Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Polychaete, Mollusca and Echinodermata Polychaete and Mollusca The polychaetes have a trochophore larva. A common trochophore larva is top shaped bearing a tuft of cilia
justify the claim that paramecium is the highly evolved protozoan basing on the morphological and physiological features .
what are viruses
A n a e r o b i c lagoon system This specific system of liquid manure handling is restricted to organized dairy farms, where the flushed manure is directed into an anae
Industrial Effluents - Causes of Water Pollution Most industrial operations produce effluents that are discharged into nearby river or any other water body. The industrial eff
We just had to clean a food freezer in the office because *someone* put a can of Coke in the freezer and it exploded. Explain, at the molecular level, why the Coke can exploded. A
Spina Bifida Cystica There is a protrusion of meninges and spinal cord a) Meningocele- it is relatively uncommon lesion (4-5 per cent). In this there is protrusion of me
Define Reflection - Endodontic Surgery - Marginal gingival is very delicate and easily injured, therefore you should begin reflection of the vertical incision in the attached
NEO DARWINISM OR SYNTHETIC THEORY OF EVOLUTION - It is the synthesis of the ideas of Neo Darwinians as a new theory of evolution based upon recent findings of genetics and m
Which one of the following has its own DNA? 1. Mitochondria 2. Dictyosome 3. Lysosome 4. Peroxisome Mitochondria
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd