Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Determine the Lateral Cephalometric Skull View The use of this modality is limited in preoperative evaluation in implant placement for advance cases where there is a need for b
Microorganisms and Plants can synthesize all of the 20 standard amino acids. Mammals, furthermore, cannot synthesize all 20 and must obtain some of them in their diet. Those amin
Explain the Procedure for Preparation of Bacterial Smear? Start the exercise by following the steps enumerated herewith. (1) Take properly washed and dried glass slides for
what is mode of feeding in tick
human genome project
Vital Signs of clinical evaluation Patient's clinical evaluation starts with the examination of certain vital signs which are: B.P. (Take average of two regarding with atlea
Biochemical Reactions - Nitrate Assimilation Nitrate is the most readily available and preferred source of nitrogen for growth. Assimilatory reduction of NO - 3 to NH 3 is
Q. Illustrate Stents? Stents are metallic scaffolds that are deployed within a diseased segment of a coronary artery to establish and then maintain a widely patent lumen. Stent
When constructing phylogenies using maximum likelihood methods, you assume?
Define Manganese Metabolism - Micro Minerals? Intestinal absorption of Mil occurs throughout the length of the small intestine although the exact mechanism of absorption is not
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd