Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Q. Describe about defecation reflex? An example of a reflex having an autonomic (and somatic) component is the DEFECATION REFLEX: The rectum is generally empty, but when fec
B ov i n e leukemia Bovine leukemia, also known as bovine lymphosarcoma or leucosis, is a lymphoproliferative neoplastic disease of bovines. The virus belongs to genus Delt
List out the Principles of Food Preservation? All food preservation methods are based upon the general principle of preventing or retarding the causes of spoilage caused by mic
Q. Describe the Morphological Characteristics? One of the first steps in the identification of bacteria in food is microscopic examination to ascertain the shape, size, aggreg
Tlie phylum Cnidaria or Coelenterata, includes the faliiiliar hydras, jelly fishes, sea anemones and corals. You have olreacly studied about Cnidarialis in Units 4 and 7 of LSE-09
What are the main human degenerative diseases? The main human degenerative diseases are separated into three groups: cardiovascular diseases, neoplastic diseases and degenerat
Define Interaction of Vitamin C with other vitamins? a. Ascorbic acid and other vitamins: Ascorbic acid synthesis is diminished in thiamin and riboflavin deficiency. Vitamin
List the different suturing techniques There are a various suturing techniques each suited for a particular situation. Few of the common suturing techniques are: i) Interrup
Resistance Acyclovir-resistant HSV occurs mainly in immunocom- promised patients treated with the drug; isolates are usually also resistant to valacyclovir and famciclovir. Re
When we watch animals in the wild, most often we see them foraging for food. The foraging behaviour of animals has been a focus of behavioural studies for many decades. Natura
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd