Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Digestion of various disaccharides of the diet The enzymes from brush border membrane of small intestine complete the digestion of various disaccharides of the diet and the pro
Explain the Health Economics? Health economics concentrates on application of the principles and rules of economics in the sphere of health. In broad terms, it includes analysi
Adverse Effects The most common adverse effects of itraconazole are dose-related nausea and abdominal discomfort. Rash and serious hepatic toxicity can happen. The drug can ca
Which is the brain region responsible for the coordination and equilibrium of the body? In the central nervous system the cerebellum is the main controller of the motor coordin
Discuss six bad listening habits. Which do you think is the biggest challenge for you personally?
Hemicryptophytes - Classes of Life Form In this case the perennating buds or organs are situated at the soil surface where they are protected by soil and fallen leaves. These
How is synthesis of soluble proteins taking equatorial part on the surface of lens? Synthesis of soluble proteins taking equatorial part on the surface of lens as follows: 1
Phylum Labyrinthomorpha - Protozoan Trophic stage, ectoplasmic network with spindle shaped or spherical nonamoeboid cells. Small group living on algae; mostly marine or estuar
Why do plants need to exchange gases with the environment? Plants require to do gas exchange because they create aerobic cellular respiration (like animals) and they need to ge
is crossing over of chromosomes is a method?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd