Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Why does scientist think that RNA was the first genetic material?
Q. How Cleaning agents works? Food particles and other debris provide good nutrients for the nlicroorganisms to grow. In fact, the food particles protect microorganisms d
Select all that are true/correct: Cellular respiration consists of the production of ATP in several steps using enzymes. Photosynthesis produces carbohydrates using carbon dioxide
Occur in 10 per cent to 40 per cent of all native-valve IE, and complicates aortic IE more commonly than mitral or tricuspid IE. Periannular infection is of even greater concern wi
Blood functions to maintain homeostasis in the human body through all but which of the following: Answer moving carbon dioxide away from cells following completion of aerobic metab
Q. What is the virus that causes flu? Why doesn't the body produce permanent immunity against that virus? How does the vaccine against flu work? Flu is a disease caused through
Explain the Virtual Dissection of the Rat in multimedia tutorials? This animation will teach you about basic mammalian anatomy. The major organ systems in a rat are very simila
Elastase The inactive proelastase is activated by trypsin to the active form elastase. Elastase attacks peptide bonds next to the small amino acid residues such 3s g
What happens to respiratory system in a man going up a hill?
In general compare and contrast the three functional classifications of joints according to movement. What are two characteristics that make synovial joints unique and different fr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd