Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
brief account on classification and general characters of protozoa
Penicillin allergy Cefazolin is often used for prophylaxis in penicillin-allergic patients, but such patients rarely may have allergic reactions to cephalosporins. When allergy
Marine Animals The composition of body fluids of marine invertebrates, including the ascidians are similar to seawater. Such animals need not expend much energy in regulating
what is the excitation threshold of a neuron?how does this threshold relate to the all or nothing rule of neural transmission
What would the effect be if a cell made defective receptor tyrosine kinase protein that were unable to dimerize?
Q. How many carbon dioxide (CO 2 ) molecules are liberated after each cycle of the Krebs cycle? For a single glucose how many carbon dioxide molecules were already liberated by the
Effects on plants of Air pollutants SO 2 , O 3 and NO 2 are strong oxidants and can bring about significant changes in plant cell chemistry. The general effects of pollutant
HOMEOS T ASI S - Homeo = same, Stasis = state Living beings maintain their internal environment by self regulating system, it is called homeostasis. Term coined by
Duck plague (duck virus enteritis) Duck plague is the most serious disease caused by a herpes virus (Anatid herpes virus). Though antigenically homogenous, differences in virul
Feeding mechanism in holozoic organisms
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd