Respiratory quotient, Biology

Assignment Help:

Respiratory Quotient

Table also shows the ratio of the volume of carbon dioxide evolved to that of the amount of oxygen consumed during oxidation. This is the respiratory' quotient or RQ. It is an important concept in energy metabolism. From the table you can see that RQ is usually between 0.7 and 1.0. However, RQ near 0.7 shows that fat is being metabolised and RQ near 1.0 suggests carbohydrate metabolism. RQ in between 0.7 and 1.0 could indicate either protein or a mixed diet metabolism.

1196_Heat production and respiratory quotient for foodstuff types.png

Quite often animals cannot utilise the entire food value because not all the food they consume is fully digested. Also some portion is excreted as urea or ammonia. In general, it has been observed that animals have a higher intake of food than what is indicated by their oxygen consumption data so that their body weight is kept steady'. The oxygen consumption per unit weight/per unit time mm 3O2/g/hr tends to decrease with higher body weight of animals. In other words, small sized animals like mouse, shrew, etc., have a higher metabolic rate than a large sized animal (an elephant) as evidenced by their oxygen consumption. Accordingly smaller animals have a need to feed constantly. This would also mean that an elephant can survive without food for a much longer period of time than a mouse.


Related Discussions:- Respiratory quotient

Another type of soil for bacteria gardens, Another type of soil for bacteri...

Another type of soil for bacteria gardens Boil some rice or potatoes in a dish unless well cooked. Drain and save the water. Use the bouillon cube to the gelatin. Use th

Biotechnology, Clonig,plasmid vectors,lambda&M13based vectors

Clonig,plasmid vectors,lambda&M13based vectors

Atrial fibrillation or flutter, Q. Atrial Fibrillation or Flutter? Tran...

Q. Atrial Fibrillation or Flutter? Transient atrial fibrillation or flutter is seen frequently and can be associated with CAD, rheumatic heart disease, thyrotoxicosis, or myoc

What is retrograde peri-implantitis, Retrograde Peri-Implantitis It has...

Retrograde Peri-Implantitis It has been described by Misch as implant failure probably due to bone microfractures caused by premature implant loading or overloading, other form

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Response to wounding, Response to Wounding Wounding of tomato plants b...

Response to Wounding Wounding of tomato plants by mechanical injury or chewing by insects releases a factor that triggers accumulation of two proteinase inhibitors-throughout

Explain nsp and food hydrocolloids, NSP NSP or dietary fibre is the nam...

NSP NSP or dietary fibre is the name given to a group of materials found in the cell walls of plants which gives the plant its structure and form. Food hydrocolloids Fo

Explain the management of middle - third perforation, Explain the Managemen...

Explain the Management of Middle - Third Perforation Same to coronal one-third perforation, except defects located more deeper from the access cavity. For successfully

Determine the pre-conditions for gtt, Pre-conditions for GTT You are ad...

Pre-conditions for GTT You are advised to carry out the GTT (OGTT) test to confirm a diagnosis of diabetes mellitus for a person with: a) The history of glycosuria (glucose

Types of amoeboid movements, Types of Amoeboid Movements As the amoeba...

Types of Amoeboid Movements As the amoeba's cell body throws out one or a few pseudopodial lobes, a temporary rear end or uroid is pulled along. The central, more fluid protop

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd