Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain the effect of deficiency of copper in human, Explain the effect of ...

Explain the effect of Deficiency of Copper in Human? Owing to the remarkable homeostatic mechanisms, copper deficiency in humans is rare. However, copper deficiency has been re

Dna, diagram of dna replication

diagram of dna replication

Qualities of a good counsellor, It is important to know about qualities of ...

It is important to know about qualities of a counsellor because you will be counselling a diabetic patient and his family members in clinic/home/hospital and therefore, you shoul

Kingdom fungi, what are the characteristis in species in the phyla division...

what are the characteristis in species in the phyla division

Plant physiology, why does the removal of extremity of coleoptile prohibit ...

why does the removal of extremity of coleoptile prohibit plant growth?

Matter - living and non-living, Matter - Living and Non-Living Our uni...

Matter - Living and Non-Living Our universe is made up of two basic components:, matter and. energy. Matter, as you know, has mass; it occupies space. You can touch matter. It

Explain observations seen in thyphoid, Some observations seen in this fever...

Some observations seen in this fever are: 1.  Massive loss of  lean body mass or muscle due to tissue breakdown (250-500 g muscle tissue is lost/day) leading to excessive nitro

Define significance of plants and animals on human life, Define Significanc...

Define Significance and Impact of Plants and Animals on Human Life? Plants and animals both have a great significance and unparalleled impact on human life. Most of our needs a

Demography, Demography : This is the study of populations. In the other wor...

Demography : This is the study of populations. In the other words demography is the statistical study of human population. This may be a very general science which can be applied t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd