Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Write the positive ion isoelectronic with neon The positive ion isoelectronic with neon must have 10 electrons and 11 protons, and thus must have an atomic number = 11. This i
Do enzymes act better under acid or basic pH? Most enzymes act in pH among 6 and 8, a range that corresponds to the general acidic level of cells and blood. There are enzymes,
A foreign DNA has to target a precise chromosomal site and integrate with the host DNA. Are the methods of gene therapy strong enough to produce desired expression without mistakes
Endodermis is the layer of cells surrounding the vascular cylinder of plants.
Describe steps of Indications definitive Surgical Treatment? Indications for Definitive Surgical Treatment : Surgery is indicated in all acute proximal dissections. Ind
Which of the below terms laws best describes the statement: Members of a homologous (pron: ho-MOL-eh-gus) pair of genes are separated at the time of meiosis (pron: my-O-sis) o
The Protein synthesis is very significant because it is by the use of genetic information to synthesize proteins in which the genes in the DNA are expressed in the phenotype. Make
Studying the main parts of a flower Study specimens of large easy flowers such as tulips or lilies. Count the stamens and observe how they are arranged about the central pistil
What are the cell types that form the phloem? What are the main features of those cells? The major cells that form the phloem are the sieve elements and the companion cells. Th
Advances in neurodiagnostic techniques Major scientific and technology advances have made it easier to correlate behaviours suspected as having a neurological basis with actual
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd