Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define about the Micro Minerals? Micro minerals are those minerals, which comprise less than 0.01% of the total body weight and are required in concentrations of one part per m
Interferons are small glycoproteins formed by virus-infected cells that inhibit viral infection. They are heterogeneous. Gamma interferons induce MHC class II antigens in macrophag
How are platelets formed? What is the function of platelets? What consequences does the clinical condition known as thrombocytopenia yield? Platelets, also called as thrombocyt
Q. What are the antigen-presenting cells of the immune system? The antigen-presenting cells of the immune system also known as APC cells are cells that do digestion and phagocy
Why do we need a family of proteins for cell adhesion (what is the advantage of having a family of proteins?)
Define some features of Penicillium? The identifying features of Penicillium are: 1. Mycelium consists of colourless, septate and branched hyphae, some of which grow inside
Following are the advantages of the DSME: It enables the patient to 1. Accept the disease. 2. Gain knowledge about disease, its prevention, treatment and management. 3.
Q. Is the ventricle lumen larger during diastole or during systole? During diastole the opposite occurs. The muscle fibers of the ventricles relax and the lumen of these chambe
Define Etiology and Clinical Features of Epilepsy? This disorder usually starts in childhood, with the peak incidence between birth and two years. Etiological factors include
There are three methods of collections: 1. Kerbside collection: In this collection system the refuse is brought in containers and placed on the footway, from where it is
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd