Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Distribution of Nitrate Reductase and Nitrite Reductase Let us see whether nitrate assimilation depends upon the reductants produced in photosynthesis or in oxidative metaboli
What is the classification that divides orders? Orders are divided into Families. The hierarchy of classification of living things most usually used is, from broadest to nar
Advances in Mineral and Vitamin Nutrition of Livestock Even though, minerals and vitamins as nutrients are as essential as energy and protein, general negligence occurs primari
how mollusca bore into hard substrate
Regarding the article "Baby Blues" which of the following is a false statement? A. Children, whose mothers underwent severe stressful episodes during pregnancy, have higher tha
10 organisms &there mode of nutrition
URINIFEROU S TUBULE - Unit of kidney. 3-5 cm. long (30 mm). Total length of nephrons is 65 km. A tubule consists of - 1 . Malpighian capsule (
Define Genetic engineering and Biotechnology Genetic engineering or recombinant DNA technology, involves the use of a variety of enzymes, such as restriction endonucleass and
Cilia and flagella share a common structure, with a microtubular core which has a 9+2 organization with nine paired doublets of microtubules surrounding a central pair to form the
How we write assimgment about mycobiology of mycoplasma in detail
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd