Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is an example of a hypothesis which may explain why there is not a big representation of the class Reptilia found in polar regions? Beings of the class Reptilia are abunda
In multicellular organisms there is a requirement for the cells to communicate with one another in order to coordinate their metabolism and growth. The principal way by that cel
how many atoms are H2SO4 compound
Explain the Pregnancy and Obesity? Obesity is associated with increased risk for gestational diabetes, hypertension, pre- eclampsia, perinatal mortality and the need for induce
Define Management of Canal Blockage Canal Calcification Diamond coated instrument rt 1 designed for better visibility and cutting efficiency a) Very powerful for efficient
What is neiosis
Define Regulation of Water Balance? The input of water, as well as, its loss can be highly variable due to individual habits and environmental factors; in spite of this, the to
separation of nucleic acid
Q. What are the Communication process steps?Communication process steps: 1. Rapport Building 2. Finding the Problem 3. Planning 4. Implementation of the Plan 5. Ter
Management Goals Improve oxygenations and ventilation to restore the person/s Pa 2 O 2 and PaCO 2 , to their previous levels. Understand the underlying cause.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd