Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Simple sedimentation: The process of removal of suspended, colloidal impurities by allowing water to stand undisturbed in big tanks about 5m deep. Most of the suspended particl
Fertilisation: Fertilisation is the process of fusion of male and female gametes. For fusion of male and female gametes, pollen grains have to reach the surface of the stigm
Dietitians and nutritionists Dietitians and nutritionists, who are associated with hospitals and clinics generally have regular work hours. At times, they may be required to wo
The extracellular surface of the plasma membrane is frequently covered with a protective coat of carbohydrate. A Sugar residue of this carbohydrate coat can be
What are the analyses provided by the study of human age pyramids? The study of human age pyramids can give the following analyses: proportion of individuals at an economically
mechanisms of reciprocal inhibition
Explain Fungi - Nutritional Types of Microorganisms? Fungi are filamentous, eukaryotic microorganisms, ubiquitous in nature. These grow best in dark and moist habitats. Their h
test to prove that carbondioxide is needed for photosynthesis to take place
Explain the term Microfilaments ? Microfilaments are fine fibrils, only 7 nm in diameter, composed of a protein called actin. Actin is one of the two major proteins involved
Q. How is the nervous system characterized in beings of the phylum Annelida? How can one compare cephalization in annelids to cephalization in platyhelminthes and nematodes? An
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd