Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What do you understand by taxonomy? Taxonomy is dependent on many sciences and they in turn are equally dependent on it. The activities of a taxonomist are basic to all othe
Wet Stigma - Category of Stigma Petunia shows several randomly distributed 2-celled papillae on its surface. In a developing stigma, the epidermis is covered by a continuous,
R a d i o g raphic imaging: Radiology has been in use since the discovery of X-rays by Wilhelm Conrad Roentgen in 1895. Until 1980s, radiography was the
Explain about the Musculoskeletal System? Osteopenia (decrease in bone mineral content) is observed with aging. There is an average of 30% decline in the bone mineral density f
Q. How to investigate aortic stenosis by Electrocardiogram? Typically left ventricular hypertrophy with strain pattern is seen in severe aortic stenosis. Total QRS amplitude in
Name TWO choices of microscope and stain (if stain should be used) that you could use to view each of the following. For example, to view human cheek cells you could use (1) bright
Infectious laryngotracheitis (ILT) Infectious laryngotracheities, caused by fowl Gallid Herpesvirus 1 belonging to the family Herpesviridae, is a quickly spreading acute res
The cystic fibrosis allele occurs in European populations with q=0.02, what fraction of this population can be expected to have cystic fibrosis?
Two true-breeding pea plants were crossed. One parent is round, terminal, and violet, constricted, while the other expresses the respective contrasting phenotypes of wrinkled, axia
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd