Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What is the association between inflammation and fever? In the tissue region where inflammation occurs prostaglandins, cytokines, bacterial toxins, interleukins and endothel
various parameters which are used in water quality measurement
What is cell biology? Cell biology is the science of studying how cells function like as their reproduction and metabolism, their internal and external anatomy.
A 20 year old female university student came to the clinic complaining of palpitations. She has had occasional rapid heart rates but never lasting more than 2 minutes. This time it
How the needles are classified by thier point geometry Needles may also be classified by their point geometry; examples include: - taper (needle body is round and tapers smo
At 1 AM, an impermeable membrane separates a 1 liter solution of 2M KCl in the left compartment from a 1 liter solution containing both 1M NaCl and 1M KCl in the right compartment.
Q. What is ammensalim? The Ammensalism is the ecological interaction in which an individual harms another without obtaining benefit. The Ammensalism is an inharmonious (negativ
Which of the following groups is NOT ionizable? Select one: a. Guanidinium b. Imidazole c. Phosphoryl d. Amine e. Aldehyde
A)Which of the following statements about DNA structure is true? 1.The nucleic acid strands in a DNA molecule are oriented ant parallel to each other, meaning they run in opposite
main branches of biology
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd