Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Bone Density The compact bone surrounding dense evenly spaced trabeculae with small cancellous spaces is ideal/suitable for implant placement. Dense or porous cortical bone is
A vanishing point is where parallel lines that move off into the distance seem to converge. It's an artifact of perspective. The vanishing point for any set of lines that are paral
This means the non-market value of natural products such as firewood, game and fodder that do not pass through a market or product preparation. Indigenous people in developing cou
what are genetics
What is the Echocardiogram ? When doubts persist whether a patient has CHD or not despite a thorough clinical exam and chest X-ray, ECG, and hyperoxia test, an echocardiogram s
rRNA structure and synthesis assignment
Explain the term Kwashiorkor? The term Kwashiorkor means the 'disease the first child gets when the second baby is born', that is, 'the sickness of the deposed child'. Thus, th
Question 1 List the cells and organs involved in immune system. Explain the role of thymus in development of T cells. Add a note on recognition of self antigens by immune system
ADRENAL OR SUPRARENAL GLANDS (GLANDS OF EMERGENCY) - These are paired structures located on the top of the kidneys. Each adrenal gland has two parts external adrenal cort
Exceptions to the Cell Theory Viruses, however, are not the only exception to the Cell Theory as formulated earlier. This has led scientists to take a much broader view of the
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd