Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define the equilibrium potential for potassium ions, A complete motor neuro...

A complete motor neuron is removed from a frog and placed in a large volume of normal physiological saline.  The neuron is healthy; it has a stable resting voltage of -70 millivolt

How do they affect the processing of genetic information, Q. What are intro...

Q. What are introns, and how do they affect the processing of genetic information? Introns, a feature of eukaryotic DNA, are intervening stretches of DNA lying between the exon

Deficiency diseases-zinc deficiency, Zinc deficiency Zinc is essential ...

Zinc deficiency Zinc is essential for several physiological functions in the body such as protein synthesis, carbohydrate and nucleic acid metabolism, and foetal growth. The de

What is gametogenesis, What is the type of cell division that allows sexual...

What is the type of cell division that allows sexual reproduction? What is gametogenesis? Meiosis is the type of cell division that permits sexual reproduction since it decreas

How does the hypophysis-corpus luteum negative feedback work, How does the ...

How does the hypophysis-corpus luteum negative feedback work? What is the name given to the atrophied corpus luteum after this feedback process? After ovulation the estrogen an

Internal structure of mammalian heart, INTERNA L STRUCTURE - Wall o...

INTERNA L STRUCTURE - Wall of auricles are thin than wall of ventricles, because they have to push the blood to ventricles only situated close to them. Walls of ventricl

Simple proteins, SIMPL E PROTEINS The proteins are made of amino acids...

SIMPL E PROTEINS The proteins are made of amino acids only. Additional chemicals are absent. These are of two types -    (i) Fibrous        (ii) Globular ( i )

Molecule synthesis and molecule break-down, Match dehydration reaction and ...

Match dehydration reaction and hydrolysis reaction to molecule synthesis and molecule break-down

Human evolution, In the last unit we traced the human evolutionary history ...

In the last unit we traced the human evolutionary history mostly from a palaeontological viewpoint. Although still fragmentary, the available fossil evidence makes it possible to c

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd