Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Character displacement and ecological exclusion, Consider two species of or...

Consider two species of organisms, species A and species B. Species A has a population in a community. Another population species B arrives into the same community, rather suddenly

Important herbaria, Q. Important Herbaria? The herbarium is a place whe...

Q. Important Herbaria? The herbarium is a place where dried and mounted specimens are stored according to any recognised system of classification. Special attention is paid tow

What is glands, What is Glands? The central nervous system controls muc...

What is Glands? The central nervous system controls much of the endocrine system through the hypothalamus. The hypothalamus directs many of the body's functions through the "ma

Define the factors effect the quantity of human milk, Define the factors ef...

Define the factors effect the Quantity of Human Milk? A large healthy baby who can vigorously suck will induce and obtain much more milk from its mother than a small, sickly or

Cori cycle, Cori Cycle Skeletal muscles have some mitochondria, yet are...

Cori Cycle Skeletal muscles have some mitochondria, yet are competent of vigorous activity. as a output, the little stores of oxygen are rapidly depleted, causing the muscle ti

Illustrate the conductance of potassium channels, A decrease in parasympath...

A decrease in parasympathetic discharge to the heart leads to A. an increase in the conductance of F-channels in SA node cells. B. a decrease in the conductance of potassium

Nutrition, what is non conventional feed

what is non conventional feed

Define alcoholic cardiomyopathy, Q. Define Alcoholic Cardiomyopathy? In...

Q. Define Alcoholic Cardiomyopathy? In a case of dilated cardiomyopathy alcohol cardiomyopathy is suspected if there is history of alcohol intake of 100g/day for more than 10

Define vitamin requirements for preterm and low birth weight, Define Vitami...

Define Vitamin and Mineral requirements for preterm and low birth weight? Care to be taken for calcium and phosphorus intake in preterm infant. Due to inefficient sodium conser

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd