Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Body Fluids of Marine Teleost The body fluids of marine teleost are hypotonic to seawater, so these fishes lose water to the environment especially across the gill epithelium.
Define the Agar Shake Tube Method The agar shake tube method is useful for isolation of anaerobic microorganisms. What are anaerobic microorganisms? You may recall the theory c
What are biogeochemical cycles? Biogeochemical cycles are representations of the circulation and recycling of matter in nature. The major biogeochemical cycles studied in Ec
Predisposing Factors The patients with diabets mellitus, malignancies and those on immunosuppressive drugs have reduced resistance and are more susceptible to develop meningi
Explain of Functional property Browning/Flavour/ Aroma Mode of action Proteins contribute to browning by reacting with lactose and other reducing sugars present in a form
What is the association between inflammation and fever? In the tissue region where inflammation happens bacterial toxins, cytokines, prostaglandins, interleukins and endothelin
Q. How many chambers does the fish heart have? The fish heart is a tube made of two consecutive chambers such as one ventricle and one atrium.
Determine the term - Test-retest reliabilities The test manual reports reliability data. Test-retest reliabilities for the 13 main scales range from .78 to .96. The problem of
D- and L- glucose are Select one: a. stereoisomers b. configurational isomers c. optical isomers d. enantiomers e. all of the above
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd