Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is plant tissues explain there types, What is Plant Tissues explain th...

What is Plant Tissues explain there types? Vascular plants have separate organs to carry out specialized functions. For instance, leaves function to convert radiant energy to

Is water a polar or a non-polar molecule, Is water a polar or a non-polar m...

Is water a polar or a non-polar molecule? What is the consequence of that characteristic for the function of water as solvent? Water is made of two atoms of hydrogen attached b

Explain the heat fixation method, Explain the Heat Fixation Method? Thi...

Explain the Heat Fixation Method? This is the usual method. Here, bacteria is fixed by gentle heating of air-dried bacterial film, which results in coagulation of bacterial pro

Degrading monoglyceride, Degrade a monoglyceride that has an 18-carbon fatt...

Degrade a monoglyceride that has an 18-carbon fatty acid attached to it by Ester bonds. You will have to degrade the glycerol component followed by the fatty acid in presence of O2

Describe in detail about the cytoplasm, Describe in detail about the Cytopl...

Describe in detail about the Cytoplasm Cytoplasm also possesses a number of dense granular elements (about 25,000 per cell) called the ribosomes, which are the sites of protein

What does the formula dpd = sf - tp mean, What does the formula DPD = SF - ...

What does the formula DPD = SF - TP mean? DPD is the abbreviation of diffusion pressure shortage, SF (suction force) is the vacuolar osmotic pressure and TP is the turgor press

Explain the physiologic mechanism of osseointegration, Q. Explain the Physi...

Q. Explain the Physiologic mechanism of osseointegration It has been suggested that the physiologic mechanism for maintaining osseous integration is a sustained evolution in re

Genetic resources of biodiversity, Q. Genetic resources of biodiversity? ...

Q. Genetic resources of biodiversity? Genetic diversity or the gene pools are important for promoting and ensuring high agricultural yield. Genetic diversity provides crops wit

Describe schizocoelus and its role., Describe Schizocoelus and its role. ...

Describe Schizocoelus and its role. One of two ways that a body cavity forms within mesoderm. (The other is enterocoelic pouching.) Block of mesoderm splits apart to create the

Describe alternation of generations, Describe Alternation of Generations? ...

Describe Alternation of Generations? Alternation of Generations :  In meiosis, four haploid daughter cells are formed from one diploid mother cell. The life cycles of sexuall

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd