Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
The fact that some pure solutions of hydrocarbons do not readily evaporate at room temperature is a result of- Select one: a. London dispersion forces. b. The hydrophobic
State in brief about the term - Calcium and Magnesium Exchangeable forms of these ions are considered to be available nutrients. The concentration from extractant is found by
What is phototropism? Phototropism is the movement of plant structures in response to light. Phototropism might be positive or negative. Positive phototropism is that in which
Describe Class Aves in details? Class Aves: The fossil record contains evidence that birds evolved from the reptiles. Birds share anatomical features with Protoavis and Archa
Q. How is the light from the sun transformed into chemical energy to be used by the living beings on earth? Light from the sun is converting into chemical energy contained in o
what is the mode of nutrition of fungi,bacteria and man
Explain the Advantages of Double Beam Method? The double beam method has advantage over single beam as it automatically corrects, for the change in light transmission, through
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
A patient was complaining of frequent urination, excessive thirst and dehydration. His fasting glucose level was found to be normal. Name the disease and its cause. Describe
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd