Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Initiation phase - mechanism of protein synthesis ? The assembly of a ribosome on an mRNA molecule at the correct start point, the initiation codon. Three initiation fac
What are the chemical substances that compose the plasma membrane? Ans) The major constituents of the plasma membrane are phospholipids, proteins and carbohydrates. The phosphol
Under which form is nitrogen fixed by living beings? Most living beings cannot use molecular nitrogen to get nitrogen atoms. Producers fix nitrogen mostly from nitrate (NO3-).
Diastolic dysfunction is responsible for one third of cases of heart failure alone and rest two third of cases in combination with systolic dysfunction. Diastolic dysfunction c
two types of amoebas waste and how they get rid of them
Define the Water Bath with Shaker? An electric water bath with a shaker that can hold test tubes as well as conical flasks. When on a non-shake mode, it acts as a simple water
Q. What is Interpretation of Stress Echocardiography? The standard approach to interpretation is qualitative. The attendant need for training and problems posed for reproducibi
How does the pancreatic juice resume the digestion of carbohydrates? What is the involved enzyme? Carbohydrate digestion starts with the action of the salivary amylase (ptyalin
You are working at a large, well funded research institute with the latest biochemical techniques available. The focus of your research is to find a specific mutation, or set of mu
Define the Nutrient requirements for preterm and low birth weight? Energy: For preterm infants 1.20 Kcal/kg/day, For normal infants 108 Kcal/ kg/ day. Proteins
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd