Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

#title.animal biodiversity., why obelia is considered to be of special inte...

why obelia is considered to be of special interest in zoology ass an animal showing intermediate grade of organisation

What are the structures that form the external ear, What are the structures...

What are the structures that form the external ear? What is its function? The internal ear comprises the pinna, or auricle, and the auditory canal. Its function is to conduct t

Is herbivorism a form of predatism, Is herbivorism a form of predatism? ...

Is herbivorism a form of predatism? Herbivorism is a type of predatism in which first order consumers feed from producers (plants or algae). For instance, birds and fruits, hum

Zygote and fecundation formation occur in these plants, Q. How do zygote an...

Q. How do zygote and fecundation formation occur in these plants? Do these processes depend on water? The microsporangia in the male strobile rupture at the right time of the y

Fibre requirements for ulcerative colitis, Q. Fibre requirements for ulcera...

Q. Fibre requirements for ulcerative colitis? Fibre: Eliminating roughage seems to have a better effect on preventing relapses of the disease. A low residue diet may be given d

Determine the term anapsid , Determine the term Anapsid ? The type of s...

Determine the term Anapsid ? The type of skull found in reptiles and seen today only in turtles. Behind the opening of the orbits the skull is solid and lacks temporal openings

Outbreak of staphylococcal food poisoning, Q. What are the conditions favou...

Q. What are the conditions favouring the outbreak of Staphylococcal food poisoning? • Botulism is caused by the bacteria Clostridium botulinum. • All low acid foods can s

Explain fossn ovalis defect ostium secundum defect, Explain Fossn Ovalis De...

Explain Fossn Ovalis Defect (Ostium Secundum Defect) ? This is the most common type of atrial septal defect. The usual approach is through a midline incision and median sterno

Style of stigma interaction, Style of Stigma Interaction The style has...

Style of Stigma Interaction The style has been distinguished into two types: In open styles a stylar canal is present which is lined with a well-developed glandul

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd