Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Which phase of the menstrual cycle does nidation occur, Q. What is nidation...

Q. What is nidation? In which phase of the menstrual cycle does nidation occur? Nidation is the implantantion of the embryo in the uterus and Nidation takes place around the 7t

Describe alternation of generations, Describe Alternation of Generations? ...

Describe Alternation of Generations? Alternation of Generations :  In meiosis, four haploid daughter cells are formed from one diploid mother cell. The life cycles of sexuall

Definition of osseointegration in microscopic biology, Q. Definition of Oss...

Q. Definition of Osseointegration in microscopic biology? From a view point of macro and microscopic biology and medicine. Osseointegration of a fixture in bone is defined as t

Fertilization in earthworm, In earthworms, when the ovaries mature, the cli...

In earthworms, when the ovaries mature, the clitellum secretes a viscous substance in the form of a girdle. This girdle hardens in to a cocoon around the clitellum. The ova are dis

Which aqueous solution has the lowest ph, The aqueous solution with the low...

The aqueous solution with the lowest pH is: Select one: a. 0.01 M HCl. b. 0.1 M acetic acid (pKa = 4.86). c. 0.1 M formic acid (pKa = 3.75). d. 0.1 M HCl. e. 10 t

Solution of ampicillin, How much ampicillin (sodium sal, mw=371.40) would y...

How much ampicillin (sodium sal, mw=371.40) would you dissolve in 400 mL of water to make 80 mg/ml solution of ampicillin?

Three main types of trophic pyramids studied in ecology, What are the three...

What are the three main types of trophic pyramids studied in Ecology? The three kinds of trophic pyramids studied in Ecology are the numeric pyramid, the biomass pyramid and th

What do you mean by insect control, Q. What do you mean by Insect control? ...

Q. What do you mean by Insect control? The insects can breed and hide in garbage and other places where there is availability of waste materials. The cockroach lives and breed

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd