roots, Biology

Assignment Help:
secondary growth in roots

Related Discussions:- roots

Explain bidirectional superior vena cavo, Explain Bidirectional Superior ve...

Explain Bidirectional Superior vena cavo pulmonary shunt bidirectional glenn "This is a palliative produce where blood from superior vena cava is diverted to the pulmonary arter

Define the marasmic kwashiorkor, Define the Marasmic Kwashiorkor? In co...

Define the Marasmic Kwashiorkor? In countries where the incidence of protein-calorie malnutrition (PCM) is high, a large number of cases show signs and symptoms of marasmus and

State the versions of binocular movements, State the Versions of Binocular ...

State the Versions of Binocular movements Versions are movements of both eyes in the same direction. a) Dextroversions: Movements of both eyes to'the right side. b) Levov

Digestive system - mouth, MOUT H - It is as transverse slit. It is ...

MOUT H - It is as transverse slit. It is pseudo type i.e. not open directly into alimentary canal. Mouth is covered by upper & lower movable lips. Movement is due to arb

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define important points while working with autoclave, Define Important Poin...

Define Important Points While Working With Autoclave? Note: Following points should be kept in mind while working with autoclave. 1. Autoclave should not be packed tightly o

Traumatology, Traumatology : This is the study of wounds. In other words we...

Traumatology : This is the study of wounds. In other words we can say that traumatology  is the study of wounds or injuries which can be caused by accidents or violence to a person

How are antivenoms produced, Q. How are antivenoms produced? Why are antive...

Q. How are antivenoms produced? Why are antivenoms an example of passive immunization? Antivenoms are obtained by the following process: the venom (antigen) is inoculated into

Temperate deciduous forest - ecosystem, Temperate deciduous forest - Ecosys...

Temperate deciduous forest - Ecosystem The temperate forests are characterised by a moderate climate and broad-leafed deciduous trees, which shed their leaves in fall, are bar

Explain the mechanical requirements of implant materials, Mechanical requir...

Mechanical requirements of implant materials Dental implant s must be able to sustain and transfer loads -It should have adequate mechanical strength in order to distribute th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd