Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Show the important groups of bacteria? The important groups of bacteria are: a) Bacillus: rod-shaped. b) Coccus: spherical. c) Coccobacillus: oval-shaped. d)
Difference between rods and cones - Rods Cones 1. More in number 1150 lakh 2. Outer seg. is cylindrical and contains
a) What are the advantages of human milk over cows' milk for feeding babies? b) Apart from the composition of the milk, what are the other advantages of breast- feeding?
Q. How are the circulatory systems of animals classified? A circulatory system is classified as open or closed. In open circulatory systems blood gets out of vessels and flows
Chemistry of Living Matter All living things including ourselves, are made of protoplasm. Protoplasm is essentiallya colloidal suspension of proteins in a w&ery solution. It is c
How to Prevent and Control PEM? Any programme aimed at prevention of PEM should be holistic and comprehensive considering the family as a unit. Since the effects of under nutr
Evolution of migration Eg Benefits associated with migratory flights must be greater than those associated with staying in Alaska and having to tolerate seasonal changes
special components and features
Define Obligatory and Facultative water excretion? i) Obligatory water excretion: The kidney is 'obligated' to excrete some water to rid the body of its daily load of urinary s
Question 1 List various liver function tests. Discuss the importance of each test. Add a note on standardization of various liver function tests Question 2 Discuss the follow
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd