Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
SHARPS : Cuts due to careless handling of sharps such as sectioning razors, microtome blades etc. are probably the most common cause of injury in the biology lab. The only real re
Determine the term Epitheliomuscular cell. Cells which line outer surface of cnidarians. These cell have two functions: first is to form the outer body covering of animal, seco
Explain the Components of heart sounds? The first major component is associated with mitral valve closure (M 1) and is due to abrupt arrest of the leaflet motion when the cusps
Biodiversity maintains the air we breathe and the water we drink. Green plants purify our air and our water by taking in carbon dioxide, regulating water vapour, releasing oxygen,
Involution - Internalization of Mesoderm As by now mentioned, in the frog Xenopus (and probably in other amphibian species as well) the cells of presumptive mesoderm are in t
Disability evaluations after injuries: (a) Explain the following terms: "duration of disability" and "degree of disability". (b) Explain how degrees of disability after injur
A v i a n leukosis (Sarcoma group of retroviruses) This is a complex of viral diseases caused by an avian retrovirus with various manifestations such as lymphoid leukosis,
Prevention of flap tearing Tearing of a flap is a common complication of the inexperienced surgeon who attempts to perform a procedure using a flap that provides insufficient a
Venting of the Heart : It is important that heart does not distend during cardio pulmonary bypass. This is prevented by venting of the left side of the heart by inserting a cannu
Eucaryotic cell structure All eucaryotic cells have a cytoskeleton made up of a network of protein filaments (Figure shown below). This network gives the cell its shape, capac
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd