Scientific method, Biology

Assignment Help:

SCIENTIFIC METHOD -

The scientific approach to explain a particular phenomenon require a series of organized steps based on common sense. It is called scientific method.

A scientific method is not mere conjecture but based on facts and observations subject to test and verification.

The steps followed in a scientific method are -

1.       OBSERVATION

Observations are generally made by applying our sense like that of sight, smell, hearing, touch and taste. The most common source for observations are of course the eyes and also using binoculars, telescope, and microscope.

2.       DEFINING A PROBLEM

Observation lead to enquires. For example mosquitoes are more in summer and rainy season. Rat and mice are active during night time. Frog are more active in rainy season.

In other words, after making accurate observation, a scientist clearly defines a problem to work upon.

3.       PREDICTION OR HYPOTHESIS

It involves generalize various observation so that some reasonable answer can be put forth for a particular problem.

4.       EXPERIMENTATION

Experimental part of the scientific method is very crucial and require analytical mind of the scientist. If the result of experiment is according to those expected from the hypothesis, the hypothesis is said to be true.

5.       CONTROLLED EXPERIMENT

A control consists of everything similar to the original experiment except one particular factor which is assumed to be the cause of the phenomenon under study.

6.       FORMATION OF THEORY

When a hypothesis gets established through experimental data from several sources, it is termed a theory. A theory by no means can be said to be the ultimate truth. It is always open to question and can prove wrong by further collection of facts.


Related Discussions:- Scientific method

Menstrual cycle- reproduction, Menstrual Cycle- Reproduction Menstrual...

Menstrual Cycle- Reproduction Menstrual cycles are characteristic of primates and do not occur in other vertebrate groups. The length of the cycle is highly variable, though 2

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine the term - epilepsy, Determine the term - Epilepsy In epileps...

Determine the term - Epilepsy In epilepsy, a person suffers from recurrent seizures of various types that register on an electroencephalogram and are associated with disturbanc

Netlike membranous complex of superposed flat saccules, Q. A netlike membra...

Q. A netlike membranous complex of superposed flat saccules with vesicles detaching from the extremities seen in electronic microscopy. What is the observed structure? What is its

Define clinical feature and medical complication for bulimia, Define Clinic...

Define Clinical Features and Medical Complications for bulimia? Unlike, anorexia nervosa, in bulimia you will find that symptoms are more difficult to detect because patients a

Features of phylum porifera and eumetazoa, Features of Phylum Porifera and ...

Features of Phylum Porifera and Eumetazoa Table: Distinctive Features of Phylum Porifera and Eumetazoa The branch Eumetazoa, as we have seen above, consist of meta

Pluripotent scs:grouping of stem cells, Pluripotent SCs : Characterizing...

Pluripotent SCs : Characterizing more restricted abilities for differentiation.their sources are some celles blastocyst (5-14 days) embroys, so can from over 200 cells types i.e

Male reproductive system - semen, SEMEN - Sperms and secretion of acces...

SEMEN - Sperms and secretion of accesory glands collectively known as seminal fluid or semen. It is milky, semi-solid in nature having particular smell. pH : 7.35 - 7.5. Spe

Convey information and trends in a convenient fashion, Graphs are a way to ...

Graphs are a way to convey information and trends in a convenient fashion. For this week's Discussion Board you should search the internet for a graph related to biology. Provide u

Deficiency diseases-neonatal hypoglycaemia, Neonatal  hypoglycaemia Hy...

Neonatal  hypoglycaemia Hypoglycaemia is a metabolic condition of newborn piglets that develops in first few days of life due to decreased caloric intake and increased cataboli

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd