Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Agro industrial-phosphorus, Phosphorus Phosphorus has been known as “m...

Phosphorus Phosphorus has been known as “master mineral” because it is involved in most metabolic processes. Phosphorus, which is stored in bones and teeth, is often discussed

What are the transposable elements, Transposable elements are able to move ...

Transposable elements are able to move around the genome by precise or imprecise excision events. What is meant by imprecise excision? A. Imprecise excision refers to a transpo

Punnett Sqares Virtual Lab, I need help with my biology virtual lab. Its du...

I need help with my biology virtual lab. Its due tomorrow

Frequency - synthetic characters, Frequency - Synthetic Characters Thi...

Frequency - Synthetic Characters This term refers to the degree of dispersion of individual species in an area, and is usually expressed in terms of percentage. Frequency can

#nervous system, 6. What is the function of the myelin sheath? Do all axons...

6. What is the function of the myelin sheath? Do all axons present a myelin sheath?

What is adaptive convergence?, What is adaptive convergence? The Adapti...

What is adaptive convergence? The Adaptive convergence is the phenomenon by which living beings facing the same environmental pressure (problems) and undergoing genetic variabi

Role of psychiatric nurse, ROLE OF PSYCHIATRIC NURSE: In Blocks 2 and ...

ROLE OF PSYCHIATRIC NURSE: In Blocks 2 and 3 you have learnt about various therapeutic interventions  for mental disorders  like anxiety neurotic disorders, psychotic disorder

Why enzymes work to speed up a chemical reaction, Enzymes work to speed up ...

Enzymes work to speed up a chemical reaction by: a. attaching coenzymes to the substrate b. heating up the substrate c. lowering the activation energy of the reaction d. supplyi

What are the most important structures in the nucleus, Q. What are the most...

Q. What are the most important structures within the cell nucleus? Within the cell nucleus the most important structures are the nucleolus, an optically dense region, spherical

Describe postpartum cardiomyopathy, Q. Describe Postpartum Cardiomyopathy? ...

Q. Describe Postpartum Cardiomyopathy? It is defined as presentation of LV Systolic dysfunction and heart failure in last trimester of pregnancy or within 6 months of delivery.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd