Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Show defense mechanism when inflammation fails, Q. What is the defense mech...

Q. What is the defense mechanism that begins to work when inflammation fails to stop an infection? If the inflammatory attack is not sufficient to halt the infectious process t

Define the interaction of vitamin c with iron, Define the Interaction of Vi...

Define the Interaction of Vitamin C with iron? Ascorbic acid powerfully enhances absorption of non- haem iron and reverses the inhibiting effect of tea and calcium phosphate. I

Ecology lab assignment, i need to complete a model on loop analysis Java an...

i need to complete a model on loop analysis Java and answer questions on my assignment sheet....any experts to help me do my lab homework?

Difference between plants and animals, DIFFERENCE BETWEEN PLANTS  AND ANIM...

DIFFERENCE BETWEEN PLANTS  AND ANIMALS - S . N o . C h a ra c ter P l an ts A n i m al s 1 Nutrition

Why did it not drop more give reason, Mr. Smith read that cholesterol was b...

Mr. Smith read that cholesterol was bad for his health so he eliminated all foods and food products containing this molecule. He later found that his cholesterol level dropped only

Explain the occurrence of vitamin B2, Explain the Occurrence of vitamin B 2...

Explain the Occurrence of vitamin B 2 Vitamin B 2 (riboflavin) occurs in nature almost exclusively in a combined form i.e. esterified with phosphoric acid as riboflavin-5'-ph

What is the meaning of ideometric approach, What is the meaning of Ideometr...

What is the meaning of Ideometric approach Ideometric approach in the context of neuropsychological assessment emphasises the patient's premorbid functioning with reference to

Explain vasopressindrug term, Explain Vasopressindrug term? As a single...

Explain Vasopressindrug term? As a single bolus of 40 U, vasopressin has been recommended as an alternative to epinephrine in VF/pulseless VT refractory to defibrillation. Furt

Male reproductive system - urethera, URETHRA - It is common duct as ...

URETHRA - It is common duct as sperms & urine both pass from it. It receives juices of prostatic gland & cowper's gland. Urethra is 20 cm long, passes through the peni

Active instruments-small occlusal, Active instruments -This category o...

Active instruments -This category of instruments actively engage a restorative , enabling a specific dislodgment force to potentially lift off the prosthesis -These devices

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd