Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is the defense mechanism that begins to work when inflammation fails to stop an infection? If the inflammatory attack is not sufficient to halt the infectious process t
Define the Interaction of Vitamin C with iron? Ascorbic acid powerfully enhances absorption of non- haem iron and reverses the inhibiting effect of tea and calcium phosphate. I
i need to complete a model on loop analysis Java and answer questions on my assignment sheet....any experts to help me do my lab homework?
DIFFERENCE BETWEEN PLANTS AND ANIMALS - S . N o . C h a ra c ter P l an ts A n i m al s 1 Nutrition
Mr. Smith read that cholesterol was bad for his health so he eliminated all foods and food products containing this molecule. He later found that his cholesterol level dropped only
Explain the Occurrence of vitamin B 2 Vitamin B 2 (riboflavin) occurs in nature almost exclusively in a combined form i.e. esterified with phosphoric acid as riboflavin-5'-ph
What is the meaning of Ideometric approach Ideometric approach in the context of neuropsychological assessment emphasises the patient's premorbid functioning with reference to
Explain Vasopressindrug term? As a single bolus of 40 U, vasopressin has been recommended as an alternative to epinephrine in VF/pulseless VT refractory to defibrillation. Furt
URETHRA - It is common duct as sperms & urine both pass from it. It receives juices of prostatic gland & cowper's gland. Urethra is 20 cm long, passes through the peni
Active instruments -This category of instruments actively engage a restorative , enabling a specific dislodgment force to potentially lift off the prosthesis -These devices
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd