Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Infective endocarditis (IE) is a microbial infection of the endothelial surface of the heart. The characteristic lesion, the vegetation, is a variably sized amorphous mass of plate
two main evolutionary novelties presented by annelids
Which of the following compounds results from cyclization of glucose? Select one: a. alpha-D-glucopyronose b. beta-D-glucopyronose c. alpha-D-glucofuranose d. beta-D
Seminal plasma in human males is rich in : 1. fructose and calcium 2. glucose and calcium 3. DNA and testosterone 4. ribose and potassium Fructose and Calcium
Scope for public nutrition
what is mode of nurtion of earth worm/
Q. What are peristaltic movements? What is their role in human digestion? Peristalsis is the process of synchronized contractions of the muscular wall of the digestive tube, Pe
Q. What is the difference between sexual gametes and spores? Do humans present sexual gametes or spores? Sexual spores are structures generated from meiosis with ploidy number
Q. What are the major significant organic molecules for living beings? Ans. There are many types of organic molecules that are important for the living beings. Particularl
Chilling and Flower Induction Some plants flower only after passing a winter season. For example, winter wheat is sown in the autumn for harvest in the following summer. It ne
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd