Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Other complications of prosthetic valves, Other Complications of Prosthetic...

Other Complications of Prosthetic Valves :  One of the dreaded complications of mitral valve replacement is ventricular rupture. It is difficult to manage and so it is better avoi

Impact of user charges or fees, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Phylum, what is phulum cnideria

what is phulum cnideria

Explain about maple syrup urine disease, Q. Explain about Maple Syrup Urine...

Q. Explain about Maple Syrup Urine Disease? Maple Syrup Urine Disease (MSUD) is a group of inherited metabolic disorders of three branched chain amino acids (BCAA) namely leuci

What are atherosclerosis, Atherosclerosis, the most common part of hardenin...

Atherosclerosis, the most common part of hardening of the arteries, is characterized by the presence of cholesterol-rich arterial thickenings (atheromas).  This progressive  diseas

Potassium, Potassium, Calcium, Iron and Magnesium - Microorganism? Thes...

Potassium, Calcium, Iron and Magnesium - Microorganism? These are supplied by inorganic salts and exist in the cell as cations. These perform various functions in the cell like

Explain back pain, Explain Back pain, arthritis and gout - Effect of Obesit...

Explain Back pain, arthritis and gout - Effect of Obesity? Abdominal obesity increases the risk of back pain because of the extra load on the spinal column. This, in turn, red

Which does not contain a guanidinium group, Which of the following does NOT...

Which of the following does NOT contain a guanidinium group Select one: a. Urea b. arginine c. creatine d. guanidinium ion

Explain poor growth - clinical signs of kwashiorkor, Explain Poor growth - ...

Explain Poor growth - clinical signs of kwashiorkor? Growth retardation is the earliest manifestation of kwashiorkor, the child will be lighter and shorter than its normal peer

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd