Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Why are vaccines made of the own disease agent or of fragments of it? The goal of vaccines is to artificially persuade a specific primary immune response (and the consequent fo
Differences between Budding and Fission Both budding and fission are identical in at least one way in that the young ones produced by these procedures are the result of direct
Explain Whipping foam method? Whipping is the most common method used as it forms bubbles by cutting the surface and introducing air into liquid. Repeated action makes the
Explain Elephant Trunk Technique in Aortic Aneurysm ? Elephant Trunk Technique : When aneurysm involves arch of the aorta and large portion of descending thor
Define Briefly the Enzymatic Proteins? The most varied and very highly specialized proteins are those along with catalytic activity - the enzymes. Virtually all the chemical re
Absorption of amino acids and peptides Generally, the dietary proteins are almost comp!etely digested to their constituent amino acids and these are rapidly absorbed from
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta act
Braxy The causative agent of braxy is Cl. septicum. It usually affects lambs. The agent is a normal inhabitant of soil and is frequently found in the faeces of herbivores. Bra
Discuss troponin
FATS ( = True Fats, Triglycerides, Neutral Fats) They are esters of fatty acids and 3-carbon trihydric alcohol glycerol (= glycerine). T rue fat is also called trig
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd