Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
How Vaginal infections cause Sulfonamide creams, other ''broad-spectrum'' vaginal preparations, and currently available preparations of Lactobacillus species or dairy products
Q. Investigation of aortic regurgitation by Surgical Therapy? The recommendation for Aortic valve replacement is only for those patients with Severe AR. If patients with mild A
how to draw a decomposition diagram
Fungal Infections Intravenous infusion of amphotericin B deoxycholate frequently causes fever and chills, and sometimes headache, nausea, vomiting, hypotension and tachypnea,
procees of excretion in reptiles
Annelids - Regeneration in Invertebrates Between the segmented worms both the polychaetes and oligochaetes have remarkable powers of regeneration. Leeches totally lack this ca
What is plutonium reprocessing? Why is it a big environmental issue? Plutonium is the highly radioactive chemical element produced from uranium by nuclear plants. Plutonium can
Ethylene - Dormancy Ripening of fruits involves a chain of cellular events like: Rise in the rate of respiration, Breakdown of higher carbohydrates into carboxylic
what si tubal pregnancy ,
Food Chain - Ecosystem In a food chain, the food energy is transformed from a given source through a series of species, each of which eats the one before itself in the chain.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd