Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What are deciduous trees? The Deciduous trees are plants that lose their leaves in a period of the year and in the case of the deciduous trees of the temperate forest the fall
Use of Alternate Metabolic Pathways Plants surviving under water-logged conditions offer the simplest example of such a response. The submerged parts of such plants use the an
What is Micro-Endodontic Surgery? Combines of the magnification and illumination provided by the microscope with proper use of new micro-instruments.
Pseudocoelom - Metazoa The platyhelminths which do not have a body cavity surrounding the gut, have a solid type of body constitution. The mesoderm completely fills the space
Concerning permeability what type of membrane is the cell membrane? The cell membrane is a selectively permeable membrane, i.e., it permits the passage of water and some select
Ancillary Accomodation: Ward KitchenIPantry: It should have large sink and drain board along with fly proof door. If the food is received from central kitchen and tray pre
For the biological diversity is mitosis or meiosis the more important process? Meiosis is the cell division process that permits the formation of gametes to sexual reproduction
How is an Epithelial cell made?
Membrane is any delicate sheet that divides one region from other blocking or permitting (selectively or completely) the passage of substances. The skin, for example, can be consid
List of Conditions Requiring Rapid Treatment of Hypertension 1) Cardiac: • Acute aortic dissection • Acute left ventricular failure • Acute or evolving myocardial i
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd