Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What functions of the smooth ER and rough ER are similar?
Microfilaments comprise of the proteins The microfilaments comprise of the proteins, actin and myosin, the same contractile proteins that are found in skeletal muscle cells. Si
Explain the Integumentary System in human biology? The skin, its glands, and outgrowths form the Integumentary system. This system provides protection, sensory perception, tem
Procedure for testing Presence of Vanaspati and Rancidity in Ghee? Carry out the steps enumerated herewith for conducting this exercise. For Vanaspati Checking: 1. Take 5
Define uses isolated soybean proteins? Partially hydrolysed soy proteins possess good foam stabilization properties and can be used as whipping agents in combination with egg a
Plants and animals The activity of living organisms like lichens, fungi, bacteria, blue green algae, bryophytes is also responsible for weathering. It is referred to as biolog
Explain Esterification The process of converting an acid into an alkyl or aryl derivative. Most frequently the process consists of the reaction of an acid with an alcohol in th
What are the major features of the meristematic cells? And why do these cells need to have a high mitotic rate? The Meristematic cells have very thin cell walls, a well-central
Which Foods allowed in soft diet:- Soups - mildly flavoured - broths and cream soups. Beverages - all Meat - moist, tender meat, fish or chicken, cottage cheese, eggs
nissles granule found in
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd