Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
EGG S OF HEN It is a meiolecithal egg which is oval. The animal pole is found in the form of a small germinal disc. The vegital pole has two types of yolk viz. White yol
Cohesiveness and Surface Tension Water flows freely, yet water molecules do not break apart. They cling together particularly to polar surfaces. Therefore, water can fill a tub
If we were to completely eliminate one group of marine organisms from ocean, which would most likely be fatal to Marin fish populations? Elimination of: a) Starfishes b) Dia
Central Nervous System (CNS) Covering of the brain and spinal cord is called Meanings (membranes which cover and protect brain and spinal cord are called meanings) There is flu
Explain the Bioelectrical impedance Analysis (BIA)? The difficulty of measuring total body water (TBW) by Isotope Dilution Method led to the search of Bioelectrical Impedance A
If the generation time (t) is the incubation time (t) per generation (G), or t = t/G, rewrite the formula you derived in question 2 for bacterial population growth in terms of incu
Which are the living beings that carry out photosynthesis? Which is the cell organelle responsible for the absorption of light for the photosynthesis process in plants and algae?
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Acetylcholine, a well known neurotransmitter, plays a critical synaptic role in the initial formation of memory. Chemical blockage of the acetylcholine receptors makes it harder to
Question 1 Explain pharmacokinetic parameters observed in plasma concentration time curve Question 2 What is Gas Chromatography? Mention the quantitative applications of gas
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd