Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Compound leaf is the leaf in which the blade forms small leaflets. Compound leaves which have several small leaflets originating from the central axis are termed as pinnately comp
Mechanical Valves They are made of a combination of metal alloys, pyrolite carbon and dacron. Types of Mechanical Valves Caged-ball Valve (Star-Edwards) A me
Research methods used in studying a genetic disease change with technological advances. These changes can be seen in Reading 22.1: Discovering the Huntington Disease Gene, which de
Define Indicators at the individual level? Number of individuals who have gone hungry through lack of personal food supply, amount of expenditure on food, percent of disposable
Human respiration Human beings are adopted for terrestrial mode of life. They conduct pulmonary respiration. This system consists of external nostrils, nasal cavities, pharyn
Explain Regulatory enzymes Regulatory enzymes: Citrate synthase, isocitrate dehydrogenase and a-ketoglutarate dehydrogenase complex are the key enzymes which regulate
Severe Acute Respiratory Syndrome (SARS) After travelers' diarrhea, respiratory infection is the most common infectious disease affecting travelers. In the winter of 2003 a ne
About phylum platy helmenthus
RESPIR A TIO N IN INSECT (COCKROACH) - Respiration is direct. So metabolic rate is high. This system is related to each cell of the body so respiratory pigment is ab
Define the Clinical success for the Root Canal Treatment a) Absence of pain and swelling. b) Disappearance of sinus tract. c) No evidence of soft tissue destruction, incl
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd