Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Phyletic lineage, Ask questiona brief assignment on it #Minimum 100 words a...

Ask questiona brief assignment on it #Minimum 100 words accepted#

Illustrate basic working of pineal gland, Q. What is the pineal gland? ...

Q. What is the pineal gland? The pineal gland also known as epiphysis or pineal body is situated centrally in the head. It secretes the hormone melatonin. A hormone produced at

Blood and its composition, BLOOD - Blood is a mobile connective tiss...

BLOOD - Blood is a mobile connective tissue composed of a fluid, the plasma and the cells, the blood corpuscles. Blood is basis of life. Blood is the softest tissues

Meiosis comprises two separate divisions, All of the following make meiosis...

All of the following make meiosis different from mitosis; EXCEPT A. Meiosis comprises two separate divisions. B. Meiosis only occurs during embryonic development. C. Chromoso

Explain about pre - diabetes, Q. Explain about Pre - Diabetes? Pre - Di...

Q. Explain about Pre - Diabetes? Pre - Diabetes is a condition where blood sugar level is above normal but below to be diagnosed as diabetes mellitus. It has been found that

Blood formation, why are blood formed at bones or joints

why are blood formed at bones or joints

Determine the end of the meiotic process during oogenesis, What is the rela...

What is the relation among fecundation and the end of the meiotic process during oogenesis? The oocyte II only completes the second meiotic division (interrupted at metaphase) i

Cellular transport, Cellular Transport Cellular transports demote to th...

Cellular Transport Cellular transports demote to the movement of compounds across the outer wall or membrane of the cell. This transport is critical in two respects. Firstly, t

Mitosis, What are the steps of mitosis in order?

What are the steps of mitosis in order?

Mr, Define animals

Define animals

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd