Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Where is the gall bladder located? The gall bladder is located in the Upper Right Quadrant (URQ) of the abdomen just below the liver. It keeps bile secreted by the liver. The d
Determine about the Accommodation of eye Accommodation is the ability of the overall refracting power of the eye to change to clearly view objects at different distances. This
Explain Sodium Sodium (Nu) : In sodium-restricted diets, no salt is added to the diet which still provides approximately 50 mmoL Na. Foods containing high Na content must b
Q. Does pH affect the enzyme activity? The concentrations of hydrogen ions in solution affect the enzyme activity. Each enzyme has utmost efficiency under an optimum p H . S
Two-Kingdom Classification The history of taxonomy is as old as man himself. It may be traced back to prehistoric times because man had learnt to designate living organisms by
Define Role of Fitness in Field of Human Endeavour? Fitness plays a vital role in any field of human endeavour and influences the efficiency of a person. For this reason, fitne
How Buffer Solution Can Be Prepared? A buffer solution can be prepared to have a desired value of pH by controlling the amount of acid and its salt in case of acidic buffer and
Q. Describe U - Waves? The U-wave is usually upright if the T is also upright and is highest at low rates. When the heart rate increases to more than 90, the U-wave is rarely v
Pulmonary edema is life-threatening condition and therefore, treated as a medical emergency. As is the case with chronic stable heart failure, identification and correction of any
Spermatogonia Spermatogonia are the youngest germ cells from which spermatozoa proliferate. These lie next to the basement membrane and undergo series of mitotic divisions lea
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd