Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Why is it more probable that the photosynthetic prokaryotes appeared before the aerobic eukaryotes? It is more feasible that photosynthetic prokaryotes appeared before the aero
defitionce of vitamin d
Q. How is the sound vibration captured by the tympanum transmitted through the ossicular chain of the middle ear? The acoustic transmission from the middle to the external ear
how get a aids
Q. What is Tricuspid valve annuloplasty? It depends upon the cause of tricuspid regurgitation. Specific therapy is directed towards the particular cause of pulmonary artery hyp
C o w - po x (vaccinia) E p idemiology: This infection, although mostly occurring in cows, sometimes also occurs in buffaloes. Under natural conditions, t
Ross Operation : In this technically demanding operation, the aortic valve is replaced by patient's own pulmonary valve (autograft) and a pulmonary or aortic allograft (homo
What do all organic compounds contain? The key element is carbon. Organic compounds are all carbon-having compounds. By definition, an organic compound having carbon. Alt
Which of the following is true for the following spanning membrane proteins? A. The mAChR (muscarinic Acetylcholine Receptor) is a spanning membrane protein located in the memb
Illustrate about the metabolic waste products in the cornea? Metabolic Waste Products During the metabolism various waste products including lactic acid, protein an
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd