Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
In order to define growth limit logistic equation was given by Verhulst. In a given ecosystem, the maximum population that can exit is called carrying capacity (k). The factors wh
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are the types of cell respiration? There are two types of cell respiration: aerobic cell respiration, a reaction with participation of molecular oxygen (O2), and anaerobic
What is Fluorescent Microscope? In above said microscopes, image is produced from light that passes through a specimen. In fluorescent microscope, however, specimen image is f
In-vitro studies Mechanistic data might be supplemented by data from in-vitro studies, like as information on genotoxicity derived from reversion assays or other same ass
According to the Nernst equation, the equilibrium potential for any ion (Eion) distributed across a membrane is dependent on the internal (Ionin) and external (Ionout) concentratio
What is Bilateral Symmetry system? To review: all animals besides the sponges (Phylum Porifera) belong to the Eumetazoa. There are two groups within the Eumetazoa that possess
What is deplasmolysis of plant cells? The plant cell when placed under hypertonic medium loses a huge amount of water and its cell membrane detaches from the cell wall. In that
characteristic of spider that makes it the phylum arthropoda?
why sporophyte of psilopsida is rootless
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd