Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
State in detail about the thylakoid membrane The thylakoid membrane contains all the factors associated with the photosynthetic electron transport leading to the generation of
CRP is a marker of systemic inflammation. As the role of inflammation in the initiation and progression of atherosclerosis becomes better understood, CRP has gained prominence as a
Explain about the Qualitative Tests for Carbohydrates? This section will familiarize you with simple techniques and tests to identify carbohydrates in a laboratory. The objecti
Explain about the Paediatric and Geriatric Nutrition? Every stage has its unique requirements due to different changing needs. Adequate and optimum nutrition support is very im
Q. What is self-catalytic RNAs? Ribozymes - Term 'ribozyme' was initially suggested by Thomas R. Cech, Nobel Prize winning biochemist, who discovered this class of RNA molecul
Define about the Storage of Zinc in Humans? Zinc is found in most organs, concentration being higher in liver, kidney, muscle, skin and bone. Zinc content of muscle, brain, lun
Explain about the Herbal of Valerius Cordus? The Herbal of Valerius Cordus published posthumously in 1561; contained not only medicinal plants found in Germany and Italy, but
Determine about the Nervous System and Behaviour Damage to certain parts of the brain will be reflected as behaviour deficits. For example, damage to the temporal lobe may affe
how can i work with u as an online biology tutor?
Q. Show the Symptoms of salmonellosis? Symptoms: The susceptibility of humans varies with the species and strains of the organism and the total number of bacteria ingested. A
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd