Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Autogamy - Patterns of Sexual Reproduction It is known to take place in many ciliate protozoans including Paramecium. Autogamy involves same nuclear behavior like in conjugati
EPIDIDYMIS - All seminiferous tubules form short straight tubules as tubuli recti, open into wider network of rete testis. From rete testis 15-20 fine convoluted tubules,
Q. Do the membranes form only the outer wrapping of cells? Lipid membranes do not form only the outer cover of cells. Cell organelles, such as the Golgi complex, lysosomes, chl
Explain Triangular Full Mucoperiosteal Flaps - Endodontic Surgery - Only vertical releasing incision with the Horizontal incision, -Used at the area of important anatom
Photometer Photometer (Figure shown below) measures the intensity of light. The metallic plate A is a photocell which emits electrons from its surface when light of sufficient
Describe Prostaglandin - Availability, Administration and Alternatives ? Prostaglandin El (available in India as Prostin VR, Pharmacia) is a very essential drug and should be a
how can i read role od fungi as saprophyte?
Define Paediatric Problems and Nutritional Management? The process of accepting and digesting food in adequate amounts to meet nutrition needs is termed as feeding. Certain gro
Question 1 A patient is admitted to the hospital with suspected pulmonary tuberculosis. How would you confirm this disease? Answer the following questions a)
Explain Ailing Implant Which may indicate an increased risk for failure, which can be of temporary significance or amenable to treatment and is generally a soft tissue aberrati
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd