Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What organisms make glycogen, What organisms make starch? What is it used f...

What organisms make starch? What is it used for? What organisms make glycogen? What is it used for?

Complete test of hypothesis, Conduct a test of hypothesis to verify whether...

Conduct a test of hypothesis to verify whether a difference exists among the average numbers of ant species found at sites in the two regions of Mongolia. Use  .  You will require

How are the beings of the phylum annelida classified, Q. Concerning the occ...

Q. Concerning the occurrence of separated sexes how are the beings of the phylum Annelida classified? These beings may be dioecious (the majority of polychaetes) or hermaphrodi

The androecium in a flower of china rose, The technical term used for the a...

The technical term used for the androecium in a flower of China rose (Hibiscus rosasinensis) is: 1. Monadelphous 2. Diadelphous 3. Polyandrous 4. Polyadelphous

Different mechanisms responsible for corneal avascularity, What are the dif...

What are the different mechanisms responsible for corneal avascularity? Various mechanisms responsible for its avascularity are as follows: a) Chemical Theory: I) Role o

Explain methods of protein estimation, Explain Methods of Protein Estimatio...

Explain Methods of Protein Estimation? Several methods for protein estimation are available. These methods are based on several analytical characteristics of the protein. Labor

What is dyslipidemia or hyperlipidemia, Q. What is Dyslipidemia or Hyperlip...

Q. What is Dyslipidemia or Hyperlipidemia? It has been known for over five decades now that dyslipidemia is associated with increased severity and prevalence of atherosclerosis

Carpentier -edwards valve-biological valves, Carpentier -Edwards Valve (C-E...

Carpentier -Edwards Valve (C-E) :  This is porcine aortic valve preserved in gluteraldehyde and mounted on flexible stent made of cobalt-chromium-nickel alloy (ELGILOY). Glut

Acute myocardial infarction, Acute Myocardial Infarction :  Patients with ...

Acute Myocardial Infarction :  Patients with acute non-Q myocardial infarction may need urgent intervention as indicated for cases of unstable angina.

Define methods of quantitative analysis and colorimetry, Define Methods of ...

Define Methods of Quantitative Analysis and Colorimetry? Many methods of quantitative analysis are based upon the production of coloured solutions in such a way that the intens

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd