Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is Stem cell therapy Most defects / diseases treated by stem cell therapy are not genetic in origin so the therapy will have no impact on gene pool in terms of change in f
Q. Serotonin - Enhancement of memory? Increased level of serotonin is implicated in the enhancement of memory. It plays a significant role in classical conditioning wherein sti
Explain the Complications of Burns? Most minor burns are superficial and do not cause complications. However, deep second-degree and third-degree burns swell and take more time
How to determines the actual availability of nutrients The amount of a particular nutrient determined analytically does not necessarily represent what is available but is merel
Determine the purposes of vital signs The vital signs reflect the functioning of vital organs of the body i.e. heart, brain and lungs. They indicate the basic functions of body
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Define Criteria for Assessment of Pyridoxine Status? Vitamin B 6 status is most appropriately evaluated by using a combination of indicators, namely plasma PLP concentration,
Health Hazards with poor management of Bio-medical waste Health hazards associated with poor management of Bio-medical waste are: - Injury from sharps to staff and waste han
what is condom???
Define Active or moderately active Lifestyles - physical activity? These people have occupations that p-e not strenuous in terms of energy demands, but involve more energy expe
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd