Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
what is a Diaphragm
LOCOMOTION IN EARTHWORM - By contrection & relaxation of muscles waves are formed in body, generally from posterior to anterior. Setae are helpfull in locomotion. Rate of lo
Origin and Evolution of Metazoa Most of the early metazoans were soft bodied and so their fossils are rare. The extremely fragmented fossil record does not shed any specific l
Leukaemia Leukaemia is a malignant disease of blood forming organs of the body that results in uncontroled growth of immature white blood cells. The leukaemic process in t
Phenolic compounds Gossypol: Gossypol is a toxic compound found in the cotton plant. It is concentrated in the cottonseed but can also be found in other parts of the cotton
DNA sequencing is the process of reading the nucleotide bases in a DNA molecule. It includes any technology or method which is used to verify the order of the four bases- guanine,
Peri operative Myocardial Infarction : Peri operative Myocardial Infarction is diagnosed by the appearance of fresh Q waves. Non-Q, myocardial infarction is suspected when there
Define Sugars - Chemistry and Functionality? In this section we will learn about the simple carbohydrates called sugars. As you may already know, those carbohydrates that canno
Explain Potential Effect of Nutrient and Drug Interaction? The extent of the effects of any food and drug interaction call varies. Potential effects depend on the dose and the
Q. How does the intensity of facilitated diffusion differ in relation to the concentration of the moved substance? What is limiting factor? Like simple diffusion facilitated di
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd