Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What do you mean by cold deserts, What do you mean by Cold Deserts? Col...

What do you mean by Cold Deserts? Cold deserts cover a vast area north of the Himalayan ranges forming an ecosystem with exceptionally low temperatures which may reach - 75°C a

Define about the paper electrophoresis, Define about the Paper electrophore...

Define about the Paper electrophoresis? In paper electrophoresis the sample is applied to a point on a strip of filter paper or cellulose acetate moistened with buffer solution

What are the lateral lines of fishes, What are the lateral lines of fishes?...

What are the lateral lines of fishes? The lateral lines of bony fishes are sense organs that extend along both sides of the animal body. They make contact with the environment

Gastroesophageal reflux, Q. Show Gastroesophageal reflux? Obesity is th...

Q. Show Gastroesophageal reflux? Obesity is thought to be another potential predisposing factor to gastroesophageal reflux or GERD. Maintenance of ideal weight for age may help

Which of mendel''s postulates demonstrated in crosses, Which of Mendel's po...

Which of Mendel's postulates can only be demonstrated in crosses involving at least two pairs of traits? a) Segregation b) dominance/recessiveness c) independent assortment d) unit

Explain rifabutin, Explain Rifabutin Two alternative regimens are based...

Explain Rifabutin Two alternative regimens are based on the fact that rifabutin appears to be as effective as rifampin against TB, and has less effect on protease inhibitor lev

Explain intergenic, Intergenic: Amongs the two genes; for example intergen...

Intergenic: Amongs the two genes; for example intergenic DNA is the DNA found amongs two genes. The term is frequently used to mean non-functional DNA (or at least DNA with no kno

Give the introduction of genesis of coronary artery diseases, Give the intr...

Give the introduction of genesis of coronary artery diseases and risk factors? Cardio-vascular diseases have their roots in the structure and functional alterations in the vasc

Stratification of vegetation - qualitative characters, Stratification of Ve...

Stratification of Vegetation - Qualitative Characters Stratification of vegetation is another important feature of plant communities. There are different vertical strata in di

What is symbiotic nitrogen fixation, a) What is symbiotic nitrogen fixatio...

a) What is symbiotic nitrogen fixation? b) Name the two protein components required for this process. Define their role.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd