Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Patient after cardiac transplant, Patient after cardiac transplant ...

Patient after cardiac transplant The major focus of medical and nursing care after transplantation is to prevent early identification of rejection so that appropriate

How is reproduction done in beings of the class reptilia, Q. How is reprodu...

Q. How is reproduction done in beings of the class Reptilia? These beings reproduce sexually through internal fecundation by means of copulation between female and male individ

#title.zoology., #question.why obelia is considered of special interest in ...

#question.why obelia is considered of special interest in zoology.

Describe the term - near-far problem, Describe the term - Near-far problem ...

Describe the term - Near-far problem Signals closer to the receiver are received with less attenuation than signals farther away. Given the lack of complete orthogonality, the

List some points to keep in mind while counselling, Q. List some points to ...

Q. List some points to keep in mind while counselling? 1. Judgment Do not be judgemental. Be a patient listener. Assess and make decision. 2. Patience and Acceptance

What is the life cycle of the hookworms, What is the life cycle of the hook...

What is the life cycle of the hookworms? Adult hookworms within the human intestine release eggs that are eliminated with the human feces. Under adequate conditions of moisture

Explain about types of insulin, Q. Explain about types of Insulin? Thre...

Q. Explain about types of Insulin? Three types of Insulin is available. The type varies in how quickly it starts working (lowering blood glucose), time of peak activity (when t

Organ transplant rejection, ORGA N TRANSPLANT REJECTION - Major his...

ORGA N TRANSPLANT REJECTION - Major histocompatibility complex is responsible for stimulating the rejection of tissue MHC is set of genes that code for cell surface glycopr

Determine the implant insertion, Implant insertion The technique for in...

Implant insertion The technique for insertion of the implant depends largely upon the system being used. In general, the final bone preparation site diameter is slightly smalle

Define carbohydrates needs in postoperative nutritional care, Define Carboh...

Define Carbohydrates needs in Postoperative Nutritional Care? Carbohydrates ensure the use of protein for tissue synthesis and energy required for increased metabolic demands.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd