Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain History of Plant Classification - Ancient Greeks and Romans? Hippocrates, "The Father of Medicine" (460-377 B.C.) is reputed to have been one of Democritus 's disciples
Are the xylem and the phloem made of living cells? The cells that constitute the xylem ducts are dead cells killed by lignin deposition. The cells of the phloem are living
B o vi n e spongiform encephalopathy (BSE) Bovine spongiform encephalopathy (BSE) is a transmissible, neurodegenerative, fatal brain disease of cattle characterized by post
Q. In the phase when the cell is not dividing interphase is there activity within the cell nucleus? In the interphase there is intense metabolic activity in the cell nucleus th
Potassium Potassium, the third most abundant mineral in the body, is the major cation in intracellular fluid. Forages are excellent source of potassium, usually containing 1 t
Define the Dietary Sources and Chemical Forms? Isoflavones and coumestans are the most common compounds. Soybeans and soyfoods are the most important sources, containing approx
Q. What is a population? In the Biology a population is a set of individuals of the same species living in a given place and in a given time.
What are the main human diseases caused by virus? Between diseases caused by virus are common cold, flu, mumps, variola (considered eradicated nowadays), rubella, AIDS, measles
What are the classes in Phylum coelenterata?
Hormon e . The chief cells of the parathyroids secrete a hormone called parathyroid hormone (PTH) or parathormone or also called Collip's hormone after the name of its discove
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd