Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is Plant Tissues explain there types? Vascular plants have separate organs to carry out specialized functions. For instance, leaves function to convert radiant energy to
Is water a polar or a non-polar molecule? What is the consequence of that characteristic for the function of water as solvent? Water is made of two atoms of hydrogen attached b
Explain the Heat Fixation Method? This is the usual method. Here, bacteria is fixed by gentle heating of air-dried bacterial film, which results in coagulation of bacterial pro
Degrade a monoglyceride that has an 18-carbon fatty acid attached to it by Ester bonds. You will have to degrade the glycerol component followed by the fatty acid in presence of O2
Describe in detail about the Cytoplasm Cytoplasm also possesses a number of dense granular elements (about 25,000 per cell) called the ribosomes, which are the sites of protein
What does the formula DPD = SF - TP mean? DPD is the abbreviation of diffusion pressure shortage, SF (suction force) is the vacuolar osmotic pressure and TP is the turgor press
Q. Explain the Physiologic mechanism of osseointegration It has been suggested that the physiologic mechanism for maintaining osseous integration is a sustained evolution in re
Q. Genetic resources of biodiversity? Genetic diversity or the gene pools are important for promoting and ensuring high agricultural yield. Genetic diversity provides crops wit
Describe Schizocoelus and its role. One of two ways that a body cavity forms within mesoderm. (The other is enterocoelic pouching.) Block of mesoderm splits apart to create the
Describe Alternation of Generations? Alternation of Generations : In meiosis, four haploid daughter cells are formed from one diploid mother cell. The life cycles of sexuall
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd