Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Effect of pH or Nutrient Availability One of the greatest influence of pH on plant growth is through its effect on the nutrient availability. When base saturation is less than
why are life forms significant?
Duck plague Duck plague, caused by a member of Herpesviridae, has world wide distribution and occurs among domestic and wild ducks, geese, swans and waterfowls. Epidemiolo
A fatty acid having of a hydrocarbon chain and a terminal carboxylic acid group that is shown in the figure. Most fatty acids are in biology have an even number of carbo
Explain about the Gelation? Gelation refers to the process where denatured molecules aggregate to form an ordered protein network. Proteins can form a well-ordered gel matrix b
Thus, the objectives of the nutritional care process should include the following points: 1. Restoration of good nutritional status with dietary modifications and counseling.
Explain the Kingdom Fungi organisms? Kingdom Fungi consists of mostly eukaryotic, multicellular, non-photosynthetic organisms that derive their nutrients by absorption. Fungi
Q. What is the substance that stimulates the production of red blood cells? Which is the organ that secretes it? Under what conditions does this secretion increase? The substan
Question 1 Write a short note on the following Impactors Land fills Bio stimulation Green house effects Question 2 What is bioremediation? Give an account o
#questioen..what is the example of outline og phylum coelenterata
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd