Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Global Air Circulation The major wind systems of the earth result because large masses of air around the earth's equator are forced to rise from the bottom due to surface heati
Define Function of the Iron Uptake by Cells? Iron has several vital functions in the body. It serves as a carrier of oxygen to the tissues from the lungs by red blood cell haem
Ventilation of Tracheal System – Passive Suction Ventilation Many active insects and insects that live in environments where water is scarce cannot depend on diffusion alone t
Define Observation for Benedict Test - Carbohydrates? An insoluble reddish brown precipitate of cuprous oxide will be obtained. This is similar to Fehling's test. The reddis
#question.characteristics of coelenterata?.
All about thallophyte
Q. What is the difference between temporal summation and spatial summation of muscle fibers? What is tetany? Spatial summation is the recruiting of new muscle fibers to incr
African horse sickness African horse sickness (AHS) is a highly fatal insect born viral disease of equidae caused by an Orbivirus (family Reoviridae) and characterized by sever
What are the main symptoms of the pulmonary and of the intestinal phases of the ascaris infestation? In the pulmonary stage the ascaris infestation causes cough, hemoptysis, dy
Q. Enlist the various modalities available for sterility assurance? Various modalities available for sterility assurance are a) Prevention of overloading b) Chemical indi
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd