Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define nutritional status of the elderly, Define Nutritional Status of the ...

Define Nutritional Status of the Elderly? Nutritional risk factor is defined as "characteristic or occurrence that increases the likelihood that an individual has or will have

Oceanic islands, Oceanic islands are interesting and somewhat specialised b...

Oceanic islands are interesting and somewhat specialised biomes. Islands which have broken away from the main continents have similarity of flora and fauna related to the continent

Oracle clinical, evolutionary effect of Oracle clinical applications in Pha...

evolutionary effect of Oracle clinical applications in Pharmaceutical industries

What is mendels crosses in genetics explain breifly, What is Mendel's Cross...

What is Mendel's Crosses in genetics explain breifly? Mendel found that if he transferred pollen from a green-seed strain to a yellow-seed strain and vice versa, in a process c

What is isoniazid, Isoniazid  Serum aminotransferase activity increases...

Isoniazid  Serum aminotransferase activity increases in 10% to 20% of patients taking isoniazid, especially in the early weeks of treatment, but often returns to normal even wh

What is haccp, What  is  HACCP? HACCP, as you may  already know,  is ...

What  is  HACCP? HACCP, as you may  already know,  is an acronym that stands for Hazard Analysis Critical  Control Point,  a systematic, science-based approach  used  in  food

Conduction system - heart, In this unit, you have learnt that heart is a mu...

In this unit, you have learnt that heart is a muscular organ situated in thorax covering with pericardium and consist of four chambers i.e. right atrium, left atrium, right ventric

What do you mean by the good and bad cholesterol, Q. What are the so-called...

Q. What are the so-called "good" and "bad" cholesterol? Lipoproteins are complexes made of lipids (cholesterol and triglycerides) and proteins. The lipoproteins present differe

Define standard titration for estimation of reducing sugar, Define Standard...

Define Standard Titration for estimation of reducing sugar by Fehling Soxhlet Method? Pipette 5 ml of Fehling's A and 5 ml of Fehling B solution into a 100 ml conical flask. Ad

Anomalies related to oral cavity, Anomalies Related to Oral Cavity   Un...

Anomalies Related to Oral Cavity   Under these anomalies we will briefly discuss the cleft lip and cleft palate.  You must have seen and/or nursed a baby born with a cut on

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd