Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What information must be included on the form, Submission of evidence items...

Submission of evidence items to the forensic laboratory requires that a specific "Evidence Submission Request Form" be completed. What information should be included on the form?

Explain starch gelatinization, Starch gelatinization Undamaged starch ...

Starch gelatinization Undamaged starch granules are insoluble in cold water but can imbibe water  reversibly i.e. they can swell slightly and then return to their original siz

Hypothermia-open heart surgery, Hypothermia :  Hypothermia reduces the met...

Hypothermia :  Hypothermia reduces the metabolic requirements of the body thereby reducing oxygen consumption. It also preserves high-energy phosphate stores of the body. At norma

Hypothermia, Hypothermia As the blood passes through the oxygenato...

Hypothermia As the blood passes through the oxygenator, hypothermia machine allows the blood to cool to the required temperature. Generally, the temperature is brought dow

Name the alloys which are commonly used, Name the alloys which are commonly...

Name the alloys which are commonly used The most commonly used alloys are Ti-6Al-4V and Ti-6Al-4V extra low interstitial (ELI). Commercially pure Titanium comes in different gr

Atp, what is atp explain in detail?

what is atp explain in detail?

Q- fever, Q- fever Q-fever or query fever is primarily a disease of animal...

Q- fever Q-fever or query fever is primarily a disease of animals transmitted to human through inhalation. It is also known as Balkan influenza, Abattoir fever or Coxiellosis. It

Explain the secondary structure of proteins, Explain the Secondary structur...

Explain the Secondary structure of proteins The secondary structure of a protein involves the way that the chain of amino acid either twists or folds back upon itself to form a

Explain monascus species, Explain Monascus species Most of the reports ...

Explain Monascus species Most of the reports of food colourants from microbial sources involve Monascus species, particularly Monascus purpureus, followed by  Rhodotorula speci

What are the final digestion products of protein, What are the final diges...

What are the final digestion products of (a) protein, (b) fat, (c) starch?   a) Proteins are digested to amino acids, b) fats are digested to fatty acids and glycerol,

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd