Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What are the catalysts? Catalysts are substances that decrease the activation energy of a chemical reaction, facilitating it or making it energetically viable. The catalyst
Which of the following processes in capillaries in the lung assist in the removal of carbon dioxide from the body? A. Net flux of bicarbonate from plasma into red blood cells.
The plasma membrane consists mainly of: 1. Phospholipids embedded in a protein bilayer 2. Proteins embedded in a phospholipid bilayer 3. Proteins embedded in a polymer of
Assessment of Peripheral Vascular Perfusion (Beside Test) Burger's Postural Test Perform in daylight. Place patient supine with both legs elevated and knees
Which of the following does not (or did) not lay an amniotic egg? A) Birds B) Monotreme Mammals C) Dinosaurs D) Frogs E) Snakes
Explain what is Biomes and their types? Scientists study biological systems as units. For instance, an ecosystem unit consists of a community and its physical environment. The
Androgenic haploids Androgenic haploids of some species, such as wheat, mustard and tobacco, can also be raised through isolated microspore pollen culture (Pollen cultures). I
Q. Doppler evaluation for constrictive pericarditis ? 2D Echocardiography and Doppler evaluation can provide valuable clues to the presence of constrictive pericarditis. M-Mo
When a human donor gives a pint of blood, it generally requires how many weeks for body RESERVE of red corpuscles to be replaced? Is it: a) 7 week b) 3 weeks c) 1 weeks
Explain History of Plant Classification - Ancient Greeks and Romans? Hippocrates, "The Father of Medicine" (460-377 B.C.) is reputed to have been one of Democritus 's disciples
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd