Sarcolemma, Biology

Assignment Help:

Sarcolemma

The muscle fibre is surrounded by a cell membrane called sarcolemma. The sarcolemma connects with a complex system of transverse tubules, called T-system that runs across the muscle cells near the Z-lines. The T-tubules appear as invagination of the sarcolemma into the interior of the fibre. The muscle fibre is also surrounded by a sleeve-like structure called sarcoplasmic reticulum, which is involved in the initiation of muscle contraction.

1527_Sarcolemma.png

Figure: Sarcolemma


Related Discussions:- Sarcolemma

Apomixis, Apomixis The formation of sporophyte from the gametophyte w...

Apomixis The formation of sporophyte from the gametophyte without sexual process signifies apomixis. It relates to the replacement of alternation of a reduced gametophyte and

Explain first meiotic division, Q. What are the periods of the first meioti...

Q. What are the periods of the first meiotic division? Meiosis I is divided into metaphase I, prophase I, anaphase I and telophase I.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define about the sucrose and trehalose, Define about the Sucrose and Trehal...

Define about the Sucrose and Trehalose? Sucrose, also called saccharose, is ordinary table sugar refined from sugar cane or sugar beets. Trehalose has two a-D-glucose molecu

Are viruses cellular beings, Are viruses cellular beings? Viruses are m...

Are viruses cellular beings? Viruses are measured as living beings but they do not have cellular structure. There is some argument regarding their classification as living b

How can you identify the signs and symptoms, Identify the signs and symptom...

Identify the signs and symptoms associated with death from mercury. Explain Please.

What are the main human diseases caused by fungi, Q. What are the main huma...

Q. What are the main human diseases caused by fungi? The major human diseases caused by fungi in immunocompetent patients are , blastomycosis, histoplasmosis, paracoccidioidomy

Define method used for capsular staining - anthony staining, Define method ...

Define method Used for Capsular Staining - Anthony Staining Method? Another method used for capsular staining is Anthony staining method, devised by E.E. Anthony in 1931. The m

Which are the cell organelles that participate in cell, Q. Which are the ce...

Q. Which are the cell organelles that participate in cell division and in the formation of cillia and flagella of some eukaryotic cells? The organelles that participate in the

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd