Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Do the arteries that carry blood from the heart to the lungs contain arterial or venous blood? What happens to the blood when it passes through the lungs? Arteries of the pu
Haploid Production The higher plants are normally diploid, with two sets of chromosomes in their somatic cells. Their haploids (with one set of chromosomes) arise in nature by
Define the term - lateralisation and localisation Discriminative validity studies including lateralisation and localisation achieved satisfactory results, but the localisation
INTRODUCTION : It took just hundred years for cardiac surgery to advance to what it is today. Before 1896, surgeons considered heart to be "inviolable" and it was stated that ope
Define the Wealth Care Delivery ? The challenge that exists today in many countries is to reach the whole population with adequate health case services and to ensure their util
I dissolve 4µg of DNA in 1mL of water. How much of this solution would I need in order to add 10ng of DNA in a reaction?
what re conjugated proteins and how are they classified?
Define the Public Nutrition Public nutrition is concerned with improving nutrition in populations in both poor and industrialized countries, linking with continuity and public
Q. Define Pacinian corpuscules? Pacinian corpuscules are an example of sensory receptors scattered deep in the subcutaneous tissue underlying skin or in viscera. These mech
What is Tetralogy of Fallot ? Figure: Anatomical location of tetralogy of fallot Indications for Surgery : The diagnosis of tetralogy is considered as an indicatio
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd