Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define prevention in the prevalence of overweight or obesity, Define Preven...

Define Prevention in the prevalence of overweight or obesity? It is believed that the increase in prevalence of obesity worldwide is more due to the environment that has become

Human respiration, Human respiration Human beings are adopted for ter...

Human respiration Human beings are adopted for terrestrial mode of life. They conduct pulmonary respiration. This system consists of external nostrils, nasal cavities, pharyn

DNA REPAIR, assignment for discussing DNA REPAIR

assignment for discussing DNA REPAIR

Dot blot, Dot blot  is the technique for measuring the amount of one pertic...

Dot blot  is the technique for measuring the amount of one perticular DNA or RNA in the highly complex mixture. The samples are spotted onto the hybridization membrane (like nitroc

What is homogenization, What is homogenization Emulsions may also be st...

What is homogenization Emulsions may also be stabilized by a process known as homogenization, in which the size of the dispersed fat globules is greatly reduced to more or less

Enumerate about the minerals and rocks, Minerals and Rocks      A mine...

Minerals and Rocks      A mineral is an inorganic body, formed by the process of nature, usually having a definite composition. If formed under favourable conditions, it has a

Define fatty acid synthesis, Fatty acid synthesis is the formation of fatty...

Fatty acid synthesis is the formation of fatty acids from malonyl-CoA and acetyl-CoA precursors by action of enzymes called as fatty acid synthases. It is a very significant part o

Bioclimatology effect of climate on distribution of organism, Bioclimatolog...

Bioclimatology: This is the study of effect of climate on distribution of organisms. Bioclimatology is the inter-disciplinary field of science which studies the interactions betwe

What is the use of vitamin a dry powder, Vitamin A dry powder Vitamin A...

Vitamin A dry powder Vitamin A dry powder is used in the (manufacture of dry mixtures) for which the oily ester concentrates are unsuitable or undesirable. Mainly, they are inc

List in sequential order the organelles, Starting from a ribosome in the cy...

Starting from a ribosome in the cytosol, list in sequential order the organelles and cellular components a secreted protein would encounter from translation to secretion.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd