Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Minerals :- Calcium Food Source Dairy products, leafy vegetables, tofu, fish bones green Nutritional/Functional role Essential nutrient: Deficiency lead
What is produced at the end of the cell cycle? how do they compare to each other and to the parent cell? What happens to the parent cell?
Normal nutrition: a base of therapeutic diet Normal nutrition is the foundation upon which the therapeutic modifications are based. The primary principle of diet nutrition the
how twins are produced and why
Define Placental secretion of oestrogens During pregnancy? Placental secretion of oestrogens increase with progression of pregnancy. Oestrogens perform many functions. They sti
What are the structures that form the external ear? What is its function? The internal ear comprises the pinna, or auricle, and the auditory canal. Its function is to conduct t
Q. Explain about Coping mechanism? Coping mechanism is defined as the skill used to reduce stress. In other words, these are consciously used skills. Overuse of coping mecha
Sporogenous Tissue The primary sporogenous cells (PSCs) result after the periclinal division of the archesporial cells. The PSCs may undergo mitotic divisions and increase in
The five kingdom systems To cope up with above discussed problem a number of alternative classificatory schemes have been suggested with more than two kingdoms. The one which h
write breif notes on oogenesis
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd