Restricted lung diseases, Biology

Assignment Help:

Restricted Lung Diseases

Restricted lung disease are classified into the following:

  1. Parenchymal inflammation. This can be due to infection e.g. pneumonia acute bronchitis tuberculosis. 
  2. Space occupying leisions e.g. tumours both benign and malignant. 
  3. Occupational lung diseases e.g. Silicosis. 
  4. Pleural diseases e.g. pleural effusion. 
  5. Lung collapse e.g. Atelectasis, Pneumlothorax 
  6. Resectional surgery e.g. Pneumonectomy 
  7. Neuromuscular disorders e.g. poliomyelitis, Guillain-Barr'e syndrome, myasthenia gravis. 
  8. CNS depression. Narcotics, cerebral odema. 
  9. Limitation of thoracic mobility e.g. abdominal tumours ascites. 
  10. Change in bony thorax. Kyphoscoliosis.

Related Discussions:- Restricted lung diseases

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Class of crustacea - cirripedia, Class of Crustacea - Cirripedia These...

Class of Crustacea - Cirripedia These crustaceans are completely marine, and include the barnacles. Moa species are free living, attached to rock, and other objects. Some are

Describe the planes of muscles, Describe the Planes of Muscles The plan...

Describe the Planes of Muscles The planes of superior and inferior recti in primary position form an angle of about 23 0 with the Y-axis. Therefore, the axis of rotation of th

Name the animal who have its own dna, Which one of the following has its ow...

Which one of the following has its own DNA? 1. Mitochondria 2. Dictyosome 3. Lysosome 4. Peroxisome Mitochondria

Describe the significance of micronucleus., Describe the significance of mi...

Describe the significance of micronucleus. One of two types of dimorphic nuclei found in ciliate protozoans. The single micronucleus contains only one copy of the genome and is

Cooking of vitamin c-containing foods, Q. Why isn't the cooking of vitamin ...

Q. Why isn't the cooking of vitamin C-containing foods appropriate for vitamin C supply? To obtain vitamin C, for instance, from an orange dessert, the vitamin- containing food

Explain the food applications of hemicelluloses, Food Applications of hemic...

Food Applications of hemicelluloses The hemicelluloses find their application in  food systems as emulsifer, stabilizer and binder in flavor bases, dressings and pudding mixes.

Standard invert sugar solution, Q. Standard invert sugar solution? Rea...

Q. Standard invert sugar solution? Reagents Required 1) Standard invert sugar solution: Weigh accurately 0.985 g of sucrose and dissolve in 500 ml of water. Add 2 ml of

Fumonisins, Fumonisins The most recently characterized mycotoxins of an...

Fumonisins The most recently characterized mycotoxins of any major significance in human health are the fumonisins produced by species of Fusarium, such as F. moniliforme. Like

Define vitamin and mineral supplements for treatment for pem, Define Vitami...

Define Vitamin and mineral supplements for treatment for PEM? All cases of severe PEM require multivitamin preparation to meet the increased demands during recovery. Iron (60 m

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd