Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Pollution - Environmental Pollution Pollution refers to any undesirable change in the physical, chemical or biological characteristics of our environment, i.e. air, water and
What is Atrial Septal Defect ? Figure: Anatomical location of Am Indication for Surgery : The presence of an ASD or PAPVC (Partial Anomalous Pulmonary Venous Conn
Direction of Energy Flow Now let us consider the first point that is the direction of flow of energy. Energy flows from lower (producer) to higher (herbivore, carnivore, etc.)
Two atoms always represent the same element if they have. A) the same number of particles in the nucleus. B) The same number of electrons. C) The same number of shells. D) The same
Vitamins necessity Vitamins are essential organic substances. They are micro nutrients and required in small quantities. They do not produce any energy by themselves.
Basic Structure of Heart The heart is small organ about the size of one's fist, located in the middle and slightly to the left of the mediastinum in the chest. The wider t
simplest way to learn their classifiction
uses of protozoa
Importance of Vitamin c Vitamin C is involved in redox processes in the organisms. It is possible, that vitamin C exerts its physiological function as a redox substance in com
Two diseases
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd