Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Give detail explanation about Swimming Swimming is an excellent form of exercise. Swimming can improve the posture and circulation. It is a healthy activity. There are certain
explain the role of photophosphorylation and chemiosmosis in photosynthesis
Define about the Carbohydrates - nutritional biochemistry? Carbohydrates, you should observe by now, are made up of carbon, hydrogen and oxygen only with hydrogen and oxygen at
Q. What is the chemical equation of the aerobic cellular respiration? The chemical equation of the aerobic cellular respiration is given below: C 6 H 12 O 6 + 6 O 2 + 36 A
How different are gymnosperms from bryophytes and pteridophytes? Gymnosperms are not cryptogamic as bryophytes and pteridophytes are. They are phanerogamic and so they form flo
What is Pancreas ? The pancreas lies in the abdominal cavity in a loop between the stomach and small intestine. The pancreas consists of two major types of cells: those produci
Observe several individuals as they run. look for the application of the principles listed. Which are violated and how. The application of the principles The law of inertia
What is Rhizopus - Fungi? Rhizopus is a common laboratory contaminant. It is a spoiling mould and found frequently on the surface of bread, fruits and vegetables. It can grow a
Metaphase This is a period of short duration, the chromosomes are at the stage of their maximum condensation and , hence more clearly visible ,Upon each side of the
Question 1 A patient is admitted to the hospital with suspected pulmonary tuberculosis. How would you confirm this disease? Answer the following questions a)
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd