Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Viscosity Viscosity, as you may already know, is associated with fluid flow. It is the internal friction which tends to bring to rest portions of the fluids moving relative to
Glycogenesis : This is an anabolic process in which glucose is polymerized into glycogen by the sequence of reactions. Since glycogenesis occur in all body cells .but
Iron Deficiency Anaemia This is the most common nutritional and haematologic disorder in infancy and chhildhood in developing countries. It is caused by lack of sufficient i
Q. What is aquatic biodiversity? Biodiversity found on Earth today is the result of 3.5 billion years of evolution. Until the emergence of humans, the Earth supported more biod
Necessity of Transport in Phloem Leaves produce photoassimilates and support various tissues including roots. The excess photoassimilates and metabolites stored in specialised
Dr. Herbert discovers a cell and he is convinced it is a plant cell. However, as a student of his genetics class, you do not agree with him. You do not believe in microscopy and ph
What is Glands? The central nervous system controls much of the endocrine system through the hypothalamus. The hypothalamus directs many of the body's functions through the "ma
Exceptions to the Cell Theory Viruses, however, are not the only exception to the Cell Theory as formulated earlier. This has led scientists to take a much broader view of the
Admission Information The physician and nurses are the primary source of facts concerning the purpose of therapeutic plan and expected outcome of hospitalization. The informa
Name the subcellular particle where the electron transport chain is located. Mitochondria is the subcellular particle where the electron transport chain is located.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd