Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Chest Complications : Many of the patients undergoing coronary artery bypass surgery have risk factors for post-operative lung complications. These include old age, chronic obstru
Mention the product and its use formed by each the microbes listed below: i) Lactobacillus ii) Streptococcus iii) Saccharomyces cerevisiae
Ammonia Assimilation - Inorganic Nitrogen and Sulphur Metabolism Nitrogen (N 2 ) gas and NO 3 are the most common available forms of inorganic nitrogen. Both are enzymaticall
Lung Abscess: Lung abscess is a localised collection of pus in the pulmonary parenchyma as a result of suppuration and necrosis. The obstruction of the bronchus of the in
Explain Use of food Additives - method of food preservation? Food additives may be defined as substances added intentionally to food, generally, in small quantities to improve
what are the some examples of phlum protoza?
If water dousing, homeopathic cures, and so on work for just me but not for anyone else, it is still science.
What is diffusion? Diffusion is the spreading of substance molecules from a region where the substance is more concentrated to another region where it is less concentrated. For
Cut wings (ct) is an X chromosome (sex linked) recessive mutant of D melanogaster. Antennaless (al) is an autosomal recessive mutant. A cut, antennaless (homozygous) female is mate
Explain the interaction of vitamin A with Iron? Iron: Iron status of an individual correlates with vitamin A. The deficiency of vitamin A has been found to be associated with
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd