Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

INVERTEBRATES - STRUCTURE & FUNCTION, 2. Describe the respiratory organs a...

2. Describe the respiratory organs and mechanism of respiration in pila.

Structural function of organic molecules, Q. What are the few examples of t...

Q. What are the few examples of the structural function of organic molecules? Ans. Organic molecules have a structural function as they are part of cell membranes, organ w

Regulation of hmp pathway, Regulation of HMP Pathway The following fact...

Regulation of HMP Pathway The following factors play an important role in regulation of HMP pathway: a)  The first  reaction of this pathway catalysed by glucose-6-phosphate

Microbiology, Assume that after washing your hands, you leave ten bacteria ...

Assume that after washing your hands, you leave ten bacteria cells on a new bar of soap. You then decide to do a plate count of the soap after it was left in the soap dish for 24 h

Phylum protoza, how these can be called as acellular?

how these can be called as acellular?

What do you mean by somites, Q. What do you mean by somites? Somites ar...

Q. What do you mean by somites? Somites are differentiated portions of mesodermal tissue longitudinally distributed along the embryo and the somites originate the muscle portio

Gases, GASES There are 4 gases in the protoplasm which remain dissol...

GASES There are 4 gases in the protoplasm which remain dissolved in its free water. These 4 gases are follows-                  CO 2     >  O 2  > N 2  > H 2

What is mass transportation across the cell membrane, Mass transportation i...

Mass transportation is the access or the exiting of substances in or from the cell engulfed by portions of membrane. The fusion of internal substance-having membranous vesicles wit

Define needs of fluid in postoperative nutritional care, Define Requirement...

Define Requirements of Fluid in Postoperative Nutritional Care Extensive fluid losses may occur through vomiting, haemorrhage, diesis, excudate, fever and sweating after a surg

Explain innate immunity, Distinguish among epimorphic and morphallactic reg...

Distinguish among epimorphic and morphallactic regeneration, giving single example of each. Explain innate immunity. Name and explain the category of barrier which includes mac

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd