Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Lyme disease It is a metazoonoses caused by a spirochaete, Borrelia burgdorferi. The disease based on the specific symptoms, is also known as erythema migrans (ECM) or lyme arthr
COMMUNITY If you look around yourself you will notice that populations of plants and animals seldom occur by themselves. The reason for this is quite obvious. In order to survive
Explain Measurement of Cell Mass - Microbial Estimation? You may recall reading earlier that filamentous bacteria and moulds cannot be counted satisfactorily by employing plate
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Gluconeogenesis Gluconeogenesis (i.e synthesis of new glucose) is the synthesis of carbohydrate from non-carbohydrate, source. The major substrates for glucone
Q. What is Galactosemia? Galactosemia is a genetic disorder caused by deficient functioning of any of these three enzymes namely galactokinase, galactose -1 - phosphate uridyl
Which type of genetic disease can be identified from the visual analysis of the number of chromosomes present in a karyotype? The counting and the identification of chromosomes
Q. What are the major divisions and representing species of the gymnosperms? This group of plants can be separated into conifers (pine, sequoia, cypress), that have flowers cal
OPIUM - Opium is milky latex obtained by incising the unripe capsule of white poppy ( Papave r somniferum family paprarecea) It has eaten or smoke. Generally it
What is the classification scheme for echinoderms?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd