Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Determine causes of iron deficiency anaemia, Determine Causes of Iron Defic...

Determine Causes of Iron Deficiency Anaemia? Dietary Inadequacy Poor bioavailability of iron Presence of absorption interfering substances in diet Poverty and

Indications of phototherapy, Indications i) When there is an abnormal...

Indications i) When there is an abnormal rise in the bilirubin level which may be due to physiological or pathological jaundice or any other problem. ii) Prophylactic ph

Screening dna libraries, Genomic  libraries  are  screened  by  hybridizati...

Genomic  libraries  are  screened  by  hybridization with  a  DNA probe which is complementary  to component of the nucleotide  sequence  of the desired gene. The problem should be

Definition of osmosis, Definition of osmosis A) The best explanation of...

Definition of osmosis A) The best explanation of osmosis is 'The movement of water from a dilute solution to a    concentrated solution across a partially permeable membrane'.

Direction of energy flow, Direction of Energy Flow Now let us consider...

Direction of Energy Flow Now let us consider the first point that is the direction of flow of energy. Energy flows from lower (producer) to higher (herbivore, carnivore, etc.)

What are the main proteins that constitute the sarcomere, What are the main...

What are the main proteins that constitute the sarcomere? What is the function of those molecules in the muscle cells? In the sarcomere there are organized myosin and actin blo

Explain about oil-bearing fruits, Explain about Oil-bearing fruits Oil-...

Explain about Oil-bearing fruits Oil-bearing fruits, nuts and seeds have been grown and used for food for many centuries. More than 100 varieties of plants are known to have oi

What is the use of uncoated polyvinyl chloride, Q. What is the use of Uncoa...

Q. What is the use of Uncoated polyvinyl chloride? Uncoated polyvinyl chloride (PVC) and polyvinylidene chloride (PVDC): PVC and PVDC are closely related plastics that are a

What do numeric pyramids represent, What do numeric pyramids represent? ...

What do numeric pyramids represent? Numeric pyramids show the number of individuals in each trophic level of a food chain.

Investigating, What is scientific investigation?

What is scientific investigation?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd