Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What are the major cellular features of fungi? There are pluricellular and unicellular fungi. All fungi are heterotrophs and eukaryotes. Fungi have cells with cell wall m
Nongonococcal nonchlamydial urethritis and cervicitis Nongonococcal urethritis (NGU) in men is often nonchlamydial as well. Possibly caused by Ureaplasma urealyticum, Mycoplas
Determine Energy Density of Human Milk? The energy density of human milk depends on the relative proportions of protein, fat and the principal carbohydrate, lactose. Lactose co
Q. How different are fecundation in chondrichthyes and in osteichthyes? In chondrichthyes fecundation is internal by resources of copulation. In osteichthyes fecundation genera
How the Required weight gain Calculated? Weight gain is another aspect deserving attention. 'Allowable' or recommended weight gain could be higher than for adults. The weight g
How much ampicillin (sodium sal, mw=371.40) would you dissolve in 400 mL of water to make 80 mg/ml solution of ampicillin?
Explain Difficult Feeding and Poor Growth to recognition of congenital heart disease? Difficult Feeding and Poor Growth: The parent of an infant with CHD may complain that the
Describe Pericardial Rub and their Characteristic ? Generation of sound: The sound is generated due to rubbing of visceral and parietal pericardial surfaces against each other
control of microorganisms by chemical method.
What is Energy ? Energy Energy is defined as the capacity to do work. Work is defined as the movement of a mass, or the product of the force and the distance through which t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd