Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

How are the transparency and functions of cornea evaluated, How are the tra...

How are the transparency and functions of cornea evaluated? Physiological roles of barrier function, refractive function (with interaction of tear film), response to wound and

What do you mean by taxonomist, Q. What do you mean by Taxonomist? Mode...

Q. What do you mean by Taxonomist? Modern classification systems are based on many types of evidence. A truly natural classification is obtained from analysis and harmonisation

Potassium ion can pass easily through cell membranes, In the human body, th...

In the human body, the potassium ion can pass easily through cell membranes, yet the potassium ion concentration is higher inside many cells than it is outside these cells. Could t

Retina, R E TIN A - It is inverted. Innermost, sensitive laye...

R E TIN A - It is inverted. Innermost, sensitive layer. The part of ratina which is attached to choroid is pars optica. The part of retina attached to cilliary b

Advantages of implant supported maxillo-facial prosthesis, Q. Discuss the a...

Q. Discuss the advantages of implant supported maxillo-facial prosthesis. Maxillofacial Prosthodontics involves the prosthetic rehabilitation of patients with congenital or acq

Respiration of seeds, How can i design an experiment to compare the heat ou...

How can i design an experiment to compare the heat output by two different types of germinating seeds?

Determine the principles of suturing, Determine the Principles of suturing ...

Determine the Principles of suturing These are universal principles which are applicable in all aspects not just implant surgery: 1. Sutures should always be inserted throug

Zoology, what is the term used for study of sponges,protozoa,colentreta,mol...

what is the term used for study of sponges,protozoa,colentreta,molusca,fish,aves,mammal

Consciousness as inner state, Q. Explain Consciousness as inner state? ...

Q. Explain Consciousness as inner state? Consciousness as inner state: We are conscious of thoughts, images, emotions and memories within ourselves though they may not have phy

Valvular heart diseases, Valvular heart diseases :  Congenital and acquire...

Valvular heart diseases :  Congenital and acquired valvular heart diseases often require surgical intervention. 1 is well known that conservative surgery by valve repair gives bet

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd