Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Which of the following serves as an actuating signal, or as part of an actuating signal, in a negative feedback system? A. Blood plasma levels of Glucose. B. Blood plasma le
Define General Characters and Classification of Arthropoda? These are metamerically segmented animals with an exoskeleton of cuticle. Scliizocoelic coelom is much reduced and is
Assume that after washing your hands, you leave ten bacteria cells on a new bar of soap. You then decide to do a plate count of the soap after it was left in the soap dish for 24 h
You have 200 cells and find 120 in interphase, 57 in prophase, 8 in prometaphase, and 5 in metaphase, 8 in anaphase and 2 in telophase. (None in G0 phase). it takes 18 hours to com
Explain about the Macro Minerals? Previously we learnt about the structure, properties, deficiencies/toxicity and recommended dietary intakes of several vitamins. In this unit,
How do the cheek and onion cells visually resemble one another, and why are shapes of squamous cells so different than the onion cells?
Dietary counseling based on the food pyramid concept and the food to target concept will be quite useful in the management of the disease. The optimal age for discontinuing the
Quantification of Tricuspid Regurgitation Echocardiography and right ventricular angiogram can quantify tricuspid regurgitation. Echo Quantification Trivial: Non susta
Define Metabolic utilization of carbohydrates? Following absorption, the monosaccharides enter the portal circulation and are carried to the liver. Both galactose and fructose
advantage sand disadvantages of protozoa
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd