first movements of the foetus and appearance of hair on its head are usually observed during which month of pregnancy? 1. Fourth month 2. Fifth month 3. Sixth month
On living organism Air pollution causes following effects on living organism: (a) Effects on humans: 1. Carbon monoxide reduces the oxygen carrying cap
Q. What is the life cycle of a tapeworm? The Pregnant proglottids with taenia eggs are released together with human feces. If ingested by the intermediate hosts, bovineor swine
Q. Biological species concept? A biological species as defined by Ernst Mayr are "groups of actually or potentially interbreeding natural populations which are reproductively
Soil pH and Nutrient Availability Soil pH is the most important factor which governs the availability of nutrients in soil. All the nutrients are absorbed by plants in their io
Define Vitamins requirement to avoid underweight problem? Vitamins and Minerals: If the diet provides good amounts of fresh fruits and vegetables, vitamin or mineral supplement
How does the Cornea work, I heard that it is like a motor, however i''m not too sure... because a motor is in vehicle and has piston, and the Cornea is in our eyes and... Well does
Q. Conditions Necessary for outbreak of botulism? The following conditions are necessary for an outbreak of botulism: 1. Presence of spores of C. botulinum of type A, B o
What are the hormones secreted by the adrenal medulla? What are their respective functions? The medullary portion of the adrenals secretes hormones of the catecholamine group:
Explain assessment of iron status - Transferrin saturation? Transferrin saturation: As iron deficiency progresses, there is a decline in transferrin saturation. With deficiency
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd