Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Respiratory Quotient
Table also shows the ratio of the volume of carbon dioxide evolved to that of the amount of oxygen consumed during oxidation. This is the respiratory' quotient or RQ. It is an important concept in energy metabolism. From the table you can see that RQ is usually between 0.7 and 1.0. However, RQ near 0.7 shows that fat is being metabolised and RQ near 1.0 suggests carbohydrate metabolism. RQ in between 0.7 and 1.0 could indicate either protein or a mixed diet metabolism.
Quite often animals cannot utilise the entire food value because not all the food they consume is fully digested. Also some portion is excreted as urea or ammonia. In general, it has been observed that animals have a higher intake of food than what is indicated by their oxygen consumption data so that their body weight is kept steady'. The oxygen consumption per unit weight/per unit time mm 3O2/g/hr tends to decrease with higher body weight of animals. In other words, small sized animals like mouse, shrew, etc., have a higher metabolic rate than a large sized animal (an elephant) as evidenced by their oxygen consumption. Accordingly smaller animals have a need to feed constantly. This would also mean that an elephant can survive without food for a much longer period of time than a mouse.
Another type of soil for bacteria gardens Boil some rice or potatoes in a dish unless well cooked. Drain and save the water. Use the bouillon cube to the gelatin. Use th
Clonig,plasmid vectors,lambda&M13based vectors
Q. Atrial Fibrillation or Flutter? Transient atrial fibrillation or flutter is seen frequently and can be associated with CAD, rheumatic heart disease, thyrotoxicosis, or myoc
Retrograde Peri-Implantitis It has been described by Misch as implant failure probably due to bone microfractures caused by premature implant loading or overloading, other form
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Response to Wounding Wounding of tomato plants by mechanical injury or chewing by insects releases a factor that triggers accumulation of two proteinase inhibitors-throughout
NSP NSP or dietary fibre is the name given to a group of materials found in the cell walls of plants which gives the plant its structure and form. Food hydrocolloids Fo
Explain the Management of Middle - Third Perforation Same to coronal one-third perforation, except defects located more deeper from the access cavity. For successfully
Pre-conditions for GTT You are advised to carry out the GTT (OGTT) test to confirm a diagnosis of diabetes mellitus for a person with: a) The history of glycosuria (glucose
Types of Amoeboid Movements As the amoeba's cell body throws out one or a few pseudopodial lobes, a temporary rear end or uroid is pulled along. The central, more fluid protop
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd