Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Post-partum anoestrus Reproductive efficiency among animals greatly depends upon detection of estrus. This is even more important in reference to small herds managed under tro
Fungal Infections Intravenous infusion of amphotericin B deoxycholate frequently causes fever and chills, and sometimes headache, nausea, vomiting, hypotension and tachypnea,
Predation is a process by which one organism (predator) eats another organism (prey). If the prey population is abundant, the predator population also becomes abundant. If the pred
Q. What is an etiological agent of disease? The etiological agent of disease is the agent that causes the disease. It may perhaps a living being, substance or environmental fac
What are all possibilities of genotypes and phenotypes formed in the combination of alleles responsible for the production of factor VIII? Considering the alleles X and Xh, whe
The law of contract is that the branch of law which determines the circumstances in which promises made by the parities to a contract shall be legally binding on them. Its rules de
Asexual Reproduction - Its Prevalence and Significance Having studied the several aspects of asexual reproduction in the non-chordates we can now make a few generalizations.
Q. Causes of Mitral Regurgitation? Mitral regurgitation is the most common valvular abnormality seen in clinical practice. Different disease processes leading to mitral regurgi
Q. What is Dyslipidemia or Hyperlipidemia? It has been known for over five decades now that dyslipidemia is associated with increased severity and prevalence of atherosclerosis
Buccal Perforations Buccal concavities in the bone can result in some threads of the implant being exposed. Where these are very circumscribed and covered with thick and well-
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd