Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Which one of the following is an example of a tree having simple leaf ? 1. Neem 2. Rose 3. Mimosa pudica 4, Peepal.
Define Maternal Nutrition and Foetal Outcome? Maternal malnutrition has deleterious effects on both the mother and the offspring. Inadequate energy intakes, iron deficiency an
Genetic Defect in Pyruvate Dehydrogenase A defed in any of the protein subunits of PDH can result in decrease or complete loss of activity. Severe cases are usually fatal. Sy
Q. What is coronary disease? The Coronary disease, or the coronary insufficiency, is a disease in which there is total or partial obstruction of one or more of the arteries tha
Founder effect The difference in gene pools amongs an original population and a new population founded by one or a few individuals randomly separated from the original population,
In which parts of the circulatory system are there valves? There are valves in the heart (between each atrium and ventricle, in the aorta and pulmonary artery), in some of the
V i ra l Diseases A v ian encephalomyelitis This is enterovirus disease of chicken, pheasants, turkeys and Japanese quails caused by the member of the family Pi
describe the different types of genomes that viruses can have
What is Polymerase Chain Reactionin genetics? A great advance in sequencing and cloning DNA is the polymerase chain reaction, devised by the American biochemist Kary Mullis in
Q. Do the phylogenetically proximal species have cells with proximal chromosome counts? The number of chromosomes typical of each species is proximal for phylogenetically proxi
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd