Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What are bacteriophages? Bacteriophages are viruses specialized in parasitism of bacteria. They are used in genetic engineering as molecular cloning vehicles to insert recombin
Enrichment of soil Indirect provision of minerals to grazing livestock includes mineral fertilization of pasture and altering soil pH, however this may not be always feasible
Could you survive on a diet which contained no carbohydrate? It should be possible to survive without carbohydrate as energy can be obtained from fats and proteins.
Define the Diet intervention for lactose intolerance? Lactose is present in dairy products such as milk, cheese, yoghurt, ice cream etc. Hidden sources of lactose may include
Define Surgery? Surgery ! Does the word itself not create a feeling of anxiety and bring our thoughts towards a debilitating state of health which would be accompanied by pain,
morphological characterstics of e histolytica
NatURAL SELECTION IN BIOLOGY
BBBBBBBBBBBBBiiiiiiiiiiittttttttttcccccccchhhhhhhhhhhhhhh ass cunt.
Explain Isoniazid It is the drug of choice for treatment of latent TB infection. It should be given for 9 months in a single daily dose of 300 mg for adults and 10 mg/kg (max 3
what is qualities of phylum porifera
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd