Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is Ventricular Septal Defect (VSD) ? VSD accounts for 15-20 per cent of all CHDs. The ventricular septum may be divided into a small membranous portion and a large muscula
Agricultural activities - Cause of Air Pollution Agricultural activities too are a major cause of air pollution. About 60 to 65% of carbon dioxide is produced from burning of
Q. Explain the taxonomic concepts? The history of classification is an exciting aspect of plant taxonomy. The discovery of the use of plants for food and later as medicine bega
Hypomagnesaemic tetany (grass tetany, grass staggers, lactation tetany) Hypomagnesaemic tetany is a multifactorial complex metabolic disorder, which is characterized by reduct
Are nematodes diploblastic or triploblastic animals? Just like platyhelminthes, nematodes are triploblastics, i.e., they show three germ layers (ectoderm, mesoderm and endoder
In native-valve IE, acute CHF occurs more frequently in aortic-valve infections (29 per cent) than with mitral (20 per cent) or tricuspid disease (8 per cent). CHF may develop acut
Normal or General Diet This diet is planned to be consistent with the Recommended Dietary Allowances (RDAs) of nutrients and is based on the food groups. It is usuall
Make a detailed study on Phylum Protozoa taking an example with clear labeled diagrams.
Goat pox Goat-pox is common in occurrence, and its nature is similar to sheep pox. The incubation period varies from 5 to 10 days. The disease tends to attack male kids and ewe
Braxy The causative agent of braxy is Cl. septicum. It usually affects lambs. The agent is a normal inhabitant of soil and is frequently found in the faeces of herbivores. Bra
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd