Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define fluorides Metabolism? Soluble fluorides, even at high intake levels are almost completely absorbed from gastrointestinal tract. These include aqueous solutions of fluori
Explain Atazanavir Atazanavir (ATV, Reyataz) - Atazanavir (Medical Letter 2003; 45:89) is the first single-agent protease inhibitor with once-daily dosing. In clinical trials
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
Explain Materials for Root End Filling- Amalgam a) Its radiopacity is the better than any other REF materials b) Greatest amount of leakage! c) Corrosion, and significant
Visual Field Examination Russel et. al include a formal visual field examination using a parameter as part of their assessment procedure. Tests in the expanded version include
Write a DNA palindrome or inverted repeat of at least 10 nucleotides in length.
Air pollution is complex in origin and varied in effect. It is very crucial from the point of human health. Every human being inhales about 15-22 kg of air daily and air is pollute
Discuss why humans not evolve with one central repository of DNA rather than having it replicated throughout the body?
Define Classifications of carbohydrates based on number of aldehyde? Classification based on the presence of aldehyde or ketone group Carbon atoms Aldos
Cell structure and function All organisms, whether simple or complex, plants or animals. are composed of cells. For example, a bacterium or an amoeba is made up of just one cel
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd