Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Ask questiona brief assignment on it #Minimum 100 words accepted#
Q. What is the pineal gland? The pineal gland also known as epiphysis or pineal body is situated centrally in the head. It secretes the hormone melatonin. A hormone produced at
BLOOD - Blood is a mobile connective tissue composed of a fluid, the plasma and the cells, the blood corpuscles. Blood is basis of life. Blood is the softest tissues
All of the following make meiosis different from mitosis; EXCEPT A. Meiosis comprises two separate divisions. B. Meiosis only occurs during embryonic development. C. Chromoso
Q. Explain about Pre - Diabetes? Pre - Diabetes is a condition where blood sugar level is above normal but below to be diagnosed as diabetes mellitus. It has been found that
why are blood formed at bones or joints
What is the relation among fecundation and the end of the meiotic process during oogenesis? The oocyte II only completes the second meiotic division (interrupted at metaphase) i
Cellular Transport Cellular transports demote to the movement of compounds across the outer wall or membrane of the cell. This transport is critical in two respects. Firstly, t
What are the steps of mitosis in order?
Define animals
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd