Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is the respective importance of water, What is the respective importan...

What is the respective importance of water, carbon and nitrogen for living beings? Water is the major solvent of living beings and it is essential practically for all biochemic

Do plants present only sexual reproduction, Q. Do plants present only sexua...

Q. Do plants present only sexual reproduction? There are asexual forms of reproduction in plants few naturally detached pieces of root, leaves or limbs develop into another com

Pleuritis, P l e u r iti s It is the acute or chronic inflammatio...

P l e u r iti s It is the acute or chronic inflammation of the pleural membranes. It is characterized by pain during respiration, pleural effusion, and shallow rapid resp

Illustrate about mylohyoid muscle, Mylohyoid muscle Surgical manipulati...

Mylohyoid muscle Surgical manipulation at the crest of a severely resorbed ridge may injure the mylohyoid muscle. Manipulation of the tissues of the floor of the mouth for plac

Define prevention of vitamin a deficiency, Define Prevention of vitamin A d...

Define Prevention of vitamin A deficiency? Since dietary inadequacy is the major cause for micronutrient deficiencies, the most rational approach to prevent these deficiencies

What is Bile salts , Bile salts or bile acids are polar derivatives of...

Bile salts or bile acids are polar derivatives of constitute and cholesterol the major pathway for the excretion of cholesterol in mammals.  In the liver, the cholesterol is circul

Pporifera, write the general account of porifera

write the general account of porifera

The difference between high and low c, How does brain recognize difference ...

How does brain recognize difference between high and low c and soft and loud sounds?

Diagnosis, D i a g no s i s Diagnosis, the key for successful ma...

D i a g no s i s Diagnosis, the key for successful management of the disease problem, refers to identification of the cause of a disease. The process of diagnosis requir

What is antimicrobial resistance, Question 1 What is antimicrobial resista...

Question 1 What is antimicrobial resistance? List the reasons for antimicrobial resistance. Explain why antimicrobial resistance is a global concern. Add a note on various mechani

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd