Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. What are the cytochromes? Cytochromes are proteins of the interior mitochondrial membrane that are specialized in electron transfer and participate in the respiratory chain.
What is cytosolic cyclic AMP Healthy Person P takes a new drug that is a member of a drug family that results in constant levels of cytosolic cyclic AMP (cAMP) in one and only
Explain the Consequences of Malnutrition? Malnutrition manifests itself in terms of illness and death in all age groups. Children, pregnant women, nursing mothers and elderly a
Q. Explain Hypertensive Response? Hypertension at rest has long been known to be a risk factor for the development of coronary artery disease (CAD). Significant elevation of B
Does natural selection produce an effect directly on genes, on genotypes, or on phenotypes? Explain please.
For each of the cases that follow, list as many properties of the equilibrium state as you can, specially the constrains placed on the equilibrium state of the system by its surrou
Explain in details about Respiratory system Respiratory system starts from nostrils through which we inhale air in the nasal cavity. Then, air enters pharynx and goes through l
Radiographic Evaluation - criteria for endosteal implants Surgical and interventional imaging involves imaging the patient during and immediately after surgery and during the
What are the main functions of the bacterial flora within the human gut? Bacteria that live inside the gut have great significance in digestion. Some polysaccharides like cellu
Vegetable Butters Fats of this group are derived from the seeds of various tropical trees and are distinguished by their narrow melting range, which is due mainly to the arra
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd