Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Can you define P-Waves? Changes in P-wave morphology have been well described in resting tracings and are very useful in identifying right and left sided hemodynamic alterat
The Svalbard ptarmigan (Lagopus mutus hyperboreus) is a small herbivorous bird that lives permanently on the island chain of Svalbard. Svalbard is located in the Arctic Circle, app
Define the term Prebiotics? Dietary Sources and their Mode of Action/health Effects We have already seen how prebiotics are defined. Let us go a little in-depth about them. Pre
Q. Proteins requirements for ulcerative colitis? Proteins: Patients with ulcerative colitis lose about 4-8 g fecal N2 as compared to the normal excretion of 2 g. In severe ulce
Potassium Potassium, the third most abundant mineral in the body, is the major cation in intracellular fluid. Forages are excellent source of potassium, usually containing 1 t
What are trophic levels? How many trophic levels can a food chain have? The Trophic levels correspond to positions on a food chain. thus producers always belong to the first tr
Define about the Population Dynamics? In this unit, we are going to study about human population who eventually suffer from these problems. Why do we want to study about human
Explain Dental Care Delivery System In the dental care delivery system: there are: patients, insurance payers and dentists For patients: Success = function + esthetics
how can i calculate the energy released from burnt peanut
Define Larval Stage of Taenia Cystcercus? The pork tapeworn (T: solium) and beef tapeworn (T : saginata , which are endoparasites of humans who are the final hosts
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd