Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Echinoderm - circulatory and nervous system, Q. Echinoderm identity card. H...

Q. Echinoderm identity card. How are echinoderms characterized according to examples of representing beings, basic morphology, type of symmetry, germ layers and coelom, respiratory

What is angina pectoris, Q. What is Angina Pectoris? Chest discomfort i...

Q. What is Angina Pectoris? Chest discomfort is often reported by most patients especially those which are chronic cases of dyslipidemia and/or hypertension. Like diarrhoea and

Differences between continuous traits and discrete traits, Can you please d...

Can you please describe the differences between continuous traits and discrete traits and how it helps an ecologist measure variation? Please give a few examples.

Explain major divisions of the hypophysis, Q. What are the major divisions ...

Q. What are the major divisions of the hypophysis? What are their functions? The hypophysis is divided into two portions- the anterior hypophysis or adenohypophysis and the pos

Explain insect resistant crops in evolutionary way, Explain Insect resistan...

Explain Insect resistant crops in Evolutionary way Insects are a natural selection pressure so plants resistant to certain insects could have an evolutionary advantage (in

Explain the proteus - characteristics of bacteria, Explain the Proteus - Ch...

Explain the Proteus - Characteristics of Bacteria? It is gram negative, non-sporulating rod, which is characterized by rapid motility (peritrichous flagella) and swarming type

Types of leukemia, Types of Leukemia Leukaemia may be chronic  or acut...

Types of Leukemia Leukaemia may be chronic  or acute and is classified  into  the  following  categories:  i)  Acute Lymphocytic Leukaemia (ALL) This is  the most comm

Axon, Axon: Axon is a projection from the cell body. Each neuron ...

Axon: Axon is a projection from the cell body. Each neuron has only one axon. Unlike dendrites, axons are very long and are usually unbranched structures. The axon

Do enzymes act better under basic or acid ph, Q. Do enzymes act better unde...

Q. Do enzymes act better under basic or acid pH? Most enzymes act in pH between 6 and 8, a range that corresponds to the general acidic level of blood and cells. There are enzy

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd