Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
At 1 AM, a healthy squid giant axon is placed in a bath of normal squid physiological extracellular saline and is internally perfused with normal squid intracellular saline.
Typical Form or Reparative Regeneration - Heteromorphosis Sometimes the part which grows back is not the same as that which was lost. The phenomenon is called Heteromorphosis.
Benefits of energy pyramids
Encystment – Protozoan Encystment is characteristic of the life cycle of many protozoan. The protozoan secretes a thickened envelope (cyst) around itself and becomes inactive
list and explain the modes of nutrition
Subsequently many such fossils were known from France, Italy and middle East. All such fossils exhibited reduced brow ridges, steep forehead, high rounded cranial vault, short face
Explain the Occurrence of Vitamin C Vitamin C (ascorbic acid) is an active ingredient present in any animal or vegetable cell which occurs in the plant in free form and also bo
F a t cow syndrome Fat cow syndrome, also known as fatty infiltration of liver, is a highly fatal disease in high yielding dairy animals that occurs a few days before or afte
Parturient paresis (milk fever, hypocalcaemia) Parturient paresis is an acute to peracute non-febrile disease, which occurs in diary cows and buffaloes usually around the t
Give detail explanation about Swimming Swimming is an excellent form of exercise. Swimming can improve the posture and circulation. It is a healthy activity. There are certain
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd