Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Use values of biodiversity, Despite its importance, determining the value o...

Despite its importance, determining the value or worth of biodiversity is complex and often a cause for debate. This is largely due to the fact that the worth placed on biodiversit

Evidence in favour and against of mutation theory, EVIDENC E IN FAVOUR OF ...

EVIDENC E IN FAVOUR OF THE MUTATION THOERY - Mutation theory can explain both progressive and retrogressive evolution and the occurrence of both changed and unchanged forms.

Digestion of various disaccharides of the diet, Digestion of various disacc...

Digestion of various disaccharides of the diet The enzymes from brush border membrane of small intestine complete the digestion of various disaccharides of the diet and the pro

Clotting mechanism, Normal 0 false false false EN-IN ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

What are the cells that form the cartilaginous tissue, What are the cells t...

What are the cells that form the cartilaginous tissue? The main cells of the cartilages are the chondrocytes, originate from the chondroblasts that secrete the intersticial ma

Mycoplasmosis-pigs, Pigs Mycoplasma infection causes arthritis in limb ...

Pigs Mycoplasma infection causes arthritis in limb joints in pigs, while infection with M. hyopneumoniae gave rise to symptoms of coughing and chronic pneumonia and the disease

Explain the importance of biochemical tests, Explain the Importance of Bioc...

Explain the Importance of Biochemical Tests? Specific series of biochemical tests have been developed for fast identification of microorganisms in laboratories. These biochemic

Define systematic botany - taxonomy, Define Systematic Botany - Taxonomy? ...

Define Systematic Botany - Taxonomy? We will now learn something mare about systematic botany. The early recognition of harmful and useful plants was the beginning of systemati

Explain the acid fast staining, Explain the Acid Fast Staining? Acid fa...

Explain the Acid Fast Staining? Acid fast staining is a type of differential staining used for identification of certain bacteria, e.g. Mycobacteria which cannot be stained rea

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd