Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Freeze Concentration? This process has been known for many years and has been applied commercially to orange juice. However, high processing costs due largely to losses
Hazard identification We start the process of risk assessment by first identifying the hazard. The goal of hazard identification is to identification potential adverse hea
Cytoplasmic bridge formed during the conjugation of paramoec: The two paramoecia that undergo conjugation are called conjugants. During conjugation, the two conjugants com
WHAT TRAITS ALLOWED VASCULAR PLANTS TO GROW TALL
Explain about the Amino Acids and Proteins? We shall now study the properties of amino acids which we know are the building blocks of proteins. In this practical, we shall car
What are the affinities of pteridophytes with gymnosperms?
OXIDATION OF PYRUVATE TO ACETYL CoA The oxidation of pyruvate to acetyl CoA is the irreversible route from glycolysis to the citric acid cycle. What is citric acid cycle?
Define Important Points While Working With Autoclave? Note: Following points should be kept in mind while working with autoclave. 1. Autoclave should not be packed tightly o
What is the difference among cryptogamic and phanerogamic plants? Cryptogamic (hidden sex organs) plants are those that do not show flowers or seeds. They comprise the bryophy
Explain the term- Horizons These processes take a long time- may be a few thousand years to create a soil. As the time passes, the soil matures and generally becomes deeper and
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd