Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Disease Control and Prevention reports: Body Mass Index is a reliable indicator of body fat for most children and teens. BMI is calculated from a child's weight and height is
EXAMPLES OF NATURAL SELECTION - 1 . INDUSTRIAL MELANISM - First studied by Fischer & Ford (1845) on pepperd moth (Biston betularia) of two types : grey moth (B.
Prevention of Accidents - Accidents and Losses The theories of accident causation explained earlier serve as good guide to prevent accident. The factors that may cause acciden
true or false. the law of entropy says that all energy is ultimately derived from the sun
Define the Functions of Vitamin A? Vitamin A (retinol) is an essential nutrient needed in small amounts by humans for the normal functioning of the visual system, growth and de
Which of the following is a situation in which a closed-loop negative feedback system is converted to an open-loop system? A disease that destroys all the A. V2 Receptors in a
Define the Water Bath with Shaker? An electric water bath with a shaker that can hold test tubes as well as conical flasks. When on a non-shake mode, it acts as a simple water
Explain about the Cheese Making - methods of food processing? Cheese is a way of preserving milk for long periods of time. In this process, the milk in cheese becomes something
Rectum check for anal patency and passage of meconium and observe whether meconium is passed or not. Confirm its patency then pass a catheter or gloved finger check if
Define the Water activity - Microbial Survival? It is the amount of water available to the organism. In general, requirement for water activity is more for bacteria (minimum 0.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd