Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
How Cereal and Bread important for Human -Nutritional Factor? Cereals form the staple of the Indian diet. These grains are the main source of energy in the Indian diet
Nucellus - Seed In a large majority of flowering plants the nucellus is gradually utilized by the endosperm or embryo. In leguminous seeds, for example, the nucellus degenerat
Q. What do you mean by Subxiphoid Long Axis Sweep? This sweep begins with keeping the transducer at subxiphoid region, positioning directly posterior with marker pointing towar
Define Carbohydrate requirement for cancer patients? Adequate amount (60% of total energy) of carbohydrates should be provided. If a very high calorie diet is being given, emph
what is a cell
While studying evolution, a student comes across a cladogram that includes clades like amphibia, reptilia, aves, and mammalia. What must be the basal clade?
Q. How many ATP molecules are made after glycolysis? Glycolysis is a process similar to glucose degradation in fermentation it produces final balances two molecules of ATP for
Define Estimation of Blood Thiamin Levels - Thiamin Status? The levels of free thiamin and its phosphoesters in whole blood and erythrocytes are measured using high- performanc
Q. Show Appearance of food product? Appearance can be judged by the eye. Appearance factors include such things as size, colour, uniformity, absence of any defect, shape, whole
Q Why do protease-supplying cells of the stomach and of the pancreas make only precursors of the active proteolytic enzymes? The stomach and the pancreas make zymogens of the p
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd