Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Long-term responses - Behaviour of Plants Plants alter their course of development to suit the prevailing environmental conditions. For example, leaf maturation and fall, onse
How do you prevent food borne infection? Prevention of Food borne infections: Avoid consumption of contaminated foods and water Eat properly cooked foods Wash
Three ways in which food might become contaminated by harmful bacteria. Food may become contaminated:- (i) from the unwashed hands of a food-handler, (ii) by house- flies
Subordinate Distinctions In addition to the above mentioned designations, master horizons are further characterised by specific properties such as distinctive colour or the ac
general characteristics
Q. What do you mean by Descending Aorta? The descending aorta begins at the level of the fourth thoracic vertebra. It is defined through the cardiac shadow on the CXR, as it l
what are some examples of eperimenting palants?
How to prevent or overcome this nutritional deficiency? A large number of government schemes and programmes have been launched about which we have already studied in the Publi
How can the concept of recombination frequency be used in genetic mapping? Genetic mapping is the determination of the location of the genes in a chromosome. By determining
What are the three qualities specific to colour vision There are three qualities specific to colour vision- hue, saturation, and brightness. Hue: Hue is the function of a wa
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd