Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Blockage of ducts In some bulls there is a blockage of the transport of sperm through the epidydimis usually caused by a congenital non-patency of some part of the vasa effere
Q. Why does the ingestion of vegetable fibers improve the bowel habit in people that suffer from hard stools? Some kinds of plant fibers aren't absorbed by the intestine but pl
R a b i e s It is also known as lyssa, and hydrophobia in human beings. This fatal disease is characterized by altered behavior, deranged consciousness, laryngeal paralysi
The various organs involved in the digestion process are: Alimentary tract which includes mouth, pharynx, esophagus stomach, small intestine, large intestine, appendix, rec
Define Vitamins and Minerals needs in Nutrient Requirement and Dietary Management Although the exact requirements are not known, it is generally recommended to give plenty of f
Coo k in g loss and quality Yields and cooking losses of products are important as these determine acceptability and economics of products. Higher cooking losses increase th
Explain Non-surgical Endodontic Retreatment - Missed Canal Missed root canal as it hold pulp tissues and bacteria is major cause of endodontic failure. Mandibular molar
What two abiotic factors might affect (a) an animal living at the bottom of the sea, (b) a plant growing on a mountainside? (a) The abiotic factors which might
If a cow develops a preference for eating white four o'clock flowers and ignoring pink and red four o'clock flowers, what type of selection is being demonstrated? Would the cow eve
Shapes: Nightingale Ward In the 1940s, this traditional nursing unit was based on the long rectangle pavilion type ward and self-contained unit. This concept is establis
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd