Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
binomial nomenclature
Q. What benefits can commensalism offer to a species? The Commensalism may involve obtainment of food (for instance, the innocuous bacteria of the human gut), shelter or suppor
Explain in detail about Male Reproductive System The male reproductive organ consists of the following: A pair of testes, held in scortum; produces spermatooa and testoster
When you eat a salad with lettuce, croutons, hard-boiled egg, bacon bits, and salad dressing, which one of those ingredients will be broken down the least by your digestive system?
Explain Complex or Undefined Media? Here, the exact composition of the medium is not known. It contains some complex components of plant and animal extracts whose exact chemica
Significance of Apomixis Apomixis offers the possibility of indefinite multiplication of especially favorable biotypes without any variation due to segregation or recombinati
What is the relationship between the estrogen level and the LH level in the menstrual cycle? What is the function of LH in the menstrual cycle and when does its blood concentration
What are deciduous trees? Deciduous trees are plants that lose their leaves in a period of the year. In the case of the deciduous trees of the temperate forest the fall of the
Lateral Roots - Root Apex Lateral roots normally arise at a definite distance behind the tip from areas close to or opposite the points of xylem star. So, a triarch root can
Explain the Sub-Culturing? Microbiological studies require microorganisms in pure form, i.e., a single type of microorganisms should be present in a culture. Maintenance of the
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd