Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Why is the Krebs cycle also called the final common pathway of the degradation of organic compounds? The Krebs cycle is known as the final common pathway of the degradation of
Meiosis is the special type of cell division in which the numbers of chromosomes in daughter cell are reduced to half, as compared to parent cell. Occurrence: It takes place
Q. What is the function of the vitellus in the vertebrate egg? How are these eggs classified according to the amount of vitellus within them? Vitellus (yolk) is the nutritive m
What are the Stages of soil The development of soil takes place in two stages. In the first stage there is formation of parent material which is generally consolidated and cons
Define Techniques for Measuring Body Composition - Underwater weighing? Underwater weighing (densitometry): It applies the Archimedean principle of water displacement by the fu
What is the Nonhuman Experimental Studies How normal brain development proceeds is essential knowledge for professionals concerned with understanding infant and young child dev
What are the uses of microorganisms
Explain Factors influencing food production? Appropriate food production involves getting an adequate output (i.e. food) using appropriate inputs. An essential requisite for th
Q. What is a mixed gland? Why the pancreas is considered a mixed gland? Mixed gland is a gland that produces exocrine and endocrine secretions. The pancreas is an example of
Q What are the bacteriophages? Bacteriophages are viruses specialized in parasitism of bacteria. They are used in genetic engineering as molecular cloning vehicles to include r
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd