Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Considering the nature of negative-feedback control and the function of the respiratory system, what effect do you predict that a decrease in CO2 in the internal environment would
Planning the Nursing Care Provide bed rest Administer antibiotics as advised Prevent infection Implementation of Nursing Care Provide Bed Rest Sin
What is the treatment of tuberculosis The disease can be very effectively treated with the help of antibiotic therapy, rest and nourishing food. The key to the treatment is ear
Question 1 List various methods used for determination of blood glucose. Explain the principle of each test. Add a note on advantages and disadvantages of each method Qu
What are the phytoplankton and the zooplankton? Phytoplankton and zooplankton are parts of the plankton. The phytoplankton comprises the autotrophic floating beings: cyanobacte
What is the function of the umbilical cord? The umbilical cord is a set of blood vessels that connects the fetus with the placenta. In the fetus one extremity of the cord inse
Common Exercises You should know some of the common exercises which patient can do without help of a professional or going to a fitness club. Advise the patient to go for regul
Adult (Post natal) stem cells : act as repair system for the body replenishing specialized cells but also maintain the normal turnover of regenerative organs such as blood, skin o
Insect resistant crops (IRC) Insects are a natural selection pressure so plants resistant to certain insects could have an evolutionary advantage (in natural environments)
Which of the subsequent statements concerning platelets is INCORRECT. Platelets: a) Are between 1/2 and 1/3 the diameter of the red cell b) Are roughly disk-shaped c) Hav
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd