Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Phospholipids - conjugated lipids, PHOSPHOLIPIDS Most abundant lipid...

PHOSPHOLIPIDS Most abundant lipid present in cell membrane, also called membrane lipid. It is made up of lipid & phosphoric acid. The basic phospholipid is phosphat

Vivipary - development biology, Vivipary - Development Biology In flow...

Vivipary - Development Biology In flowering plants the seed or fruit generally is dispersed and germination occurs when the conditions are congenial for growth. However, in so

Are fibrates effective at lowering tg levels, Q. Are Fibrates effective at ...

Q. Are Fibrates effective at lowering TG levels? Fibrates are effective at lowering TG levels by 20 per cent to 50 per cent and raising HDL by 10-35 per cent. LDL reduction var

Define functions of selenium in humans, Define Functions of selenium in hum...

Define Functions of selenium in humans? Until recently, the only known metabolic role of selenium in humans was as a component of glutathione peroxidase which along with vitami

How temperature affect the rate of cellular respiration, How does temperatu...

How does temperature affect the rate of cellular respiration? Please explain with great detail!

Types of amoeboid movements, Types of Amoeboid Movements As the amoeba...

Types of Amoeboid Movements As the amoeba's cell body throws out one or a few pseudopodial lobes, a temporary rear end or uroid is pulled along. The central, more fluid protop

Treatment of acute myocardial infarction, Q. Streptokinase is a substance u...

Q. Streptokinase is a substance used in the treatment of acute myocardial infarction. How does this substance act? Substances known as fibrinolytics, like urokinase and strepto

Origin, What group did reproduction via sexual exchange of genetic informat...

What group did reproduction via sexual exchange of genetic information originate in?

Into which classes are mollusc divided, Into which classes are mollusc divi...

Into which classes are mollusc divided? What are some representing beings of each class? The phylum Mollusca is separated into five major classes: pelecypods, or bivalves (Pele

Evolution conditions, What are the five conditons that can cause evolution ...

What are the five conditons that can cause evolution to take place?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd