Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q How does the excretory system of nematodes work? The metabolic residuals of nematodes are together by two longitudinal lateral excretory channels that open in one single excr
What is Sporocyst? Specify. A stage in the life cycle of trematode flukes. Sporocyst develops from the mericidium found in intermediate host. Every sporocyst contains the germ
Respiratory Insufficiency Respiratory insufficiency usually indicate inadequate exchange of oxygen and carbondioxide to meet the needs of the body during normal activities.
Braiding technique for SP removal: - Three small size files inserted alongside the silver point. - Files twisted together to engage silver point - Withdraw the f
A v i a n leukosis (Sarcoma group of retroviruses) This is a complex of viral diseases caused by an avian retrovirus with various manifestations such as lymphoid leukosis,
Describe the structure of the stomach. How is it modified to carry out its functions? How does it compare to that of the fetal pig?
Describe about the mitochondrial membranes The composition of the two mitochondrial membranes is entirely different. The outer membrane is rich in lipids and contains nearly 50
Trophic Level - Ecosystem In an ecosystem, the various biotic components are related to each other and form food chains. If we group all the organisms in a food chain accordin
Is it expected that a change in the primary, in the secondary or in the tertiary structure of a protein will produce more functional consequences? Any change of the protein str
What are the main human diseases caused by prions? The main called human diseases of such type are the Creutzfeldt-Jacob disease (CJD), the kuru and the Gerstmann-Sträussle-Sch
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd