Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What do you mean by Cold Deserts? Cold deserts cover a vast area north of the Himalayan ranges forming an ecosystem with exceptionally low temperatures which may reach - 75°C a
Define about the Paper electrophoresis? In paper electrophoresis the sample is applied to a point on a strip of filter paper or cellulose acetate moistened with buffer solution
What are the lateral lines of fishes? The lateral lines of bony fishes are sense organs that extend along both sides of the animal body. They make contact with the environment
Q. Show Gastroesophageal reflux? Obesity is thought to be another potential predisposing factor to gastroesophageal reflux or GERD. Maintenance of ideal weight for age may help
Which of Mendel's postulates can only be demonstrated in crosses involving at least two pairs of traits? a) Segregation b) dominance/recessiveness c) independent assortment d) unit
Explain Rifabutin Two alternative regimens are based on the fact that rifabutin appears to be as effective as rifampin against TB, and has less effect on protease inhibitor lev
Intergenic: Amongs the two genes; for example intergenic DNA is the DNA found amongs two genes. The term is frequently used to mean non-functional DNA (or at least DNA with no kno
Give the introduction of genesis of coronary artery diseases and risk factors? Cardio-vascular diseases have their roots in the structure and functional alterations in the vasc
Stratification of Vegetation - Qualitative Characters Stratification of vegetation is another important feature of plant communities. There are different vertical strata in di
a) What is symbiotic nitrogen fixation? b) Name the two protein components required for this process. Define their role.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd