Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Describe aerobic respiration to the pyruvic acid molecules, Q. What happens...

Q. What happens during aerobic respiration to the pyruvic acid molecules made by glycolysis? and What is the sequence of reactions that then follows? The pyruvic acid molecules

The wall of left ventricle of an infants heart, Because of developmental ab...

Because of developmental abnormality, the wall of left ventricle of an infant's heart is as thin as that of right ventricle. What would be its explicit effect on circulation of blo

Identification and care of taxonomic collections, Q. Identification and Car...

Q. Identification and Care of Taxonomic collections? Collection of plant specimens is essential for taxconomic research. Herbarium specimens become a permanent record. Select t

Salmonellosis in poultry, Salmonellosis in poultry A wide variety of se...

Salmonellosis in poultry A wide variety of serovars are prevalent among chicken, turkeys, ducks and geese. The poultry is an important reservoir of salmonellae. The common dise

Leptontene and zygotene, Leptontene: The chromosomes becomes visible,...

Leptontene: The chromosomes becomes visible, shorten and thick. The size of the nucleus increase. The homologous chromosomes start getting closer to each other. Z

Controlling of gaseous pollutants, The gaseous pollutants can be controlled...

The gaseous pollutants can be controlled through the techniques of combustion, absorption adsorption and cold trapping. (a)   Combustion: Though combustion is a major cause of i

Assignment of botany, habitat, habit, cell wall chemistry, reason why cell ...

habitat, habit, cell wall chemistry, reason why cell wall like this of Archaebacteria , eubacteria,fungi,algae,bryophytes ,pteridophyes, gymnosperms , angiosperms..

Hemorrhagic enteritis, H e morrhagic enteritis in Turkeys The viral e...

H e morrhagic enteritis in Turkeys The viral etiology in turkey poults showing sudden death was first described in1930 and thereafter reported in most turkey-producing areas.

What are the basic constituents of the cell membrane, What are the basic co...

What are the basic constituents of the cell membrane? The cell membrane is produced of lipids, proteins and carbohydrates. The membrane lipids are phospholipids, a special t

Allele-specific ligation, Allele-specific ligation  is the technique permit...

Allele-specific ligation  is the technique permitting discrimination of two allele at locus by giving two short synthetic oligonucleotides which would bind ajjacent to teach other

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd