Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Approximate Composition of Human Tissue Table gives the approximate composition of human tissue. We all know that carbon, oxygen, hydrogen are present in water and other organ
how does a cell work ?
OLIGOSACCHARIDES They are small-sized polymers of monosaccharides having 2 - 6 simple sugars, occasionally upto 9 - 10. Oligosaccharides are soluble in water, sweet to t
The extracellular surface of the plasma membrane is frequently covered with a protective coat of carbohydrate. A Sugar residue of this carbohydrate coat can be
How are the excretory systems of the three main arthropod classes constituted? In crustaceans a pair of excretory organs known as green glands exists. The green glands collect
example of pisces
Phenoxyethanol is dangerous and can be absorbed through the skin - official sites for toxicity data, though, show little toxicity in man and some toxicity (irritation) with high do
Define Reaction of Fehling Soxhlet method? The reducing sugars formed are acted upon by the alkali of Fehling's solution to form enediols. These enediols are very unstable and
Counselling Diabetic Travellers The counsellor needs to educate a diabetic patient and /or his family members to following issues when such patients plan to travel: · Plan
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd