Respiratory chain to produce atp, Biology

Assignment Help:

Decreasing power is available in a cell both as NADPH and NADH but these have quite distinct roles. NADH is oxidized by the respiratory chain to produce ATP by oxidative phosphorylation. For biosynthetic reactions NADPH is used which decreasing needs power. Despite their similar structures, NADPH and NADH are not metabolically interchangeable and so the cell must carry out a group of reactions which specially establish NADPH. This set of reactions is the pentose phosphate pathway also called as the hexose monophosphate shunt or the phosphogluconate pathway. It took place in the cytosol and is particularly significant in tissues like as mammary gland, adipose tissue and  the  adrenal  cortex  which  synthesizes  fatty  acids  and  steroids  from acetyl CoA. The activity of the pathway is very low in skeletal muscle, for instance, that does not synthesize fatty acids or steroids.

 


Related Discussions:- Respiratory chain to produce atp

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How could an adult lose billions of cells, How can an adult lose billions o...

How can an adult lose billions of cells from all parts of the body each day and still survive?

Define requirements of chromium, Define Requirements of Chromium? There...

Define Requirements of Chromium? There is no Recommended Dietary Allowance (RDA) for chromium but adequate intakes that can be used as a goal for individual intakes has been pr

Describe the two kind of fermentation, Q. What are the two kind of fermenta...

Q. What are the two kind of fermentation? What are their complete chemical equations? The two major types of fermentation are alcoholic fermentation and lactic fermentation.

Biochemical production, Plants are the source of a large variety of bioche...

Plants are the source of a large variety of biochemicals which are metabolites of both primary and secondary metabolism. But secondary metabolites are of much greater interest s

Pylum mollusca, Economic importance of phylum mollusca

Economic importance of phylum mollusca

Instance of negative feedback of the homeostatic regulation, Q. What is an ...

Q. What is an instance of negative feedback of the homeostatic regulation? Negative feedback happens when the response to a given action generates an effect that inhibits that

Explain third mitotic period, Q. What are the major events of the third mit...

Q. What are the major events of the third mitotic period? The third mitotic period is anaphase. In anaphase the following events occur breaking and duplication of centromeres w

Soil ph and nutrient availability, Soil pH and Nutrient Availability So...

Soil pH and Nutrient Availability Soil pH is the most important factor which governs the availability of nutrients in soil. All the nutrients are absorbed by plants in their io

Define vitamins requirement to avoid underweight problem, Define Vitamins r...

Define Vitamins requirement to avoid underweight problem? Vitamins and Minerals: If the diet provides good amounts of fresh fruits and vegetables, vitamin or mineral supplement

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd