Restricted lung diseases, Biology

Assignment Help:

Restricted Lung Diseases

Restricted lung disease are classified into the following:

  1. Parenchymal inflammation. This can be due to infection e.g. pneumonia acute bronchitis tuberculosis. 
  2. Space occupying leisions e.g. tumours both benign and malignant. 
  3. Occupational lung diseases e.g. Silicosis. 
  4. Pleural diseases e.g. pleural effusion. 
  5. Lung collapse e.g. Atelectasis, Pneumlothorax 
  6. Resectional surgery e.g. Pneumonectomy 
  7. Neuromuscular disorders e.g. poliomyelitis, Guillain-Barr'e syndrome, myasthenia gravis. 
  8. CNS depression. Narcotics, cerebral odema. 
  9. Limitation of thoracic mobility e.g. abdominal tumours ascites. 
  10. Change in bony thorax. Kyphoscoliosis.

Related Discussions:- Restricted lung diseases

Define major divisions & representing species of gymnosperm, What are the m...

What are the major divisions and representing species of the gymnosperms? This group of plants can be separated into conifers (pine, sequoia, cypress), that have flowers called

Osseointegration in immediate placement of implants, Q. Osseointegration In...

Q. Osseointegration In Immediate Placement Of Implants? In routine procedures, delayed placement of implants is done. However, immediate placement of implants into fresh extrac

Define the nutritional and functional role of nickel, Minerals :-Nickel  ...

Minerals :-Nickel  Food Source      Plant foods  Nutritional Functional role Essential nutrient: Deficiency in humans unknown. Catalyst: hydrogenation in

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define the ionizing radiation for sterilization, Q. Define the Ionizing rad...

Q. Define the Ionizing radiation for sterilization? Ionizing radiation are high energy electromagnetic waves including X-rays, gamma rays, particulate radiation, cosmic rays wh

What are the cytoplasmic inclusions, Q. What are the cytoplasmic inclusions...

Q. What are the cytoplasmic inclusions? Cytoplasmic inclusions are cytoplasmic molecular aggregates, such as organic polymers, pigments and crystals. They are not considered ce

Which groups does not contain a carbonyl, Which of the following functional...

Which of the following functional groups does NOT contain a carbonyl? Select one: a. Aldehyde b. Carboxyl c. Phosphate d. Amide e. Organic ester

Explain glycolysis, Explain glycolysis? Name the two monosaccharides w...

Explain glycolysis? Name the two monosaccharides which readily enter the glycolytic pathway. Illustrate a diagrammatic sketch of the microscopic view of a mammalian sperm a

Bovine viral diarrhoea, Bovine viral diarrhoea Bovine viral diarrhoea ...

Bovine viral diarrhoea Bovine viral diarrhoea (BVD) and mucosal disease (MD) are clinically dissimilar disease syndrome yet have a common viral etiology. The acute disease is

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd