Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. How DNA-RNA hybridization occurs Both DNA and RNA are able to form hybrids in solution with other RNA or DNA molecules which have complementary base pairing. Double-stranded
A group working at the University of California, Berkeley has developed "nanothermometers," little nanoparticles that can be injected into cells to measure the temperature in vario
To obtain the correct Healing Collar the following steps need to be followed: - Determine the si-e of the implant platform.76 Practical Manual - Select the emergence profile
VENOU S SYSTEM It is collecting system formed by the uniting branches as smaller and then larger veins and venacava leading to the heart. Blood from anterior part of the
What are some diseases or genetic abnormalities caused by recessive genes? Instance of recessive genetic diseases are: cystic fibrosis, phenylketonuria, albinism, galactosemia,
Renal Glycosuria Renal glycosuria is a condition in which the glucose is excreted in the urine in spite of normal blood sugar levels. Self Monitoring of Blood Glucose (SMBG
The distinct ecological importance of species supports functional diversity and has a direct bearing on the species composition of the site, and therefore on overall biodiversity.
Q. Give Choice of Catheters for Ventriculography? 1) Pigtail Catheter: This catheter developed by Judkins has end hole and side holes. The end hole permits insertion of the c
Human Impact on Carbon Cycle Human activities have greatly influenced the carbon cycle. The discharge of CO 2 , into the atmosphere is steadily increasing owing to burning of
What is succession?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd