Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
State in brief about the soil horizon A soil horizon may be defined as "a horizontal layer of regolith, approximately parallel to the soil surface, and possessing relatively
Q. What are the main interspecific ecological interactions? The major harmonious interspecific ecological interactions are: protocooperation, commensalism and mutualism. The ma
Explain the Canal Obstruction File work shorter than the normal apical and feel a great resistance to reach true length. a. A retained instrument o Canal calcification b.
What is Cerebrum Cerebrum is divided into right and left parts known as cerebral hemisphere. It is the largest part of the brain. The functions of the cerebrum: It recei
What do biomass pyramids represent? Biomass pyramids show the sum of the masses of the individuals that participate in each trophic level of a food chain.
What is the etiological agent of cutaneous leishmaniasis? How is the disease transmitted and what are its typical manifestations? The etiological agent of cutaneous leishmanias
Explain the Food Applications of guar Guar imparts smoothness to ice cream by promoting small ice crystals during the freezing process. Guar gum in the dressing of cot
Dfine Integrated Child Development Services (ICDS)? The adolescent girl scheme under ICDS intends to cover school dropout girls, 11-18 years in age with a view to meet their ne
a) A recombinant DNA is formed when sticky ends of vector DNA and foreign DNA join. b) Define how the sticky ends are formed and get joined.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd