Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Benefits of Computerization Computerization were the following benefits in nursing: Improved professional care Better accuracy (by decreasing human error) Effect
Class Holothuroidea Body cucumber-such as; no arms; no spines; no pedicellariae; ossicles minute and embedded in muscular wall; anus present; tube feet along with suckers; am
How we explain intenal organs when we talk about symmetry??Is there any animal that is completely symmetric even insid the body?
Male reproductive disorders due to infections Septicemic infections have a greater affinity for vesicular glands than other regions of the reproductive tract viz. prostate, am
Define the Criteria for an Indicator Organism? Following criteria are suggested for an indicator organism: i. It should be suitable for the analysis of all types of water, i
introduction
Propane boils at -46oC. Propanol boils at 97oC. The difference is attributable to- Select one: a. The fact that propanol is much heavier b. The fact that propanol ionizes all
Utilization of Alternate Feed Resources Use of alternate feed resources is one of the potential areas for augmenting feed resource base in the country. However, the use of NCF
Define requirements of Zinc during pregnancy period? Zinc, as a mineral, was found to be associated with foetal growth and birth weight. Low plasma zinc was associated with mor
Alcohol Related Emergencies: Alcohol is one of the most serious health problems. Alcoholism is defined as a primary or chronic disease with genetic, psychological and environ
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd