Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
PANCREA S - It is derived from the endoderm of the embryo. Structure . The pancreas lies inferior to the stomach in a bend of the duodenum. It is both an exocrine an
Ethnobotany : This is the study of relationship between tribals and plants. Ethnobotany is from "ethnology" - study of culture or "botany" - study of plants. This is the scientific
Is it possible that an X chromosome of a woman can have come from her father? It is not only possible that an X chromosome of a woman is from her father, it is certain. Every w
Q. What are the etiological agents of malaria? The etiological agents of malaria are protozoans of the genus Plasmodium. There are four different kinds of plasmodia that cause
Phylogenetic considerations
Q. Classification of plant on the basis of their resemblances? Pliny seemed to have little interest in the classification of plant on the basis of their resemblances. He classi
cell wall of prokaryotic cell consist of what???
Insulin Syringe To administer Insulin properly, familiarize yourself with information about insulin: (a) insulin syringes, (b) storage, (c) site selection (d) steps for injecti
The effect of natural selection on colonies or population favouring one group in preference to other may be referred to as group selection. A group can be the smallest collection o
Stages of Research Process: Planning Stage The planning stage of research process includes a series of interdependent steps consisting of 1) conceptualizatioq of the r
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd