Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain the dietary modifications - obesity, Explain the Dietary Modificati...

Explain the Dietary Modifications - Obesity? The dietary modifications serve as a guide for the obese to make healthy food choices. The first step towards prescribing a diet fo

Mycroboilogy mycoplasma, How we write assimgment about mycobiology of mycop...

How we write assimgment about mycobiology of mycoplasma in detail

Calculation of maximum crop yield percent, Calculation of Maximum Crop Yiel...

Calculation of Maximum Crop Yield Percent It was pointed out previously that 1 Baule of any growth factor is equal in effect on growth to the effect of 1 Baule of any other fa

Are microorganisms directly or indirectly affects our lives, Describe 5 way...

Describe 5 ways that a microorganisms directly or indirectly affects our lives.

What do you understand by haemagglutinins, Q. What do you understand by Hae...

Q. What do you understand by Haemagglutinins? Haemagglutinins are the globulin type of proteins which are present in the seeds of plants like double bean, field bean, white be

What are the main features of the meristematic cells, What are the main fea...

What are the main features of the meristematic cells? Why do these cells require to have a high mitotic rate? Meristematic cells have very thin cell walls, small vacuoles, a w

Aeromonas associated zoonotic disease, Aeromonas associated zoonotic diseas...

Aeromonas associated zoonotic disease Aeromonas causes gastrointestinal infections and extra intestinal infections such as cellulitis, wound infectiopn, peritonitis, endocardi

Animal diversity, what are the theories of animal classification

what are the theories of animal classification

What is the typical biological function of the tissues, What is the typical...

What is the typical biological function of the connective tissues? How is this function associated to the main features of its cells? The typical function of the connective tis

Diseases, what diseases are caused by trypanosoma and entameoba histolytica...

what diseases are caused by trypanosoma and entameoba histolytica

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd