Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is pollination? What are the main forms of pollination? The process in which pollen grains (the male gametophytes of phanerogamic plants) reach the female gametophyte is k
differenciate between plasma and serum
Explain Sinus Venosus Defect with Partial Anomalous Venous Connection ? In this defect the atrial septal defect is situated just below the orifice of superior vena cava above
Q. What are some examples of biological activities in which osmosis plays an significant role? Hemolysis destruction of red blood cells by entrance of water, the hydric regulat
In eukaryotes possibly the most rapid and complex signaling is mediated through nerve impulses. The Nerve cells (neurons) consist of a cell body with numerous projections
Q. Explain about Tropical Rain Forests? As you approach the equator the climate becomes increasingly hot and seasonal variation in climate decreases resulting in practically th
THEOR Y OF GERMPLASM - August Weismann (1834-1914) criticized the inheritance of acquired characters by putting forward the theory of continuity of germplasm. According
write down the division of cryptogamae and phanerogamae
Self-Pollination - Types of Pollination Self-pollination refers to the transfer of pollen grains from the anther to the stigma of the same flower. In chasmogamous flowers the
Mentalis The mental tubercles on either side of mental protruberance(in midline) gives origin to the mentalis muscle. Above the mentalis origin, the incisivus muscle takes orig
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd