Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
LAMELLA R MODELS According to James Danielly & Hugh Davson (1935) cell membrane consists of 4 layers P-L-L-P. Molecules of phospholipid has amphipathic nature, i.e. it
Nitrogen Fixation As we have said before, atmospheric nitrogen cannot be used by plants or animals. It has to be first fixed. The term nitrogen fixation refers to the oxidatio
Which of the below terms is used to describe animals which maintain a constant body temperature by producing heat by metabolic oxidations (muscle contractions) and losing excess he
Explain about the Classification of Fungi? The fungi, as you may recall reading above, is now placed in a separate kingdom called Myceteae. Traditionally, fungi were divided in
In the metagenesis of Aurelia and Obelia what is the form that produces gametes? What is the form that reproduces asexually? In the metagenesis of some coelenterates, like Obel
Gregor Mendel's Law of Independent Segregation referred to which of the following genetic elements? A. Alleles of two genes that reside on the similar chromosome B. Alleles
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Monocotyledonous Embryo The early development of the proembryo in monocots follows the same pattern as in the dicots. However, at the time of differentiation in the globular
what is the excretory organ of lizard
Explain Implant Integrity Implant Integrity: A horizontal dark line at the abutment level is most probably due to screw-loosening and separation of elements. This may happen
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd