Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What are the major events of the first mitotic period? The first mitotic period is the prophase. During prophase the following events occur migration of each centriole pair
Q. Explain Consciousness as inner state? Consciousness as inner state: We are conscious of thoughts, images, emotions and memories within ourselves though they may not have phy
What is Photosynthesis ? Photosynthesis is the method by which plants trap radiant energy from the sun and convert the energy into a biochemical form. This biochemical energy
Which level of a gene, such as the ADH gene and its encoded product should have the highest homology among different species? Explain your answer. A. The genomic DNA sequences o
Consider 100 ml of 10% solute and 10 ml of 50& solute. Which has the greatest concentration of solute? What is the concentration of solute? Which has a greater quantity of solute?
Explain the Composition of Blood Agar? Infusion from beef heart - 500 gm Tryptose - 10.0 gm Sodium Chloride - 5.0 gm Agar - 15 gm Distilled water - 1000 ml pH
Determine Energy demand for Vigorous or vigorously active lifestyles? These people engage regularly in strenuous work or in strenuous leisure activities for several hours. Exam
Endothecium - Anther Wall Layers The layer of cells lying immediately next to the epidermis is the endothecium, which is responsible for the dehiscence of the anther. It is us
DISORDER S OF THE ADRENAL CORTEX - ( i ) ADDISON'S DISEASE : This disease is caused by the deficiency of mineralocorticoids and glucocorticoids. Its symptoms include l
Q. Explain Disorders of the gastrointestinal tract? The diseases and disorders of the gastrointestinal (GI) tract. Have you ever suffered from abnormal symptoms of the gastroin
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd