Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Explain Restricted fragment polymorphism? This method makes use of a group of enzymes termed restriction enzymes which recognise particular sequence of DNA and act as "molec
How CAMPYLOBACTERIOSIS occurs in humans C. jejuni frequently contaminates raw chicken. Survey shows that 20-100% of retail chickens are contaminated. Many healthy chickens car
A thiamine defiency will result in decreased activity of: -G-6 phosphase -transketolase -fructokinase
While various positive control components lie close to the gene they regulate additional can be situated long distances away (sometimes 10-50 kb) either upstream or downs
Chemical Stress Survival of cells is dependent on carrying out of a set of chemical reactions (metabolic reactions) in a particular order. This results in a net gain in mass a
What is the utility of fungi for some industries? Fungi are industrially used in the production of fermented beverage, cheese, bread etc. Some fungi are very significant for th
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Food Intolerances Food Intolerances: The intolerances of the patient for specific food items must be assessed. For example, milk may lead to diarrhoea in some people whil
Which are the more abundant ribosomes in secretory cells - the free cytoplasmic ribosomes or those associated with the rough endoplasmic reticulum? Free cytoplasmic ribosomes
Liver necrosis?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd