Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain the term Intracellular Filaments? Intracellular Filaments : The cell contains fibrous proteins which serve to give the cell its shape and internal organization and fo
General characters of phylum protozoa
Is there a difference between the initial and the final energy levels in catalyzed and non-catalyzed reactions? The catalysis does not alter the energetic state of reagents and
L u mp y skin disease The disease, reported from Sudan in 1970 and Egypt in 1988, is caused by a member of the Capripox virus. It affects cattle and is restricted to African
Explain Continuous Murmurs and their characterstic in details? These murmurs are continuous throughout systole and diastole. It is due to continuous blood flow in the same dire
Define Proteins as biological buffers? Proteins have the ability to accept or donate hydrogen ions and by doing so they serve as biological buffers. In blood, there are three i
Define Behaviour modification - combat from obesity Problem? It is very important. A heavy parental hand and parent attitude and behaviours towards child's eating, interferes i
DIFFERENCE BETWEEN VEGETATIVE AND GENERATIVE CELL
What are sols? A colloidal system in which solid particles are dispersed in a liquid is referred to as a sol, to distinguish it from a true solution. In a true solution, the
Avian leucosis complex (ALC) The disease in poultry is caused by an RNA virus classified under avian type C Retrovirus group under the family Retroviridae. Epidemiology:
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd