Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Distribution of Nitrate Reductase and Nitrite Reductase, Distribution of Ni...

Distribution of Nitrate Reductase and Nitrite Reductase Let us see whether nitrate assimilation depends upon the reductants produced in photosynthesis or in oxidative metaboli

What is the classification that divides orders, What is the classification ...

What is the classification that divides orders? Orders are divided into Families. The hierarchy of classification of living things most usually used is, from broadest to nar

Advances in mineral and vitamin nutrition of livestock, Advances in Mineral...

Advances in Mineral and Vitamin Nutrition of Livestock Even though, minerals and vitamins as nutrients are as essential as energy and protein, general negligence occurs primari

Mollusca, how mollusca bore into hard substrate

how mollusca bore into hard substrate

Explain in brief about baby blues, Regarding the article "Baby Blues" which...

Regarding the article "Baby Blues" which of the following is a false statement? A. Children, whose mothers underwent severe stressful episodes during pregnancy, have higher tha

Excretory system - uriniferous tubule, URINIFEROU S TUBULE - Unit of...

URINIFEROU S TUBULE - Unit of kidney. 3-5 cm. long (30 mm). Total length of nephrons is 65 km. A tubule consists of - 1 .       Malpighian capsule           (

Define genetic engineering and biotechnology, Define Genetic engineering an...

Define Genetic engineering and Biotechnology Genetic engineering or recombinant DNA technology, involves the use of a variety of enzymes, such as restriction endonucleass and

Describe the terms – cilia, Cilia and flagella share a common structure, wi...

Cilia and flagella share a common structure, with a microtubular core which has a 9+2 organization with nine paired doublets of microtubules surrounding a central pair to form the

Mycroboilogy mycoplasma, How we write assimgment about mycobiology of mycop...

How we write assimgment about mycobiology of mycoplasma in detail

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd