Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Intra enterocyte transport - non-haem iron absorption? Intra enterocyte transport: In the enterocyte, the absorbed iron can have one of the following metabolic fates:
Q. What are the hexoses? What are some examples of hexoses with vital biological functions? Hexoses are carbohydrates whole of six carbons. Galactose, fructose and Glucose are
Illustrate the types of Bone Remodeling Bone remodeling occurs on existing bone surfaces. However, unlike modeling, remodeling cannot cause large changes in bone structure at a
Define Assessment of Chromium Status? No specific tests are currently available, which could help us to determine chromium status. Another reason being the chromium content of
Illustrate the Applications of Gellan gum Gellan is a highly versatile food ingredient and has numerous applications in foods. The combination of gelatin with gellan, by compar
what is rennin? how does it work? and what is its optimum pH level and activity temperature?
Why is there little or no grass in the forest? 1. Because of the presence of the bushy trees close together in the forest, sunlight does not penetrate simply to the ground. Thi
Composition of Plant and Animal Tissues Food supplies nutrients popularly known as major and minor nutrients based on the quantities in which they are required for the living b
what is the technical term used for the animals that eat yellow grass?
Explain Radial Symmetry in Classification of the Animal Kingdom? All of the animals besides the sponges are considered to belong to the Eumetazoa, or the "true animals" because
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd