Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

The movements of the foetus in which month of pregnancy, The first movement...

The first movements of the foetus and appearance of hair on its head are usually observed during which month of pregnancy? 1. Fourth month 2. Fifth month 3. Sixth month

Detailed explanation of effects of air pollution, On living organism  ...

On living organism           Air pollution causes following effects on living organism: (a)   Effects on humans: 1.      Carbon monoxide reduces the oxygen carrying cap

What is the life cycle of a tapeworm, Q. What is the life cycle of a tapewo...

Q. What is the life cycle of a tapeworm? The Pregnant proglottids with taenia eggs are released together with human feces. If ingested by the intermediate hosts, bovineor swine

Biological species concept, Q. Biological species concept? A biological...

Q. Biological species concept? A biological species as defined by Ernst Mayr are "groups of actually or potentially interbreeding natural populations which are reproductively

Soil ph and nutrient availability, Soil pH and Nutrient Availability So...

Soil pH and Nutrient Availability Soil pH is the most important factor which governs the availability of nutrients in soil. All the nutrients are absorbed by plants in their io

Define vitamins requirement to avoid underweight problem, Define Vitamins r...

Define Vitamins requirement to avoid underweight problem? Vitamins and Minerals: If the diet provides good amounts of fresh fruits and vegetables, vitamin or mineral supplement

How does the Cornea work, How does the Cornea work, I heard that it is like...

How does the Cornea work, I heard that it is like a motor, however i''m not too sure... because a motor is in vehicle and has piston, and the Cornea is in our eyes and... Well does

Conditions necessary for outbreak of botulism, Q. Conditions Necessary for ...

Q. Conditions Necessary for outbreak of botulism? The following conditions are necessary for an outbreak of botulism: 1. Presence of spores of C. botulinum of type A, B o

What are the hormones secreted by the adrenal medulla, What are the hormone...

What are the hormones secreted by the adrenal medulla? What are their respective functions? The medullary portion of the adrenals secretes hormones of the catecholamine group:

Explain assessment of iron status - transferrin saturation, Explain assessm...

Explain assessment of iron status - Transferrin saturation? Transferrin saturation: As iron deficiency progresses, there is a decline in transferrin saturation. With deficiency

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd