Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

How does caffeine effect plant growth, How does caffeine effect plant growt...

How does caffeine effect plant growth? Minerals like potassium are often found alongside caffeine when it happens in plant sources like coffee beans, and that could help the pl

State the concept of type locus interaction, State the concept of type locu...

State the concept of type locus interaction Some of the major contributions included the concept of type locus interaction, the analysis of quantitative as opposed to qualitati

What is oligosaccharides , Oligosaccharides are short chains of m...

Oligosaccharides are short chains of monosaccharides linked together by glycosidic bonds. In case of oligosaccharides  linked to proteins (glycoproteins)  or lipids (glycolipids) o

Biotechnology, Determine sequence weights for the sequences ACTA, ACTT, CGT...

Determine sequence weights for the sequences ACTA, ACTT, CGTT, and AGAT in problem 1 by using Thompson, Higgins, and Gibson method a) compute pairwise distances between sequences

What in genetics is hybridization, What in Genetics is hybridization? T...

What in Genetics is hybridization? The Hybridization in Genetics is the crossing of individuals from "pure" and different lineages in relation to a given trait that is the cros

Describe about the primary prevention - food allergy, Describe about the Pr...

Describe about the Primary Prevention - Food Allergy? Let us further, dwell on measures we could adopt in primary, secondary and tertiary prevention. Current research in primar

Blood sugar assessment, The measurement of blood sugar is of prime importan...

The measurement of blood sugar is of prime importance in the diagnosis and monitoring of patients with diabetes. You can refer sub-section 1.5.2 of Unit 1 to review about Glucose T

Heart in reptiles, Reptiles  Heart is incomplete 4 chambered, ventri...

Reptiles  Heart is incomplete 4 chambered, ventricles are not divided completely 2 auricels & 2 ventricles. Sinus venosus present, Truncus artiorsus absent [In lizzard fo

What are the cells that produce the myelin sheath, Q. What are the cells th...

Q. What are the cells that produce the myelin sheath? Of which substance is the myelin sheath formed? In the central nervous system (CNS) the myelin sheath is made by appositio

Cytogenetics, describe five features of chromosomes used in cytogenetic ana...

describe five features of chromosomes used in cytogenetic analysis?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd