Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is sporopollinin?
what is biodiversity?
Explain Proteins as carriers? A large variety of compounds are carried in the blood between tissues and organs of the body. Some of the compounds require specific protein for t
what are the methods of seed formation
Explain about the Carbohydrate Malabsorption? Carbohydrates malabsorption is usually caused by an inherited or acquired (in intestinal infection, celiac disease, PEM) defect in
Using a Tissue Punch The implant heads are located and using a suitable sized tissue punch(depending on the implant diameter), the tissue punch is used and takes a circular pie
Radiobiology : This is the study of effects of radiations on living organisms. Radiobiology is a branch of science which concerned with the action of ions. Radiobiology is the radi
Estimation of protein by Availability of amino acids include? Regeneration of blood and liver constituents includes Liver protein regeneration Blood protein regener
Classification of Diabetes Mellitus a) Type1Diabetes Mellitus i) Type 1 a ii) Type 1 b b) Type 2 Diabetes Mellitus c) Others i) Gestational Diabetes Mellitus
The cell cycle undergoes a sequence of changes which involve a period of growth replication of DNA, Followed by cell division. This sequence of changes is called cell cycle.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd