Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is the difference between the concepts of genome, Q. What is the diffe...

Q. What is the difference between the concepts of genome and karyotype? Genome is the set of DNA molecules that characterizes each species or each living being. The concept the

AMOEBA, mORPHOLOGY OF AMOEBA AND ITS ADAPTATIONS

mORPHOLOGY OF AMOEBA AND ITS ADAPTATIONS

Diabetes mellitus management after open heart surgery, Diabetes Mellitus Ma...

Diabetes Mellitus Management after Open Heart Surgery :  Diabetic patients undergoing coronary artery bypass surgery who are on oral hypoglycemic drugs are pre operatively s

Explain arteries in comparison to veins, Which of the below statements does...

Which of the below statements does NOT apply to arteries when comparing them to veins: a) Have thick walls b) Carry blood away from heart c) Highly elastic walls d) Ha

How are arthropods characterized, Q Concerning germ layers and the presence...

Q Concerning germ layers and the presence of coelom how are arthropods characterized? Arthropods are triploblastic and coelomate beings (they have three germ layers). Q. Co

Diarrhoeas disease, Diarrhoeas disease: Diarrhoeas disease rank among ...

Diarrhoeas disease: Diarrhoeas disease rank among  th most leading causes of children's death in developing countries. We shall discuss two main problems in this section i.e.

Similarities between chlorplasts and prokaryotic cells, What are the simila...

What are the similarities between chlorplasts and prokaryotic cells?

Neuropsychological screening of adults, Neuropsychological screening of adu...

Neuropsychological screening of adults Normally, a neuropsychological examination explores in depth an individual's performance in a wide range of functional domains. There are

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd