Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is stem cell therapy, What is Stem cell therapy Most defects / dis...

What is Stem cell therapy Most defects / diseases treated by stem cell therapy are not genetic in origin so the therapy will have no impact on gene pool in terms of change in f

Serotonin - enhancement of memory, Q. Serotonin - Enhancement of memory? ...

Q. Serotonin - Enhancement of memory? Increased level of serotonin is implicated in the enhancement of memory. It plays a significant role in classical conditioning wherein sti

Explain the complications of burns, Explain the Complications of Burns? ...

Explain the Complications of Burns? Most minor burns are superficial and do not cause complications. However, deep second-degree and third-degree burns swell and take more time

How to determines the actual availability of nutrients, How to determines t...

How to determines the actual availability of nutrients The amount of a particular nutrient determined analytically does not necessarily represent what is available but is merel

Determine the purposes of vital signs, Determine the purposes of vital sign...

Determine the purposes of vital signs The vital signs reflect the functioning of vital organs of the body i.e. heart, brain and lungs. They indicate the basic functions of body

Functional morphology of reproductive organs, Normal 0 false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Define criteria for assessment of pyridoxine status, Define Criteria for As...

Define Criteria for Assessment of Pyridoxine Status? Vitamin B 6 status is most appropriately evaluated by using a combination of indicators,  namely plasma PLP concentration,

Health hazards with poor management of bio-medical waste, Health Hazards wi...

Health Hazards with poor management of Bio-medical waste Health hazards associated with poor management of Bio-medical waste are: - Injury from sharps to staff and waste han

Condom, what is condom???

what is condom???

Active or moderately active lifestyles - physical activity, Define Active o...

Define Active or moderately active Lifestyles - physical activity? These people have occupations that p-e not strenuous in terms of energy demands, but involve more energy expe

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd