Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Describe the regulation of pyruvate dehydrogenase through covalent modification. PDH exists in 2 forms : Inactive, phosphorylated and Active, dephosphorylated. The active form
What is Soil Horizons In a profile, different horizons or layers are identified by certain designations assigned after comparison of the properties of the layer with those o
Define prevention of idd - Double Fortified salt? iron deficiency anaemia and iodine deficiency disorders often co-exist, the most effective approach to control these public he
Both these neurotransmitter strengthen memory when they are released into the blood stream following learning. Stressful events stimulate release of stress hormones from the adrena
Q. Explain process of Stress Testing in Women? Estrogen has been implicated as a cause of ST depression. For years it seemed that estrogen protect women from coronary artery di
Question 1 Explain pharmacokinetic parameters observed in plasma concentration time curve Question 2 What is Gas Chromatography? Mention the quantitative applications of gas
What is excretion? Excretion in Physiology is the method of elimination of metabolic wastes and other toxic substances from the body.
Q. How are nutrients distributed through the digestive system in planarias? Planarias have single opening digestive system incomplete with ramifications that transport nutrient
What are the functions of insulin and glucagon for the blood glucose control? Glucagon enhances glycemia and insulin reduces it. They are antagonistic pancreatic hormones. Gluc
COMMON DISEASE OF CAMELS - 1 . SURRA - Surra = Rotten. Spread by biting & blood sucking flies, dropping neck, half closed eyes are common symptoms. 2 .
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd