Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Chromosomes with spindle fiber: The kinetochore fibers of spindle attach to the kinetochore region (specialized area in centromere) of chromosome, and align them at the equator of
What is the cardiovascular system The cardiovascular system, nervous system, kidneys and special sensory organ, eyes is directly affected by diabetes and leads to fatal conditi
Q. What is the evolutionary importance of pteridophytes? As the first pteridophytes, tracheophytes were also the first plants to extensively colonize the terrestrial environmen
The cystic fibrosis allele occurs in European populations with q=0.02, what fraction of this population can be expected to have cystic fibrosis?
Explain the term active transport? Active Transport : At intervals, protein assemblies involved in selective, or active transport of materials are inserted into the cell mem
What do you understand by term - acanthus The egg and larval phase of an acanthocephalan which passes from the female parasite to the feces of host.
Diagnostic Wax Up A diagnostic wax up should be done by you or got done from a laboratory for each and every case regardless of the extent or difficulty level of the case as it
Explain about the Gelation? Gelation refers to the process where denatured molecules aggregate to form an ordered protein network. Proteins can form a well-ordered gel matrix b
Q. Describe Ecological phytosociological? Field studies are desirable for an understanding of the relationship of any group of plants. If it is not possible to study the plants
The first ever australopithecine fossil was found in 1924 at Taung, South Africa. It was the skull of a 6 year old child showing a mixture of human and ape like features. This a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd