Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Photosynthesis carbon dioxide is improved to form glucose, Q Why is it said...

Q Why is it said that during photosynthesis carbon dioxide is improved to form glucose? During photosynthesis carbon dioxide is energetically improve with hydrogen from water.

Aril - seed appendages, Aril - Seed Appendages It is an outgrowth that...

Aril - Seed Appendages It is an outgrowth that arises from the funicle or the testa near the raphe and covers the seed partially or completely. It is often referred to as the

Define vitamins requirement to avoid underweight problem, Define Vitamins r...

Define Vitamins requirement to avoid underweight problem? Vitamins and Minerals: If the diet provides good amounts of fresh fruits and vegetables, vitamin or mineral supplement

Which part of body is the main site of gluconeogenesis, Gluconeogenesis syn...

Gluconeogenesis synthesizes glucose from noncarbohydrate precursors, involving pyruvate and lactate, citric acid cycle intermediates, the carbon skeletons of most glycerol and amin

Why is it important to be familiar with the laboratory, Why is it important...

Why is it important to be familiar with the laboratory apparatus and their uses? If you do not use instruments or lab apparatuses correctly (or use an apparatus for something i

#virus, how do retroviruses reproduce?

how do retroviruses reproduce?

Explain inhibition of cancer cell proliferation and growth, Explain Inhibit...

Explain Inhibition of cancer cell proliferation and growth? Vitamin D diminishes proliferation of abnormal intestinal, lymphatic, mammary and skeletal cells and provides a pote

Define proteins as biological buffers, Define Proteins as biological buffer...

Define Proteins as biological buffers? Proteins have the ability to accept or donate hydrogen ions and by doing so they serve as biological buffers. In blood, there are three i

Define factors that affect the requirement of protein, Define Factors that ...

Define Factors that affect the requirement of Protein? Protein requirement is greatly influenced by many factors such as age, environmental temperature, energy intake, gender,

Respiratory system, whats the difference in respiratory system in mammals,r...

whats the difference in respiratory system in mammals,reptilia and amphibian?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd