Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is Single Ventricle Physiology ? In complete correction of a congenital cardiac condition, it is ideal to have two ventricle correction (Pulmonary and systemic ventricles
State the types of bone density Misch classified bone density into following types (1988) D1. Dense cortical bone- which is almost never observed in maxilla and approximatel
Types of Metamorphic Changes The process of metamorphosis includes reactivation of the morphogenetic processes. The morphogenetic changes also the mode of causation of these
Q. Explain Spoilage of Sweetened condensed milk? The sweetened condensed milk contains about 8% milk fat, 23% total milk solids and sweetened with the addition of a sweetener,
What are similarities and differences among the transcription process and the replication processes? A DNA polynucleotide chain serves as a template in replication (DNA duplica
Two homologous human chromosomes have the following structure: where the letters represent genetic markers and the black dot represents the centromere. 1. Diagram the two chromosom
Explain the Working Principle of Spectrophotometer? The working principle of spectrophotometer is graphically presented in Figure. Figure: Working princip
Galvanotaxis - Modes of Cell Movement Galvanotaxis considers to the movement of cells in response to a potential variation between cells. It is suggested that there are voltag
Define the Sterilization protocol? Sterilization protocol encompasses the following: 1. Transport of instruments to the sterilization area 2. Cleaning of instruments 3
Differential reinforcement (Training of incompatible behaviour)- Differential reinforcement of incompatible behaviour (DRI) is used to decrease a frequent behaviour without pun
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd