Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define the Energy Cost of Growth? The energy cost of growth has two components: 1) The energy needed to synthesize growing tissues; and 2) The energy deposited in these tis
EYELID S - 3 in number. Dermis is thinnest in it. Upper and lower eye lid with eye lashes. Upper eye lid is more motile In reptiles lower eye lid is more motile. In cycl
Draw and describe the structure of amphibian,reptile mammal and bird
Despite the technologic advances of recent years, many patients with chronic heart failure are elderly and have multiple comorbidities. Many of them will not experience meaningful
Fredrick Griffith published a series of experiments that collectively were dubbed "The Transforming Principle" in 1928. Which of the following prevented him from being able to decl
Define the major source of vitamin A? The major source of vitamin A, as you may be aware, is the carotenoid pigments which are synthesized by plants. Several carotenoid possess
What is the primary structure of a protein? What is the importance of the primary structure? Ans) The primary protein structure is the linear sequence of amino acids that produc
Explain about Diabetes mellitus Diabetes mellitus (DM) has relation with all the systems of our body. With some systems it has direct relationship, while with others it has in
TYPE S OF LYSOSOMES (1 ) Primary Lysosomes or storage granules or protolysosome - The primary lysosomes are smaller in size, they contain hydrolytic enzyme in the form
Which of the below describes the type of fruit characterized as a dry, simple, one-seeded indehiscent (pron: in-deh-HISS-ent) fruit with seed attached to one ovary wall at only one
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd