Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Prevention in the prevalence of overweight or obesity? It is believed that the increase in prevalence of obesity worldwide is more due to the environment that has become
Human respiration Human beings are adopted for terrestrial mode of life. They conduct pulmonary respiration. This system consists of external nostrils, nasal cavities, pharyn
assignment for discussing DNA REPAIR
Dot blot is the technique for measuring the amount of one perticular DNA or RNA in the highly complex mixture. The samples are spotted onto the hybridization membrane (like nitroc
What is homogenization Emulsions may also be stabilized by a process known as homogenization, in which the size of the dispersed fat globules is greatly reduced to more or less
Minerals and Rocks A mineral is an inorganic body, formed by the process of nature, usually having a definite composition. If formed under favourable conditions, it has a
Fatty acid synthesis is the formation of fatty acids from malonyl-CoA and acetyl-CoA precursors by action of enzymes called as fatty acid synthases. It is a very significant part o
Bioclimatology: This is the study of effect of climate on distribution of organisms. Bioclimatology is the inter-disciplinary field of science which studies the interactions betwe
Vitamin A dry powder Vitamin A dry powder is used in the (manufacture of dry mixtures) for which the oily ester concentrates are unsuitable or undesirable. Mainly, they are inc
Starting from a ribosome in the cytosol, list in sequential order the organelles and cellular components a secreted protein would encounter from translation to secretion.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd