Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What are the Causes of constipation? The most common causes of constipation are poor elimination habits, a lack of fibre in the diet, insufficient fluid intake, lack of exer
How does the hypophysis-corpus luteum negative feedback work? What is the name given to the atrophied corpus luteum after this feedback process? After ovulation the estrogen an
Name the proteins used in oteoblast Some of these proteins include fibronectin, thrombospondin, osteopontin and osteoadherin (most of them have RGD cell binding peptide for bin
Explain the Pseudomonas - Characteristics of Bacteria? Pseudomonas are aerobic, gram negative, straight or slightly curved rods that are motile by polar flagella. Many species
protozoa is divided into how many sub phykum?
how does the digestive system of an arthropod operate
The principal nitrogenous excretory compound in humans is synthesised: 1. in kidneys but eliminated mostly through liver 2. in kidneys as well as eliminated by kidneys 3.
Blood Plasma - Circulation Centrifugation of blood results in its separation into two portions - a packed mass of cells which constitute around 45 per cent of the volume of t
respiration in animals?
Genetic Defect in Pyruvate Dehydrogenase A defed in any of the protein subunits of PDH can result in decrease or complete loss of activity. Severe cases are usually fatal. Sy
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd