Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Tube or Enteral Feeding Ideally the patient must be fed orally, but in cases where the patient is unable to take solid foods, a part or all of intake is usually given by the tu
Determine the name of Material used for BCC You must be interested to know about type of material you can prepare and some material is available in hospitals and clinics for us
Increase in population size is known as population growth. It depends upon number of persons added to the population and number of persons lost from the population. Addition in pop
Which is the type of nitrogen waste eliminated by beings of the class Reptilia? These beings excrete mainly uric acid. This substance is less toxic than ammonia and it can be k
where does the free nucleotides present in the nucleus come from
it consists of the girdles and the skeleton of the limbs
Photoperiodism Activity like breeding and migration in animals; flowering, seed germination in plants are regulated by the length of daily period of light and darkness. This be
Explain about the forces acting on a gravity retaining wall. Forces Acting on a Gravity Retaining Wall: In a general way the forces that act on a gravity retaining wall. The
How ecosyestem concept is useful to the study of environment?
ONSE T OF PUBERTY IN FEMALE - Attains at the age of 13 by estrogen hormone. It includes - 1. Growt h of breasts 2. Growth
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd