Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain the Occurrence of vitamin B 2 Vitamin B 2 (riboflavin) occurs in nature almost exclusively in a combined form i.e. esterified with phosphoric acid as riboflavin-5'-ph
why roots grow downword
Define Glass photo-emissive tubes? Glass photoemissive tubes are those which consist of a curved metal cathode, coated with a photosensitive material. While light strikes its s
Several TCA cycle intermediates can be used as a substrate for the synthesis of other compounds. Succinyl CoA is on intermediate that is directly used for the synthesis of which of
Q. What are the consequences of shifting the chemical equilibrium of the formation of bicarbonate from water and carbon dioxide towards the consumption of products of the reverse r
(a) What carbohydrates does a plant make from glucose? (b) Which of these carbohydrates is transported round the plant? (c) Which carbohydrate is the main s
Q. Source of the bacteria of Salmonellosis? The initial source of the bacteria is the intestinal tract of birds, reptiles, farm animals, humans and occasionally insects. As int
Explain Objective Anti-arrhythmic pacemaker defibrillators? After reading this unit, you should be able to: 1 describes the classification of ant arrhythmic drugs; 2 understand
The importance of the brain in our everyday lives can never be underestimated. The brain has physical properties that are in a constant state of flux. The brain never rests totally
Categories of Air Pollutants From the above list you can see that the air pollutants can be broadly classified into the following two categories: Primary Pollutants
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd