Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is S shaped incision? The S - shaped incision is indicated where a papilla needs to be developed and was first described by Palacci. This type of incision is essentiall
Functional properties of protiens Immunoproteins such as C-reactive protein, Opsonin Immunoglobulins, Contractile respiratory, structural, enzymatic,
Q. Explain the process of Degradation of Proteins? Proteins are composed of amino acids combined by peptide linkages. The native proteins are resistant to attack by microo
Use the genetic code table Assignment34 The codon GCA specifies which amino acid?
Explain about the Dehydration or Drying? The technique of drying is the oldest method of food preservation practiced by mankind. The removal of moisture, which is actually dehy
Q. Concerning their biological function what is the difference between meiosis and mitosis? The main biological function of mitosis is cellular multiplication a fundamental pro
What is the function of the left ventricle? Where does the blood go after leaving the left ventricle? The function of the left ventricle is to get blood from the left atrium an
Q. What is meningitis? The Meningitis is the generic name given to inflammation of the meninges and membranes that cover the central nervous system. The Meningitis can have sev
It is important to know about qualities of a counsellor because you will be counselling a diabetic patient and his family members in clinic/home/hospital and therefore, you shoul
What is dengue? Dengue, or dengue fever, is an epidemic disease in some countries (for instance, in Brazil), and its most dangerous form is hemorrhagic dengue. It is caused by
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd