Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
structural adaptation of mammalian alimentary canal
E. coli strains containing the plasmid pAMP are resistant to ampicillin. Describe how this plasmid functions to bring about resistance.
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
What is recombination frequency? The Recombination frequency, or crossing over rate, is the percentage of recombinant gametes made by crossing over (in relation to the number o
Q. How Linnaeus classify the plant kingdom? Linnaeus classified the plant kingdom into 24 classes in his famous work 'Genera Plantarum' (1737) and 'Species Plantarum' (1753). I
Explain the DNA structure in details? Structure : Each DNA molecule is a double stranded polymer, consisting of perhaps thousands or millions of linked nucleotides. The two
Explain the Flow Phase of Stress Response? This is a neuro-endocrine response to physiological stress following the ebb phase. This phase is characterized by: Normal or
How can we calculate the IVI from a total number of (30) quadrats (each 30 x 30 m quadrats)
Biology once said why this statement is logical in terms of kin selection and use the coefficient of relatedness he'd be willing to lay down his life to save two brothers or eight
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd