Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is enteral feeding, Tube or Enteral Feeding Ideally the patient mu...

Tube or Enteral Feeding Ideally the patient must be fed orally, but in cases where the patient is unable to take solid foods, a part or all of intake is usually given by the tu

Determine the name of material used for bcc, Determine the name of Material...

Determine the name of Material used for BCC You must be interested to know about type of material you can prepare and some material is available in hospitals and clinics for us

Population growth, Increase in population size is known as population growt...

Increase in population size is known as population growth. It depends upon number of persons added to the population and number of persons lost from the population. Addition in pop

Which is the type of nitrogen waste, Which is the type of nitrogen waste el...

Which is the type of nitrogen waste eliminated by beings of the class Reptilia? These beings excrete mainly uric acid. This substance is less toxic than ammonia and it can be k

DNA, where does the free nucleotides present in the nucleus come from

where does the free nucleotides present in the nucleus come from

Appendical skeleton, it consists of the girdles and the skeleton of the lim...

it consists of the girdles and the skeleton of the limbs

Photoperiodism, Photoperiodism Activity like breeding and migration in ...

Photoperiodism Activity like breeding and migration in animals; flowering, seed germination in plants are regulated by the length of daily period of light and darkness. This be

Explain about the forces acting on a gravity retaining wall, Explain about ...

Explain about the forces acting on a gravity retaining wall. Forces Acting on a Gravity Retaining Wall: In a general way the forces that act on a gravity retaining wall. The

Ecosystem and environment, How ecosyestem concept is useful to the study of...

How ecosyestem concept is useful to the study of environment?

Onset of puberty in female, ONSE T OF PUBERTY IN FEMALE - Attains at t...

ONSE T OF PUBERTY IN FEMALE - Attains at the age of 13 by estrogen hormone. It includes - 1. Growt h of breasts 2. Growth

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd