Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define about Selenoproteins P and W? The third group comprises of selenoprotein P, an extracellular constituent with multiple selenocysteine molecules. This has an antioxidant
Define some Essential facts about the Fats? 1) Fats are essential in diets to facilitate satiety, high-energy intakes, and absorption of fat-soluble vitamins and provide essent
steps involved in glycolysis
Q. What are the major harms caused by vitamin A deficiency? How does this vitamin act in the physiology of vision? Deficiency of vitamin A (retinol) may corneal dryness (xeroph
Estrus - Estrous cycle This is the period of heat, and copulation is permitted only at this time. This condition lasts from 9 to 15 hours and is characterised by a high rate o
Basic Planes of Cleavage The basic planes along which the egg and its daughter blastomeres are divided during early cleavage are: A. Meridional Plane - the cleavag
Q. What are the specialized structures that help the adhesion between cells? The structures responsible for the union of the epithelial cells are called cell junctions. The mai
introduction
The goals of biological classification The world of animal diversity is quite complex and it requires an ability to recognise similarities and differences among organisms. Class
what are the organs of respiration in the lower form of animals?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd