Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define the term - functional magnetic resonance imaging, Define the term - ...

Define the term - Functional magnetic resonance imaging Functional magnetic resonance imaging (fMRI) is a recent development that permits simultaneous measurements of the brain

What is microtubules, What is Microtubules? Microtubules are the largest...

What is Microtubules? Microtubules are the largest intracellular fibers, with a diameter of about 25 nm (2.5 x 10-8 meters). They consist of hollow fibers composed of a protein

Major types of inheritances exceptions to mendel''s rules/, According to th...

According to the Mendel's law the phenotypical characteristics would be determined by pair of factors (alleles) that separate independently in gametes. What are the major types of

What is the autotrophic hypothesis on the origin of life, What is the autot...

What is the autotrophic hypothesis on the origin of life? An autotrophic hypothesis on the origin of life asserts that the first living beings on earth were producers of their

Green fluorescent protein - mitochondrial inner membrane, You are studying ...

You are studying how proteins are targeted to the mitochondria. MIP1 is in the mitochondrial inner membrane, whereas MIP2 is targeted to the matrix. You are most interested in how

What is dry mass?, What is dry mass? When the biomasses are compared of...

What is dry mass? When the biomasses are compared often the concept of dry mass is used. The dry mass is the entire (total) mass less the water mass of an individual. The total

Explain the postoperative nutritional care, Explain the Postoperative Nutri...

Explain the Postoperative Nutritional Care? The therapeutic goal for the post-operative patient is rapid recovery to normal function and well being, minimum complications and e

Use of neurotensin in consciousness, Q. Use of Neurotensin in consciousness...

Q. Use of Neurotensin in consciousness? Although little is known about the role of this peptide during the sleep-wake cycle, it has recently been shown that neurotensin injecti

Embryo and endosperm, What is the difference between embryo and endosperm?

What is the difference between embryo and endosperm?

What are some factors that can lead to protein denaturation, What are some ...

What are some factors that can lead to protein denaturation? Protein denaturation can be caused by temperature variation, pH change, alters in the concentration of surrounding

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd