Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Benefits of Cross-Pollination Because of the specific benefits of cross-pollination, flowering plants have evolved many devices to prevent self-pollination and to encourage cr
Q. Why is it said that during photosynthesis carbon dioxide is improved to form glucose? During photosynthesis carbon dioxide is energetically improve with hydrogen from water.
Patients Not on HAART For HIV-infected patients requiring TB treatment who are not currently being treated with highly active antiretroviral therapy (HAART), it may be prudent
How did Pasteur's experiment vary from Spallanzani's experiment? Instead of sealing the flask in the experimental group after boiling, Pasteur used a flask with a curved neck,
Explain about the Musculoskeletal System? Osteopenia (decrease in bone mineral content) is observed with aging. There is an average of 30% decline in the bone mineral density f
Describe the properties of gum ghatti Important property of gums referred to as 'viscosity' and the effets of pH. Gum ghatti does not form true aqueous solutions but form visco
Is the bacterium MRSA pathogenic or non-pathogenic? MRSA bacteria are pathogenic. This group of bacteria belongs to Staphylococcus aureus family, which have grown resistant to
Q. Relationship between Mind and Brain? In modern times, before the 20th century, the most popular interpretation of the mind-brain relationship was some version of dualism. It
Water of Estuaries The water of estuaries is turbid because of the great number of particulates in suspension in the water. The turbidity is minimum near the mouth and increas
RIBS- Curved or stretched 'S' shaped bones. 12 pairs, form thoracic basket, attached by head part to vertebral column and by tail part to sternum. 7 pairs a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd