Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
In patients with coronary artery disease an acute coronary syndrome event can precipitate heart failure. Mitral regurgitation occurring as a result of papillary muscle ischemia con
Controlled Hypothermia Although birds and mammals frequently function in the homeothermic mode and maintain relatively high stable temperatures, many mammals and some birds ha
What is Carbohydrates? Carbohydrates : Carbohydrates function mainly as immediate sources of energy, stored energy such as starch, and structural components of cells. Carbohyd
How are the antibodies against the Rh factor formed? The Anti-Rh antibodies are made by humoral immune response. When the Rh- individual makes contact with the Rh factor this i
Adverse effects of Abacavir In 3-9% of patients, a severe hypersensitivity reaction, usually with fever and sometimes with respiratory or gastrointestinal symptoms, malaise an
Arterial Blood Gas Studies: Purpose 1) A measurement of partial pressure of oxygen and carbon dioxide in arterial blood, as well as the pH of the blood. 2) The Partial p
When the chromosomes are depleted of histones they are seem to have a central fibrous 'protein scaffold' or nuclear matrix to which the DNA is attached in loops. Therefo
Bacterial food poisoning Food poisoning is an acute gastro-enteritis or intestinal disorder resulting from the ingestion of foods contaminated with either living microorganism
All tissues have some capability for synthesis of the non-essential amino acid remodeling, amino acids and conversion of non-amino acid carbon skeletons into amino acids and other
Define about the Radiant Energy? Radiant Energy: Radiant energy whether in the form of the ultraviolet rays of sunlight or as ionizing electromagnetic and particulate radiation
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd