Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain about vitamins, Vitamins Vitamins, as you may already know, der...

Vitamins Vitamins, as you may already know, derive its name from the word 'Vital Amine'. These are the organic compounds required for normal metabolism, growth and developme

What are the hormones secreted by the neurohypophysis, Q. What are the horm...

Q. What are the hormones secreted by the neurohypophysis? What are their respective functions? The neurohypophysis secretes the antidiuretic hormone (ADH) and oxytocin. Oxytoci

What is the other name given to sex chromosomes, What is the other name giv...

What is the other name given to sex chromosomes? What is the function of sex chromosomes? Sex chromosomes are also known as allosomes (the other chromosomes that are not sex ch

Explain adverse effects of abacavir, Adverse effects of Abacavir  In 3-...

Adverse effects of Abacavir  In 3-9% of patients, a severe hypersensitivity reaction, usually with fever and sometimes with respiratory or gastrointestinal symptoms, malaise an

What are the grain boundaries, What are the Grain boundaries Grain boun...

What are the Grain boundaries Grain boundaries disrupt the motion of dislocations by a material, so reducing crystallite size is a common way to improve strength. Since grain b

Define water distribution and compartments of body water, Define Water Dist...

Define Water Distribution and Compartments of Body Water? Each one of us has a veritable 'sea within', held in place by multiple membranes and our protective envelope of skin.

Activity of dna polymerase during the replication process, Which of the fo...

Which of the following is a false statement regarding the activity of DNA polymerase during  the replication process? A. DNA polymerase reads the template strand in the 5' to 3

Social determinants of health - food, Social Determinants of Health - Food ...

Social Determinants of Health - Food The twin paradox of food i.e., research showing excessive intake can lead to a variety of diseases whilst at the same time food poverty be

How dissimilar are cnidarians from poriferans, Q. Concerning tissue complex...

Q. Concerning tissue complexity how dissimilar are cnidarians from poriferans? Poriferans present only some dispersed specialized cells with no tissue differentiation, Cnidaria

Chemical changes due to spoilage, Q.Explain Chemical changes due to spoilag...

Q.Explain Chemical changes due to spoilage A food item may have apparently looked safe and wholesome for you to eat, but the rumbling and grumbling in your stomach at night may

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd