Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
A Molecule of DNA is 2.17 um long. The ends of the molecule become strongly ionixed: negative on one end, positive on the other. The helical molecule acts like a spring and compres
Q. Write in 3-4 lines about the term belief? Beliefs are learned by us when we were young. These include religious beliefs and beliefs about behaviour. Some beliefs lead to hea
Agreed-upon Procedures - Non-assurance Engagements Within an engagement to present agreed-upon procedures, the auditor is engaged to carry out those procedures of an audit nat
What key idea, contained in Malthus's essay on populations, helped Darwin formulates his theory of natural selection?
Why, even though they have an open circulatory system, can flying insects like flies beat their wings with great speed? In insects the circulatory system is open but this syste
Explain Positive Staining Technique? Here, a stain has a positively charged chromophore that gets attached to the negatively charged outer surface of the microbial cell and thu
Advertising Executive?
Smooth muscles These muscles are beyond our control. That means these muscles are controlled by autonomic nervous system. They are non-voluntary muscles. They are found in thin
Obelia is considered to be of special interest in zoology as an animal showing an intermediate grade of organization?
What is replication fork??
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd