Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
2. Describe the respiratory organs and mechanism of respiration in pila.
Q. What are the few examples of the structural function of organic molecules? Ans. Organic molecules have a structural function as they are part of cell membranes, organ w
Regulation of HMP Pathway The following factors play an important role in regulation of HMP pathway: a) The first reaction of this pathway catalysed by glucose-6-phosphate
Assume that after washing your hands, you leave ten bacteria cells on a new bar of soap. You then decide to do a plate count of the soap after it was left in the soap dish for 24 h
how these can be called as acellular?
Q. What do you mean by somites? Somites are differentiated portions of mesodermal tissue longitudinally distributed along the embryo and the somites originate the muscle portio
GASES There are 4 gases in the protoplasm which remain dissolved in its free water. These 4 gases are follows- CO 2 > O 2 > N 2 > H 2
Mass transportation is the access or the exiting of substances in or from the cell engulfed by portions of membrane. The fusion of internal substance-having membranous vesicles wit
Define Requirements of Fluid in Postoperative Nutritional Care Extensive fluid losses may occur through vomiting, haemorrhage, diesis, excudate, fever and sweating after a surg
Distinguish among epimorphic and morphallactic regeneration, giving single example of each. Explain innate immunity. Name and explain the category of barrier which includes mac
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd