Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Fruits Diabetics should have fruits every day. Be careful to select fruits and fruit juices, citrus fruits, such as oranges, grapefruit should be included. Tell them to eat fru
When the chromosomes are depleted of histones they are seem to have a central fibrous 'protein scaffold' or nuclear matrix to which the DNA is attached in loops. Therefo
In cats, curled ears (Cu) results from an allele that is dominant over an allele for normal ears (cu). Black colour results from an independently assorting allele (G) that is domin
Explain for Procedure Quantitative Determination of Viable Microbes? Now carry out the exercise following the steps included herewith: 1. Label the diluent tubes from 10 -1
Explain about the increases or decreases or shifts in demand terminology. Market into equilibrium P 1 Q 1 , here demand D 1 equals supply S 1 • When price reduce fromP 1
Functions of Citric Acid Cycle The citric acid cycle is an amphibolic pathway i.e. it is involved in both anabolic and catabolic processes
Explain the working of Pulmonary Circulation? In pulmonary circulation, blood is pumped to the lungs, where carbon dioxide is exchanged for oxygen. Blood returning from the bod
TYPE S OF BONE - On the basis of its texture , a bone is of two types - Spongy or cancellous or tubercular bone and Compact or periosteal or dense bone.
EXCRETION IN HUMAN -
The Upper Border of the Heart A: Mark a point on the lower border of the left second costal cartilage 1.2 cm away from the sternal margin. B: Mark a point on the upper bord
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd