Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain about the Foods Effect on Drug Utilization? The following illustrations highlight the effect of food on drug utilization. Liver and green leafy vegetables can decrea
Social Determinants of Health - Unemployment That unemployment gives rise to social insecurity and psychological stress is well recognised. Fears and uncertainties are known t
Which are the plant tissues responsible for the supporting of the plant? The plant supporting tissues are the collenchyma and the sclerenchyma. The collenchyma is made of li
What is the typical vegetation of the grasslands? The Grasslands are mainly formed of herbaceous (nonwoody) vegetation: grass, small trees and bushes.
1000 words
A restriction map of plasmid and a human gene of identified sequence is demonstrated below. Your job is to clone the human liver cDNA for that gene than the start codon is closer t
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Is there interphase again between meiosis I and meiosis II? There is no interphase nor DNA duplication among the divisions of meiosis. Only a short interval called diakinesis h
Explain Supravalvular aortic stenosis murmur? Supravalvular Aortic Stenosis Murmur : Characteristic: Murmur may be loudest in 1st Right ICS. It isn't associated with systolic
What is optic nerve The optic nerve contains more than one million axons that initiate in the ganglion cell layer of the retina. This structure originatcs at the back of the e
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd