Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Basic Properties To Proteins, To Be a Good Foaming Agent? A protein must: a) Be able to rapidly absorb at the air-water interface during whipping, b) Undergo rapid
Just definition
Q. Direct use values of biodiversity? Direct use values are for those goods that are ensured directly e.g. food and timber. Maintaining a wide range of components of biological
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
Medical Management Trealment of choice is cephalosporin which is given interavenously, alternatively can be given. In case of increased intra cranial pressure mannitol and o
Q. Explain Bruce Protocol? Bicycle Ergometry Most bicycle test are performed sitting upright, but supine bicycle test have become more popular. Treadmill Test The
Q. How is carbon dioxide released by cellular respiration transported from the tissues to be eliminated through the lungs? In vertebrates almost 70% of the carbon dioxide is ca
Cell Theory The term cell was first used by an English cytologist, Robert Hooke (1665) not for unit protoplasmic masses, but for the well defined and empty compartments, he obs
Q. What are the main types of cancer that affect humans? An Excluding skin cancer, that are the more easily detected and so cases are registered in larger number, the main type
What are the functions of insulin and glucagon for the blood glucose control? Glucagon enhances glycemia and insulin reduces it. They are antagonistic pancreatic hormones. Gluc
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd