Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Is water a non-polar or a polar molecule? What is the consequence of that characteristic for the function of water as solvent? Water is made of two atoms of hydrogen attache
what is exonephric
SOMATOFORM DISORDERS: The term 'Neurosis' was first introduced in 1769 by William Cullen (1710- 1790). Till later part of nineteenth century, anxiety disorders were conspicu
how temperature acts as limiting factor explain?
Explain electrocardiography? What is meant by P-Q interval and S -T interval in electrocardiography? Mention two medical applications of this method.
Explain the Factors Affecting GI of Foods? A variety of factors affect GI of foods. The factors which affect the rate of glucose absorption from starchy foods and therefore the
Q. Function of Adenosine in brain? Adenosine has four different receptor subtypes (A1, A2A, A2B and A3). Adenosine A2A receptors are concentrated in striatum. Adenosine recepto
Q. Causes of gastro oesophageal reflux disease? GERD may develop due to any of the following reasons: • decreased muscle tone or abnormal relaxation of the LES, • reduced st
There has been a perfect coevolution between plants and herbivorous animals. This has often developed into a mutually beneficial relationship. Whereas the plants have proved to be
Define Drug effects on Lipid Metabolism? Drugs can affect the metabolism of various essential nutrients in the body. These impairments are highlighted herewith: Lipid metabo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd