Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. How different are hemoglobin and oxyhemoglobin? Where is it expected to find a higher concentration of oxyhemoglobin, in peripheral tissues or in the lungs? Oxygen-bou
why does an organism internal environment change
Which of the below determines the major difference between bryophytes (pron: bry-oh-fites) and tracheophytes (pron: tray-key-o-fites)? a) Tracheophytes can make their own food
W A TER Occurence Water is the most abundant substance, covering 70% of earth's surface. It constitutes 60-90% of living cells. 5-6% in tooth e
Q Which are the molecules that make possible active transport during membranes? Active transport is prepared by specific membrane proteins. These proteins are known as "pumps"
Can the amount of available energy in a given trophic level be larger than the available energy in inferior trophic levels? What does that condition means to the conformation of th
Regulation of HMP Pathway The following factors play an important role in regulation of HMP pathway: a) The first reaction of this pathway catalysed by glucose-6-phosphate
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Hybrid sterility can be regarded as yet another form of interspecific sterility. The offspring of the interspecific crosses are mainly sterile. Geological studies have shown that t
What is the primary energy source for life on earth? The primary energy resource for life on earth is the sun. The sun plays the vital role of keeping the planet warmed and it
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd