Reproductive mechanisms, Biology

Assignment Help:

Reproductive Mechanisms

Organisms reproduce in two different ways,

  1. Asexually and
  2. Sexually

In asexual reproduction there is only one parent and there are no special reproductive organs or cells. Each organism is capable of producing genetically identical copies of itself as soon as it becomes an adult. Sexual reproduction involves two parents, each of which contributes special sex cells, or gametes. These gametes fuse to form a zygote. Since the zygote receives genetic material, the offspring bear the characteristics of the species, but also bear traits that make them different from their parents. In the following sections you shall study about these reproductive mechanisms.


Related Discussions:- Reproductive mechanisms

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Treatment and disposal technologies for health-care waste, Q. Treatment and...

Q. Treatment and disposal technologies for health-care waste 1. Incineration 2. Chemical disinfection 3. Wet and dry thermal treatment 4. Microwave irradiation 5. L

Diagnosis of acute myelogenous leukemia, The most recent blood work of a pa...

The most recent blood work of a patient with a diagnosis of acute myelogenous leukemia (AML) reveals thrombocytopenia. Where is the patient most likely to experience abnormal bleed

What is the echocardiogram, What is the Echocardiogram ? When doubts pe...

What is the Echocardiogram ? When doubts persist whether a patient has CHD or not despite a thorough clinical exam and chest X-ray, ECG, and hyperoxia test, an echocardiogram s

What are instances of a carnivorous, Q What are instances of a carnivorous ...

Q What are instances of a carnivorous and an herbivorous reptile? Iguanas are herbivorous, Snakes are carnivorous. Q. Do beings of the class Reptilia perform gas exchange i

Photoreceptors, Photoreceptors Photoreceptors are concerned in absorpt...

Photoreceptors Photoreceptors are concerned in absorption of light by photosensitive pigments. The chemical change involved produces the impulse concerned in the nerve cells.

Explain what position of patient will during jvp examination, Explain what ...

Explain what Position of Patient will be During JVP Examination ? Position of Patient During JVP Examination: The patient is propped up to 45"on a back rest or pillow as in thi

Explain terms retrogradation and gelatinization, What do you understand by ...

What do you understand by the terms retrogradation and gelatinization? The realignment of the amylose and amylopectin and swollen starch granules to form a pocket is termed

List the steps of mitosis, Q. List the steps of mitosis and briefly describ...

Q. List the steps of mitosis and briefly describe what happens in each.

Which animals make tracheal respiration, Q. Which animals make tracheal res...

Q. Which animals make tracheal respiration? Is there a blood-like fluid that participates in this process? Arachnids and Insects are the arthropod animals that make tracheal re

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd