Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Syphilis in Pregnancy Syphilis in pregnant women should be treated with penicillin in doses appropriate to the stage of the disease. When pregnant women with syphilis are alle
Define the Bioavailability of Riboflavin? Riboflavin availability is sodium-dependent. Prolonged contact of dietary riboflavin with the absorptive surface of the intestinal muc
Management of soil productivity The continuous prosperity and well being of the people of any nation is dependent upon several factors, one of the most important being the leve
Even though association between GAS pharyngitis and the ARF is fairly well established, the exact pathogenic mechanisms are not clearly understood. However, two mechanisms are post
Explain the Mechanisms suggested for bile acid adsorption? Mechanisms suggested for bile acid adsorption are: 1. Hydrophobic interactions between lignin and bile acids, 2
Determine Effects of probiotics on Animals? Let us briefly examine the effects that have been reported (remember most of it has been on animals): 1. In animals, probio
life cycle of stentor
FUNCTIONS OF CELL WALL 1. Provides shape to plant cell rigidity to cells. 2. Functions as a barrier to entry of pathogens into the cells. 3. Provides pr
What are plankton, benthos and nekton? Plankton, benthos and nekton are the three groups into which aquatic living beings may be divided. The plankton is formed by algae and
what are viroids
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd