Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Foliose Lichen Stage - Xerarch As mentioned earlier, the weathering of the rocks and the decaying of the crustose lichens results in the formation of soil on the otherwise bar
Calorific value is one of the most important characteristics of a fuel. It judges the efficiency of fuel. Calorific value is defined as "the total quantity of heat liberated, wh
What factor helps us in identifying the type of bone graft to be used? The following factors help us in identyfying the bone graft to be used: i) Whether graft is osteoinduc
Hydrops amnii (Hydramnios) Hydramnios is a rare condition. Excessive accumulation of amniotic fluid can be the result of foetal dysgenesis and agenesis. The increase of amniot
origin of species
Explain Management of Ledge - Non-Surgical Endodontic Retreatment Place a bend of approximately 45 degree in the apical 1-2 mm of a #15 to 25 file. By gentle reciproca
Give detailed structure of gills,book lungs
Q. What is cerumen? Cerumen is a fatty, oily substance produced by theceruminous glands in outer part of ear canal. This compound is generally referred to as ear wax and, toget
What are Herbicide tolerant crops in ecological Herbicide tolerant crops (HTC) Ecological a) Increased use of the herbicides that plant is tolerant to (describes ecologi
Define Intentional Adulteration - Types of Adulteration? In intentional adulteration, the substance is added, removed or substitute knowingly by the adulterator for the purpose
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd