Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain the lingual nerve and artery, Lingual nerve and artery It is th...

Lingual nerve and artery It is the branch of mandibular nerve which enters the oral cavity above the posterior edge of the mylohyoid muscle close to the 3 rd molar region proc

What are the presumed target substrates, What are some of the presumed targ...

What are some of the presumed target substrates for cyclin-dependent kinases?

Define role in growth and cellular differentiation, Define Role in growth a...

Define Role in growth and cellular Differentiation? The growth and differentiation of epithelial cells throughout the body are especially affected by vitamin A deficiency.  In

What is the normal duration of the menstrual cycle, Q. What is the normal d...

Q. What is the normal duration of the menstrual cycle? How does the calendar contraceptive method work? The normal duration of the menstrual cycle is 28 days but it can vary am

Explain about conjugated proteins, Conjugated Proteins Conjugated prote...

Conjugated Proteins Conjugated proteins are composed of easy proteins combined with a non- proteinous substance.  The non-proteinous substance is known as prosthetic group o

Reproduction, what is the arrangement of microtubules in the sperm

what is the arrangement of microtubules in the sperm

What are the major types of animal tissue, Q. What are the major types of a...

Q. What are the major types of animal tissue? The major animal cell tissues are the epithelial tissue, the nervous tissue, the connective tissue and the muscle tissue.

Show the paleobotanical evidence, Q. Show the Paleobotanical Evidence? ...

Q. Show the Paleobotanical Evidence? Paleobotany deals with the study of fossil records of plants and animals. New techniques and approaches to the study of fossil flowering pl

Ethological isolation, Members belonging to different species refrain from ...

Members belonging to different species refrain from mating because of the behavioural differences between them. Such behavioural differences usually centre around specific courtshi

How to evaluate blanching efficiency, How to evaluate blanching efficiency?...

How to evaluate blanching efficiency? Finally, let us learn how to evaluate blanching efficiency? Normally, two of the more heat resistant plant enzymes, namely peroxidase and

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd