respiration, Biology

Assignment Help:
what is the organ of respiration in snaks

Related Discussions:- respiration

Lamellar models, LAMELLA R MODELS According to James Danielly & Hu...

LAMELLA R MODELS According to James Danielly & Hugh Davson (1935) cell membrane consists of 4 layers P-L-L-P. Molecules of phospholipid has amphipathic nature, i.e. it

Nitrogen fixation, Nitrogen Fixation As we have said before, atmospher...

Nitrogen Fixation As we have said before, atmospheric nitrogen cannot be used by plants or animals. It has to be first fixed. The term nitrogen fixation refers to the oxidatio

Which animals maintain constant body temperature?, Which of the below terms...

Which of the below terms is used to describe animals which maintain a constant body temperature by producing heat by metabolic oxidations (muscle contractions) and losing excess he

Explain about the classification of fungi, Explain about the Classification...

Explain about the Classification of Fungi? The fungi, as you may recall reading above, is now placed in a separate kingdom called Myceteae. Traditionally, fungi were divided in

What is the form that produces gametes, In the metagenesis of Aurelia and O...

In the metagenesis of Aurelia and Obelia what is the form that produces gametes? What is the form that reproduces asexually? In the metagenesis of some coelenterates, like Obel

Gregor mendel''s law of independent segregation, Gregor Mendel's Law of Ind...

Gregor Mendel's Law of Independent Segregation referred to which of the following genetic elements? A. Alleles of two genes that reside on the similar chromosome B. Alleles

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Monocotyledonous embryo, Monocotyledonous Embryo The early developmen...

Monocotyledonous Embryo The early development of the proembryo in monocots follows the same pattern as in the dicots. However, at the time of differentiation in the globular

Excretion, what is the excretory organ of lizard

what is the excretory organ of lizard

Explain implant integrity, Explain Implant Integrity Implant Integrity...

Explain Implant Integrity Implant Integrity: A horizontal dark line at the abutment level is most probably due to screw-loosening and separation of elements.  This may happen

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd