Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define the needs for Enteral Feeding? For enteral feeding following need to be considered: - In preterm calorie density to be 0.8 Kcal/ml, - LBW formulas used: protein -
Describe the structure of the teeth? How is this tissue modified to carryout its function?
What is neurotransmitter Consider Neuron B in the frog central nervous system whose plasma membrane has a previously unknown channel that is selectively conductive to a newly
Define Historical example of management of renewable resources? There are fundamental and well developed applications of mathematical and quantitative approaches to the managem
Controlling Introduction of Alien Species As you know the alien species can cause the existing population to decrease or even become extinct. The individuals of alien species
Cattle and buffalo diseases Rinderpest: Rinderpest is the most destructive of the virus diseases of cloven-footed animals, viz. cattle, buffaloes, sheep, goats, pigs and wil
how do baby come out/
Q. How different are pteridophytes from bryophytes regarding substance transport? Pteridophytes are tracheophyte (vascular) plants that are they have tissues specialized in con
Note on production of haploid by tissue culture.
Histone methyl transferases (HMTs) having a protein domain called SET. This domain is responsible to adding methyl groups to histones. Which of the following is a false statement r
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd