Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Sarcolemma
The muscle fibre is surrounded by a cell membrane called sarcolemma. The sarcolemma connects with a complex system of transverse tubules, called T-system that runs across the muscle cells near the Z-lines. The T-tubules appear as invagination of the sarcolemma into the interior of the fibre. The muscle fibre is also surrounded by a sleeve-like structure called sarcoplasmic reticulum, which is involved in the initiation of muscle contraction.
Figure: Sarcolemma
Apomixis The formation of sporophyte from the gametophyte without sexual process signifies apomixis. It relates to the replacement of alternation of a reduced gametophyte and
Q. What are the periods of the first meiotic division? Meiosis I is divided into metaphase I, prophase I, anaphase I and telophase I.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define about the Sucrose and Trehalose? Sucrose, also called saccharose, is ordinary table sugar refined from sugar cane or sugar beets. Trehalose has two a-D-glucose molecu
Are viruses cellular beings? Viruses are measured as living beings but they do not have cellular structure. There is some argument regarding their classification as living b
Identify the signs and symptoms associated with death from mercury. Explain Please.
Q. What are the main human diseases caused by fungi? The major human diseases caused by fungi in immunocompetent patients are , blastomycosis, histoplasmosis, paracoccidioidomy
Define method Used for Capsular Staining - Anthony Staining Method? Another method used for capsular staining is Anthony staining method, devised by E.E. Anthony in 1931. The m
Q. Which are the cell organelles that participate in cell division and in the formation of cillia and flagella of some eukaryotic cells? The organelles that participate in the
Examples of trinomial nomenclature
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd