Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
A complete motor neuron is removed from a frog and placed in a large volume of normal physiological saline. The neuron is healthy; it has a stable resting voltage of -70 millivolt
What are the excretory organs in protozoa.
Q. What are introns, and how do they affect the processing of genetic information? Introns, a feature of eukaryotic DNA, are intervening stretches of DNA lying between the exon
Zinc deficiency Zinc is essential for several physiological functions in the body such as protein synthesis, carbohydrate and nucleic acid metabolism, and foetal growth. The de
What is the type of cell division that allows sexual reproduction? What is gametogenesis? Meiosis is the type of cell division that permits sexual reproduction since it decreas
How does the hypophysis-corpus luteum negative feedback work? What is the name given to the atrophied corpus luteum after this feedback process? After ovulation the estrogen an
INTERNA L STRUCTURE - Wall of auricles are thin than wall of ventricles, because they have to push the blood to ventricles only situated close to them. Walls of ventricl
SIMPL E PROTEINS The proteins are made of amino acids only. Additional chemicals are absent. These are of two types - (i) Fibrous (ii) Globular ( i )
Match dehydration reaction and hydrolysis reaction to molecule synthesis and molecule break-down
In the last unit we traced the human evolutionary history mostly from a palaeontological viewpoint. Although still fragmentary, the available fossil evidence makes it possible to c
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd