Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What we need Undergloves? These are a cotton glove worn under the treatment glove for those operators experiencing discomfort to the skin on the hands. These must be replace
Explain the molecular difference between fats and oils. How do the differences affect their physical properties?
Explain the Evaluation of the Perimplant Marginal Tissues This is to be followed by Evaluation of the Perimplant Marginal Tissues: This includes the following parameters: 1)
what is the latest classification of fungi
how can i work with u as an online biology tutor?
Gelation Agar gels can be formed in very dilute solutions containing a fraction of 1% agar. In fact gelation is perceptible at concentrations as low as 0.04%. These gels are ri
A) Definitive Infective Endocarditis 1) Pathological Criteria • Micro organism: demonstrated by culture or histology in a vegetation; or in a vegetation that has embolize
Q. Define the Ionizing radiation for sterilization? Ionizing radiation are high energy electromagnetic waves including X-rays, gamma rays, particulate radiation, cosmic rays wh
Animals in the Community - Nature and Structure of Community The animals in the community are directly or indirectly dependent on the plants also time their activities in such
explain mode of nutrition
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd