Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Briefly Describe about the Micro Minerals? The last unit focused on the macro minerals. Now in this unit we will study about the micro minerals, namely, iron, zinc, copper, sel
Q How does the presence of exoskeleton describe the general small size of arthropods? Since they have periodic ecdysis and exoskeleton, the growth of arthropods is limited to a
Phylum Ascomycetes 1) Sexual reproduction is by conjugation and is followed by the formation of ascospores inside a sac called ascus. 2) The asci may be grouped together to
Define effect of Fat on quality and quantity of human milk? Fat content of milk appears to be subject to variability as compared to other constituents. The average fat content
Give two examples in each case of organs or tissues in which you would expect (a) meiosis, (b) mitosis to be taking place a) Meiosis is likely to
Q. What is the explanation for the bleeding that accompanies menses? The hemorrhage that accompanies menses occurs because the endometrium is a richly vascularized tissue and t
GOLGI APPARATUS Camillo Golgi in 1898 discovered a reticular structure in the cytoplasm of nerve cells with the help of metal impregnation technique using silver nitrate for whic
Occurrence of vitamin B 12 Vitamin B 12 is one of the cobalamin, a group of active principles widely occurring in nature. Vitamin B 12 is present especially in liver, kidney
Describe how many bones are there in human foot The human foot is a great mechanical marvel. It has 26 bones, 29 joints, and 42, various ligaments, a sensitive and protective s
what arachnid is beneficial
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd