Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Aschelminthes, in what part of the human body aschelminthes found?

in what part of the human body aschelminthes found?

State the definition of bio-medical waste, State the definition of Bio-medi...

State the definition of Bio-medical waste 'Bio-medical waste' means any solid and/or liquid waste including its container and any intermediate product, which is generated durin

Respiration, How does Respiration in animals

How does Respiration in animals

Chloroplasts , Chloroplasts Like mitochondria, chloroplasts are also di...

Chloroplasts Like mitochondria, chloroplasts are also distinctive organelles of eucaryotic cell. But they are found only in plant cells. Chloroplasts contain membranes forming

What is genomics , We are living in an unprecedented age of biological ...

We are living in an unprecedented age of biological discovery and the application of biological knowledge.   Programmed DNA sequencing delivered, in the year of  2001 over the 2.6

Explain in detail about the optic nerve, Explain in detail about the optic ...

Explain in detail about the optic nerve The optic nerve contains more than one million axons that initiate in the ganglion cell layer of the retina. This structure originatcs a

Bacterial diseases-actinomyces, Actinomyces Members of the genus Actin...

Actinomyces Members of the genus Actinomyces are facultative anerobic, gram-positive, non acid-fast, non-spore forming, nonhaemolytic rods. All Actinomyces require rich media

Two adjacent cells is an effective transport pathway, Which one of the foll...

Which one of the following structures between two adjacent cells is an effective transport pathway? 1. Plasmodesmata 2. Plastoquinones 3. Endoplasmic reticulum 4. Plasm

Could this be accomplished by passive diffusion, In the human body, the pot...

In the human body, the potassium ion can pass easily through cell membranes, yet the potassium ion concentration is higher inside many cells than it is outside these cells. Could t

Plants of estuary, Plants of Estuary The plants of the estuary are of ...

Plants of Estuary The plants of the estuary are of four basic types: Phytoplankton, Marginal marsh vegetation, Mud-flat algae and Epiphytic plants

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd