Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Heat loss, Heat Loss Temperature regulation is extremely uneconomical...

Heat Loss Temperature regulation is extremely uneconomical if it depends only on variations in metabolism. Therefore, mechanisms for losing excess heat have been developed by

TISSUES, difference between axon and cyton

difference between axon and cyton

What is the role of stomach in human body, What is the role of Stomach in h...

What is the role of Stomach in human body? The stomach serves both to digest food and to hold it so that it can be gradually released into the small intestine. Food stays in th

Explain the term - differential reinforcement, Differential reinforcement ...

Differential reinforcement (Training of incompatible behaviour)- Differential reinforcement of incompatible behaviour (DRI) is used to decrease a frequent behaviour without pun

Pericardiocentesis, Pericardiocentesis It is removal of fluid form the...

Pericardiocentesis It is removal of fluid form the pericardial sac. It is a specialized procedure done n ICU or cardiac cath lab or OT. A 16 or 18 gauge needle is inserted

Define about the column chromatography, Define about the Column chromatogra...

Define about the Column chromatography? In column chromatography, a tube is filled with the material constituting the stationary phase, plus a solvent (mobile phase). The gener

Photosynthesis, Aim: To prove that oxygen is evolved during photosynthesis....

Aim: To prove that oxygen is evolved during photosynthesis. Apparatus: Beaker, funnel, test tube, water, Hydrilla plants. Procedure: Take a few pieces of Hydrilla plant. Keep a

Explain membrane permeability, A pure  phospholipid  bilayer with  its  hyd...

A pure  phospholipid  bilayer with  its  hydrophobic  interior,  is permeable  to water and gases such as O2, CO2, N2 and small uncharged  polar molecules such as urea, ethanol, bu

Coronal disassembly with marginal defect, Coronal Disassembly - If the ...

Coronal Disassembly - If the existing restoration with marginal defect: - The crown was sectioned through the bucco-occlusaly , Christensen crown remover elevate and remove

What are cytokines, What are Cytokines? Cytokines are polypeptides, whi...

What are Cytokines? Cytokines are polypeptides, which influence the proliferation, differentiation, metabolism and activation of cells. There are three areas in cancer that hav

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd