Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Hydrosphere, The water on earth surface constitutes hydrosphere. About 75% ...

The water on earth surface constitutes hydrosphere. About 75% of earth surface is covered with water and 97% of that water is present in oceans, which is very salty. We are only

What are the five human digestive secretions, Q. What are the five human di...

Q. What are the five human digestive secretions? Which of them is the only pne that does not contain digestive enzymes? The human digestive secretions are: bile, saliva, gastri

Human skeleton, what are the main coponents of human skeleton?

what are the main coponents of human skeleton?

1, #phyletic lineage ..

#phyletic lineage ..

What is an etiological agent of disease, Q. What is an etiological agent of...

Q. What is an etiological agent of disease? The etiological agent of disease is the agent that causes the disease. It may perhaps a living being, substance or environmental fac

Treatment of sewage, The sewage treatment methods can be classified into th...

The sewage treatment methods can be classified into the following heads: Primary treatment Secondary treatment Tertiary treatment 1. Primary Treatment: The primary

Microorganisms, advantages and disadvantages of protozoa

advantages and disadvantages of protozoa

Nucleoplasm, NUCLEOPLAS M OR KARYOPLASM OR KARYOLYMPH OR NUCLEAR SAP N...

NUCLEOPLAS M OR KARYOPLASM OR KARYOLYMPH OR NUCLEAR SAP Nucleoplasm and cytoplasm name proposed by E. Strassburger . Chemical composition of nucleoplasm given by Kossel . Co

What are protozoans? explain their functions, Protozoans are microscopic in...

Protozoans are microscopic in size however some are large enough to be seen with naked eye. Microscopic organisms such as these have numerous advantages, one of which is that they

Explain acyclovir, Explain Acyclovir Available in topical, oral, and in...

Explain Acyclovir Available in topical, oral, and intravenous (IV) formulations, acyclovir is used to treat herpes simplex virus (HSV) and varicella-zoster virus (VZV) infectio

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd