Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Echinoderm identity card. How are echinoderms characterized according to examples of representing beings, basic morphology, type of symmetry, germ layers and coelom, respiratory
Q. What is Angina Pectoris? Chest discomfort is often reported by most patients especially those which are chronic cases of dyslipidemia and/or hypertension. Like diarrhoea and
Can you please describe the differences between continuous traits and discrete traits and how it helps an ecologist measure variation? Please give a few examples.
Q. What are the major divisions of the hypophysis? What are their functions? The hypophysis is divided into two portions- the anterior hypophysis or adenohypophysis and the pos
Explain Insect resistant crops in Evolutionary way Insects are a natural selection pressure so plants resistant to certain insects could have an evolutionary advantage (in
Explain the Proteus - Characteristics of Bacteria? It is gram negative, non-sporulating rod, which is characterized by rapid motility (peritrichous flagella) and swarming type
steps in genetic engineering
Types of Leukemia Leukaemia may be chronic or acute and is classified into the following categories: i) Acute Lymphocytic Leukaemia (ALL) This is the most comm
Axon: Axon is a projection from the cell body. Each neuron has only one axon. Unlike dendrites, axons are very long and are usually unbranched structures. The axon
Q. Do enzymes act better under basic or acid pH? Most enzymes act in pH between 6 and 8, a range that corresponds to the general acidic level of blood and cells. There are enzy
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd