Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Raised blood pressure is a major risk factor for cardiovascular disease. The higher the blood pressure, the higher the risk of stroke, coronary heart disease, kidney disease, heart
Define some Detrimental Effects of Fungi? These cause diseases of animals and humans. These either cause superficial mycoses (infection of skin, hair and nails) or systemic
Q. Define biogeographic realm? Biogeographic regions are large areas that contain characteristic assemblages of animals and plants, d elineated on account of natural barriers s
Q. What is low - density lipoprotein receptor pathway? Ans. The increasing cellular free cholesterol generated regulates the activities of two enzymes that are of crucial
What is Hemorrhage Mild to moderate capillary ooze can readily be controlled by pressure packing. A more severe venous or, in rarer instances, an arterial bleed may require cl
Q.How is it produced and what is the function of cholecystokin in the digestive process? The fat level of the chyme detected in the duodenum stimulates the secretion of cholecy
KA R YOTYPE External morphology of Chromosomes specific for each species of living organisms. Karyotype can be studied in metaphase of mitosis. Karyotype includes th
PHYLUM PROTOZOA Definition and Introduction All unicellular ( or acellular ) eukaryotic animals. Most primitive (Gr. Protos = first=zoon= animals ) organisms
what the by products of sugarcane
Explain Spread Plate Method - Pure Culture Techniques? In this method, diluted microbial suspension containing about 30 to 300 colonies is spread uniformly on the agar surface
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd