Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain factors influencing rs content of foods? 1) Presence of sugar and lipids: Studies so far show that presence or addition of lipids and sugar reduces RS content. 2) Ca
Define Nutritional Requirements of Fats and Oils? As with the other macronutrients, we do compute requirements of visible fats too for all age groups and give guidelines for se
pisces kingdom
Q. What do you mean by Subxiphoid Long Axis Sweep? This sweep begins with keeping the transducer at subxiphoid region, positioning directly posterior with marker pointing towar
Before we further proceed to discuss the fossil history of the humans we shall briefly look into what distinguishes humans or genus Homo from his ancestors namely the apes. These d
Which of the following require ATP? The movement of potassium from the outside of the neuron to the inside? The movement of sodium into the neuron through a chemically gated
Explain about Battery Battery: Two electrodes (zinc and carbon) placed in electrolyte (dilute sulfuric acid). Chemical reactions in electrolyte force positive charges to
Patients with heart failure have a high incidence of both symptomatic and asymptomatic arrhythmias. About 10 per cent of patients have syncope or presyncope resulting from ventr
Infectious canine hepatitis The disease is caused by type-1 canine Adenovirus in the family Adenoviridae. The disease appears in pups as peracute, acute, and mild. The clinica
Kangroo Rat Kangroo rat Dipodornys merriami, a native of South-West America is a classical example of how small mammals survive in desert. It exhibits all the osmoregulatoryad
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd