Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Despite its importance, determining the value or worth of biodiversity is complex and often a cause for debate. This is largely due to the fact that the worth placed on biodiversit
EVIDENC E IN FAVOUR OF THE MUTATION THOERY - Mutation theory can explain both progressive and retrogressive evolution and the occurrence of both changed and unchanged forms.
Digestion of various disaccharides of the diet The enzymes from brush border membrane of small intestine complete the digestion of various disaccharides of the diet and the pro
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
What are the cells that form the cartilaginous tissue? The main cells of the cartilages are the chondrocytes, originate from the chondroblasts that secrete the intersticial ma
Pigs Mycoplasma infection causes arthritis in limb joints in pigs, while infection with M. hyopneumoniae gave rise to symptoms of coughing and chronic pneumonia and the disease
Definition and applications
Explain the Importance of Biochemical Tests? Specific series of biochemical tests have been developed for fast identification of microorganisms in laboratories. These biochemic
Define Systematic Botany - Taxonomy? We will now learn something mare about systematic botany. The early recognition of harmful and useful plants was the beginning of systemati
Explain the Acid Fast Staining? Acid fast staining is a type of differential staining used for identification of certain bacteria, e.g. Mycobacteria which cannot be stained rea
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd