Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
PHOSPHOLIPIDS Most abundant lipid present in cell membrane, also called membrane lipid. It is made up of lipid & phosphoric acid. The basic phospholipid is phosphat
Vivipary - Development Biology In flowering plants the seed or fruit generally is dispersed and germination occurs when the conditions are congenial for growth. However, in so
Q. Are Fibrates effective at lowering TG levels? Fibrates are effective at lowering TG levels by 20 per cent to 50 per cent and raising HDL by 10-35 per cent. LDL reduction var
Define Functions of selenium in humans? Until recently, the only known metabolic role of selenium in humans was as a component of glutathione peroxidase which along with vitami
How does temperature affect the rate of cellular respiration? Please explain with great detail!
Types of Amoeboid Movements As the amoeba's cell body throws out one or a few pseudopodial lobes, a temporary rear end or uroid is pulled along. The central, more fluid protop
Q. Streptokinase is a substance used in the treatment of acute myocardial infarction. How does this substance act? Substances known as fibrinolytics, like urokinase and strepto
What group did reproduction via sexual exchange of genetic information originate in?
Into which classes are mollusc divided? What are some representing beings of each class? The phylum Mollusca is separated into five major classes: pelecypods, or bivalves (Pele
What are the five conditons that can cause evolution to take place?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd