Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Examine the benefits and risks bird flu, Examine the benefits and risks bir...

Examine the benefits and risks bird flu research poses to society. Indicate if you believe there are more benefits or more risks associated with this research, and give a rationale

Explain the oligosaccharides (dp: 3-9) - carbohydrates, Explain the Oligosa...

Explain the Oligosaccharides (DP: 3-9) - carbohydrates? Oligosaccharides consists of short chains of monosaccharide units joined by covalent bonds. The glycosidic bond may be α

Explain purpose of therapeutic dietary adaptations, Purpose  of  Therapeuti...

Purpose  of  Therapeutic Dietary Adaptations A therapeutic diet is a quantitative/ qualitative modified version of a basic nutritious diet which has been tailored to suit the c

Cell theory, Cell Theory The term cell was first used by an English cyt...

Cell Theory The term cell was first used by an English cytologist, Robert Hooke (1665) not for unit protoplasmic masses, but for the well defined and empty compartments, he obs

Theories to explain fine structure of chromosome, THEORIES TO EXPLAIN FINE ...

THEORIES TO EXPLAIN FINE STRUCTURE OF CHROMOSOME (1 ) Multistranded theory Steffenson 1959 - each chromosome composed of two chromatids (Half Chromosome) and each chromat

The cell, how autophagy help in converting a tadpole larva into adult amphi...

how autophagy help in converting a tadpole larva into adult amphibian

Explain the leydig cells, In an adult male, which of the following is true?...

In an adult male, which of the following is true? A. The plasma membranes of Leydig cells contain LH receptors. B. The plasma membranes of Sertoli cells contain FSH receptor

Determine the concept of imitation in the learning process, Determine the c...

Determine the concept of  imitation in the learning process The concept of  imitation in the learning process is also a key developmental concept for infants and young children

Lymph, why is it known as middle man

why is it known as middle man

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd