Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Determine what is dermal branchiae? External extensions of outer epidermis and peritoneum of the echinoderm body cavity. Both outer epidermis and inner peritoneum are lined wit
Q. What do you mean by Echinodermata? You will recall that Pliylum Echinodermata includes spiny skinned animals which are exclusively marine (Gr, echinus : spiny; derma: ski
Sympatric speciation can be regarded as speciation where parent species gives rise to a daughter species without the individuals of a species being separated by space or territory.
Which of the following is true for a G-protein? A. After the ATP-ase of the alpha subunit of a G protein converts the ATP bound to the alpha subunit to ADP and inorganic phosph
X-ray Chest It is helpful in assessing heart size. One should look for presence of pericarditis, pulmonary oedema or pulmonary congestion. ECG One should look for pro
Transfer RNA (tRNA) molecules play an very significant role in protein synthesis. Each tRNA becomes covalently bonded to a particular amino acid to create aminoacyl- t
Fast Response - Biological Responses Some of the fast responses are discussed below: It was found that when mung bean root tips were kept in a specific solution (contain
Define Supplementation to prevention of iron deficiency anaemia? Supplementation with low doses of iron is necessary to prevent anaemia in particular groups of people. Fortifie
Q. What is the intermediate host of Schistosoma mansoni? Where does that host live? The intermediate host of a schistosome is a gastropod mollusc, Biomphalaria genus and a snai
Define Function of thiamin as Regulator of enzyme activity? Thiamin regulates the enzymes involved in carbohydrate metabolism. These are: a) Pyruvate dehydrogenase, which pr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd