Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain the gradient theoryof experimental embryology
Explain the pair of chromosomes and Sex Chromosomes? Morgan also noticed that one pair of chromosomes is different in male and female flies, one of the male chromosomes being
For the cross in Part B, predict the frequencies of each of the phenotypes in the F1 progeny, and determine the genotype(s) present in each phenotypic class. Complete the diagram b
What are the differences between blood retinal barrier and blood aqueous barrier? Blood Retinal Barrier: Blood retinal barrier is present in retina. In retina there are t
Topical Route The medication in topical route is administered through ear, nose and eye. Drops are instilled into the nose, ear and eyes of the child in much the same way
Q. How mineral salts participate in enzymatic activity? Many mineral salts are cofactors of enzymes that are the substances without which enzymes do not work.
what normally cause type one sugar diabetes
Q. Can you explain Ventricular Septal Defect? VSD can be found in various part of ventricular septum hence all possible views except suprasternal views are used to detect an
Name the location and function of Meibomian glands in the human eye. a) What is cryopreservation? Give its single use. b) Commercial importance of cryopreservation is relate
What are the inheritance and dominance patterns of the Rh blood system? The inheritance pattern of the Rh blood system is autosomal dominant, i.e., the heterozygous manifests a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd