Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Explain microbiology of Soil? Ans. You would realize that the soil contains greatest varieties of microorganisms. It actually serves as a medium for growth and developm
Q. What is the parasite that causes giardiasis? How is it transmitted and what are the typical manifestations of the disease? The Giardiasis is a protozoal infection caused by
Explain process of Selection of taxonomic characters Selection of taxonomic characters Eventually classification systems may be based almost entirely on direct study of th
Limitations of Computed Tomograpy Scan This technology is costly Increased amount for radiation
How do birds reproduce? Birds, like each vertebrate, have sexual reproduction. Their embryos develop within shelled eggs having extraembryonic membranes and outside the mother'
Explain Lipid Transport in Nutritional Care? Proteins provide the transport mechanism for lipids by forming lipoproteins. This helps to prevent fatty infiltration and hence pro
Determine what is dermal branchiae? External extensions of outer epidermis and peritoneum of the echinoderm body cavity. Both outer epidermis and inner peritoneum are lined wit
Q. What are the main factors that affect the growth of a population? The major factors that make populations grow are births and immigration. The major factors that make popula
Q. From the lumen to the external surface what are the tissues that form the digestive tube wall? From the internal surface to the external surface, the digestive tube wall is
Explain the Procedure Estimation of the Amount of Bacteria? Now carry out the exercise following the steps enumerated herewith. 1. Prepare ten fold dilutions of E. coli cult
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd