Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

How to improve the quality of protein in the diet, How to improve the Quali...

How to improve the Quality of Protein in the Diet? Since the net protein utilization (NPU) values of milk or egg proteins are higher than those of proteins of average diets con

Explain why this drug would eventualy kill a person, Dinitrophenol, DNP, wa...

Dinitrophenol, DNP, was prescribed in low doses in the 1940's to help obese patients lose weight. It's use for this purpose was discontinued when several users died. DNP makes the

Canine distemper, Canine distemper Canine distemper, a highly contagio...

Canine distemper Canine distemper, a highly contagious disease of dogs, is caused primarily by air- borne virus which belongs to the genus Morbillivirus in family Paramyxoviri

Assessment of wilm tumour, Assessment   The child with wilm's tumour wi...

Assessment   The child with wilm's tumour will present you with a large mass in the loin or an enlarging abdomen. This mass may be noticed accidently by  the parent of  the chi

What is dyslipidemia or hyperlipidemia, Q. What is Dyslipidemia or Hyperlip...

Q. What is Dyslipidemia or Hyperlipidemia? It has been known for over five decades now that dyslipidemia is associated with increased severity and prevalence of atherosclerosis

Define fluids requirement to avoid underweight problem, Define Fluids requi...

Define Fluids requirement to avoid underweight problem? Take fluids only after a meal instead of with or before meals so that food intake is not reduced. High calorie nourishin

Botony, is a wheat plant a eustele or a siphonostele or a protostele?

is a wheat plant a eustele or a siphonostele or a protostele?

Variability in populations, Variability refers to the differences in herita...

Variability refers to the differences in heritable traits exhibited by the individuals of a species. One of the major contributions of Darwin to the study of evolution was his book

Define trauma - nutrition during stress, Define Trauma - Nutrition During S...

Define Trauma - Nutrition During Stress? The term "trauma" conies from a Greek word which means "a wound" (and or damage or defect). Trauma is a form of shock to the human body

Digestive system, Digestive system is one of eleven major body organ syste...

Digestive system is one of eleven major body organ systems in animals; it converts food from the external environment into the nutrient molecules which can be used and stored by t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd