Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Difference between hemoglobin and oxyhemoglobin, Q. How different are hemog...

Q. How different are hemoglobin and oxyhemoglobin? Where is it expected to find a higher concentration of oxyhemoglobin, in peripheral tissues or in the lungs? Oxygen-bou

Homestasis, why does an organism internal environment change

why does an organism internal environment change

Signify the difference between bryophytes and tracheophytes, Which of the b...

Which of the below determines the major difference between bryophytes (pron: bry-oh-fites) and tracheophytes (pron: tray-key-o-fites)? a) Tracheophytes can make their own food

Water - properties and functions, W A TER Occurence Water is ...

W A TER Occurence Water is the most abundant substance, covering 70% of earth's surface. It constitutes 60-90% of living cells.              5-6% in tooth e

Active transport during membranes, Q Which are the molecules that make poss...

Q Which are the molecules that make possible active transport during membranes? Active transport is prepared by specific membrane proteins. These proteins are known as "pumps"

What are the inferior trophic levels, Can the amount of available energy in...

Can the amount of available energy in a given trophic level be larger than the available energy in inferior trophic levels? What does that condition means to the conformation of th

Regulation of hmp pathway, Regulation of HMP Pathway The following fact...

Regulation of HMP Pathway The following factors play an important role in regulation of HMP pathway: a)  The first  reaction of this pathway catalysed by glucose-6-phosphate

Vertebrate kidney, Normal 0 false false false EN-IN X...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Hybrid sterility, Hybrid sterility can be regarded as yet another form of i...

Hybrid sterility can be regarded as yet another form of interspecific sterility. The offspring of the interspecific crosses are mainly sterile. Geological studies have shown that t

What is the primary energy source for life on earth, What is the primary en...

What is the primary energy source for life on earth? The primary energy resource for life on earth is the sun. The sun plays the vital role of keeping the planet warmed and it

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd