Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
How does biological diversity relate to the characteristics of the abiotic factors of an ecosystem? The availability of abiotic factors as light, moisture, mineral salts, heat
In 1954, Public Health Service organized an experiment in that nearly 2 million children in grades 1, 2 and 3 participated. Experiment was to test a vaccine. Name the disease c
Who first discovered eye anatomy?
Define about the Ultraviolet rays - carcinogenic? Ultraviolet rays: There is ample evidence from epidemiological studies that ultra violet rays derived from the sun induce an i
What are the situations in which the environment can alter the genotype of an individual? What is the condition for this type of change to be transmitted to the offspring? The
Suppose a sample of 200 microliters of blood needs to be diluted 1/50. How much diluents should be added and what will be the final volume? Show all steps.
Describe the different types of respiratory organs found in annelids.
The human body can exhibit a wide range of resistances to current depending on the path of the current, contact area, and sweatiness of the skin. Suppose the resistance across the
Q. Enumerate the anatomic consequences of edentulism? The anatomic consequences of edentulism include the effect of edentulism on bone and soft tissues. Basal bone forms the de
What are some examples of the control and informative function of organic molecules? Based on genetic information, organic molecules control the whole work of the cell. The nuc
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd