Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Which of the following results from the elimination of DNA helicase activity in a cell? A. The melting of the DNA double helix at the site of replication initiation will fail t
Fertilization - Development Biology Previously you knew the process which leads to the differentiation of the male and female germ cells, the sperm and ova, respectively. In t
how can you find the coded genes for each piece of DNA?
Q. Medical and Nutritional Management for pectic ulcer? To provide physiological rest and support tissue healing, treatment should be based on providing rest to the affected ar
Q. What are the factors Affecting Taste Quality? You may have experienced that the four primary tastes i.e., sweet, sour, salty and bitter are not sensed with an equal ease. Th
Explain Deformaties of the Cliest wall should be Noted a) Pectus carinatum (pigeon chest): may be associated with Marfan syndrome. b) Pectus excavatum: commonly seen in Marfan
Define Advantage & disadvantage of using Algae as source of protein? Advantage Produces proteins which have almost all the Essential Amino acids. Rich in tyrosine
A diploid cell contains four pairs of homologous chromosomes designated C1 and C2, M1 and M2, S1 and S2, and W1 and W2. Predict the number of different haploid cells that could be
What is the lymphatic system? The lymphatic system is a network of specialized valved vessels that drain interstitial fluid (lymph). The lymphatic system is also responsible fo
Which of the below statements does NOT apply to arteries when comparing them to veins: a) Have thick walls b) Carry blood away from heart c) Highly elastic walls d) Ha
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd