Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
write short note on feeding mechanism in holozoic organism
Gluconeogenesis: When diet is deficient incarbohydrates. Glucose or glycogen is formed from noncarbohydrate compounds principally from certain amino acids and the glycerol of
CRANIAL NERVES 12 pairs. Total weight 12 gms. Upto amphibian 10 pairs cranial nerves are present. 1, 2, 8, - sensory. 3, 4, 6, 11, 12, motor. 5, 7, 9, 10 - mixed. 3
Biochemical Production: Plants are the foundation of a large variety of biochemical which are metabolites of both secondary and primary metabolism. But secondary metabolites ar
Q. Illustrate Hypertrophic cardiomyopathy? It is a genetic disorder due to mutations in the gene that encodes for β-Cardiac myosin heavy chain (Localised to chromosome 14). It
P a r a typhoid and other Salmonella infections Paratyphoid salmonellae are non-host-specific. The commonly reported species are S. Typhimurium, S . Enteritidis S . T
an assignment of amphibians
Phylum Chlorophyta (green algae) 1) The chlorophyll is the main photosynthetic pigment. 2) There is little or no cell differention in thallus. Thallus is usually filamento
Auxiliary Food Chains In addition to grazing and detritus food chains there are other auxiliary food chains operated through parasites and scavengers. Some parasitic food chai
What are the factors that for influencing photosynthesis also interfere with the gross primary productivity? Mostly water and light, but also mineral salts, temperature and car
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd