Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define the Operations of a Public Nutritionist? A public nutritionist can perform the following: In the hospital-based set up, she is a part of the team delivering thera
BIO GEOGRAPHICAL EVIDENCE- The patterns of distribution of animals and plants in different parts of the globe are termed as biogeography. It is believed that around carbo
details of these blood groups
Define General Nutritional Functions of Minerals? We hear and talk about minerals almost everyday with regards to maintaining good health. But what are minerals and what functi
Human anatomy: Human anatomy is a branch of biology which, with deals with human physiology and biochemistry. It is mainly concerned with the scientific study of the internal stru
Explain the term Trans fatty acids? Plant derived fats and oils contain cis-fatty acids. You may recall reading about the cis and trans isomers in the Nutritional Biochemistry
Illustrate the Respiratory System In general, respiration and breathing are understood to be same. But it is not so. Breathing simply means taking in oxygen from air and giving
In designing an experiment to find out whether light is required for photosynthesis (a) what is the principle of the design (b) what control would you use?
Would it be possible to establish a pure-breeding population of brown pigs with a few black spots?
What is Pancreas ? The pancreas lies in the abdominal cavity in a loop between the stomach and small intestine. The pancreas consists of two major types of cells: those produci
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd