Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
1. Awareness - First people become aware of a problem. 2. Acquire Knowledge and skills - Next, they gather knowledge and learn new skills. 3. Motivation - At the next stag
Dietary fibre Dietary fibre: Typhoid patient has an inflamed intestinal mucosa, which can be easily perforated and ulcerated leading to internal haemorrhage. Thus foods hig
Define the Types of Canned Foods? 1. Some foods form convection currents when being heated inside a can and so are heated faster since self-mixing - as foods become more visco
Q. Which are the beings that form the kingdom Fungi? The kingdom Fungi is created by fungi. Q. Which are the beings that form the kingdom Plantae? Are algae parts of this k
Primary amines can act as bases; they can- Select one: a. Absorb a proton to become R-NH2+2 b. Release a proton to become R-NH2+ c. Absorb a proton to become R-NH3+
Uses of Hydrocolloidsfor health Hydrocolloids, together with other dietary fibres are increasingly being seen as contributing to a number of health effects. Some of the hydroco
Nursing Assessment If you observe a child of thalassemia major you can identify the following clinical manifestations: Anaemia with haemoglobin level of 3 to 8 gm per ce
Define the Insulin resistance - Obesity? Insulin resistance is a condition in which your body cells cannot utilize insulin efficiently although sufficient amounts are secreted
THEORY OF ORGANIC EVOLUTION - LAMARCKISM Theory of the inheritance of acquired characters or Lamarckism put forwarded by Jean Baptist de Lamarck (1809) in his book "
Q. Fluid management in Diarrhoea? Fluid management: The key to diarrhoea management is the early replacement of fluid lost in the stools through intravenous or oral route. Whil
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd