Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
List a few applications of starches in the food industry. A few applications of starches in the foods industry include thickener, a fat sparing agent, adhesive, binder,
Determine the Principle of Brain and Behaviour A second principle is that insight into children's adaptation can be gained through an analysis of brain behaviour relationships.
Q. Described Microbiology of Air? Ans. You would realize that air, by nature, does not contain a natural flora of microorganisms. All that comes into air is by accident and i
What is crossing over? In which period of meiosis does this event occur? Crossing over is the eventual exchange of chromosomal fragments among homologous chromosomes. The pheno
Define Sterol Regulatory Element Binding Proteins (SREBPS)? These belong to a general family of transcription factors. They are synthesized as membrane embedded proteins in res
WHAT IS THERE BETWEEN THE TRACHEA OF COCKROACH AND RABBIT
Question 1 : What do you meant by medical writing? Show various types of medical writing. Define and explain briefly medical writing Discuss various types of medical w
How successful are you at synthesizing genes with really high G/C content? A: We have an extremely low failure rate, which is about one out of five thousand or ten thousand gen
What are the precautions to be taken when harvesting autogenous bone grafts from mandibular symphysis and ramus? When harvesting grafts from the mandibular symphysis region, fo
URINARY BLADDER - Pear shaped sac like. Situated in pelvic region of abdominal cavity. Ventrally placed. Lined by transitional epithelum. Detrusor muscle i.e. to expell out
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd