Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What are some examples of migratory animals? Instance of the migratory animals are southern right whales from Antarctica, that procreate on the Brazilian coast; the migrator
Which of the following is true for a G-protein? A. After the ATP-ase of the alpha subunit of a G protein converts the ATP bound to the alpha subunit to ADP and inorganic phosph
Complete feed system in ruminants Complete feed system for feeding dairy animals is a departure from conventional individual rationing method. It involves the self-feeding of
what are the biological significance of skeleton
What are the methods of foams? There are two basic methods in the formation of foams i.e. a) whipping and b) condensation.
State two ways in which cardiac muscle is microscopically similar to skeleton muscle.
Q What is the other name given to the sex chromosomes? What is the function of the sex chromosomes? Sex chromosomes are also known as allosomes the other chromosomes that are n
Q. What are some functions of the epithelium? The epithelial tissues can perform protection, covering and impermeability against the environment, for instance, in the skin, res
Cold Hardiness and Cold Acclimation In connection with cold response we would like to introduce two terms- cold hardiness and cold acclimation. Cold-hardiness ref
When the overlap between the thin and thick filaments of a sarcomere in a skeletal muscle is decreasing, the A. total length of the I band minus the length of the H zone is dec
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd