Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Ancestral unicellular organism, Ancestral Unicellular Organism So far ...

Ancestral Unicellular Organism So far in this unit we have considered the characteristic of body designs that are shared by various animals and the different body plans that d

What is the etiological agent of amebiasis, Q. What is the etiological agen...

Q. What is the etiological agent of amebiasis? How it transmitted and what are the typical manifestations of the disease? The Amebiasis is caused by the protozoan Entamoeba his

What is the purpose of dna, What is the purpose of DNA? Actually, DNA m...

What is the purpose of DNA? Actually, DNA makes you who you are. It has all your heredity info, like your hair color, your personality, etc. No two person's DNA is the similar,

Describe cultural characteristics of microorganisms, Q. Describe Cultural C...

Q. Describe Cultural Characteristics of Microorganisms? Bacterial growth in and on foods often is extensive enough to make the food unattractive in appearance or otherwise obj

Explain cardiac muscle or heart muscle, Explain Cardiac Muscle or heart mus...

Explain Cardiac Muscle or heart muscle? Cardiac muscle, or heart muscle, is a striated muscle that occurs only in the vertebrate heart. The heartbeat is controlled by noncontr

Describe the important factors of hand washing, Describe the important fact...

Describe the important factors of Hand washing Hand washing is an important practice to follow before doing any procedure for the patient. The infection can be transferred

Avian (fowl cholera), Avian (fowl cholera) Fowl cholera is a contagious...

Avian (fowl cholera) Fowl cholera is a contagious septicaemic disease of almost all classes of fowl. The causal agent is Pasteurella multocida.Serotypes A:1 and A:3 are usually

Define clinical manifestations associated with cancer, Define Clinical Mani...

Define Clinical Manifestations and Nutritional Problems Associated with Cancer? In the previous section we learnt that cancer results in several changes in the metabolism of ca

Explain significant proportion of starch in the normal diet, Significant pr...

Significant proportion of starch in the normal diet A significant proportion of starch in the normal diet escapes degradation in the stomach and small intestine and is labeled

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd