Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What organisms make starch? What is it used for? What organisms make glycogen? What is it used for?
Conduct a test of hypothesis to verify whether a difference exists among the average numbers of ant species found at sites in the two regions of Mongolia. Use . You will require
Q. Concerning the occurrence of separated sexes how are the beings of the phylum Annelida classified? These beings may be dioecious (the majority of polychaetes) or hermaphrodi
The technical term used for the androecium in a flower of China rose (Hibiscus rosasinensis) is: 1. Monadelphous 2. Diadelphous 3. Polyandrous 4. Polyadelphous
What are the different mechanisms responsible for corneal avascularity? Various mechanisms responsible for its avascularity are as follows: a) Chemical Theory: I) Role o
Explain Methods of Protein Estimation? Several methods for protein estimation are available. These methods are based on several analytical characteristics of the protein. Labor
Q. What is Dyslipidemia or Hyperlipidemia? It has been known for over five decades now that dyslipidemia is associated with increased severity and prevalence of atherosclerosis
Carpentier -Edwards Valve (C-E) : This is porcine aortic valve preserved in gluteraldehyde and mounted on flexible stent made of cobalt-chromium-nickel alloy (ELGILOY). Glut
Acute Myocardial Infarction : Patients with acute non-Q myocardial infarction may need urgent intervention as indicated for cases of unstable angina.
Define Methods of Quantitative Analysis and Colorimetry? Many methods of quantitative analysis are based upon the production of coloured solutions in such a way that the intens
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd