Receptors - ear, Biology

Assignment Help:

EAR

  1. It is phono receptor as respond to sound waves.
  2. It is teloreceptor as receive stimuli from far distance.
  3. It is stato-acousting organ as concerned with balancing and hearing.
  4. Study of hearing is audiology. Study of structure and function of ear is otology.
  5. Instrument used to examine ear is auriscope.
  6. Ear ache is otalgia. Inflamation of ear is otitis.
  7. In ear three parts are clear -

                       1. External ear or pinnae          

                       2. Middle ear         

                       3. Internal ear


Related Discussions:- Receptors - ear

Geology LAB, Can you guys help with my homework assignment for Geology?

Can you guys help with my homework assignment for Geology?

What are some industrial processes that use bacteria, What are some industr...

What are some industrial processes that use bacteria? Bacteria are used by industry in many ways. There are vaccines made of attenuated pathogenic bacteria or of antigens prese

Explain acute mr murmur in heart dieases, Explain Acute MR Murmur in heart ...

Explain Acute MR Murmur in heart dieases? MR due to ruptured papillary muscle, ruptured chordae tendinae, or due to Infective Endocarditis/Myocardial infarction. Characteri

Use of chemicals to control and destruct microorganisms, Q. Use of Chemical...

Q. Use of Chemicals to Control and Destruct Microorganisms? Ans. The use of chemicals, as a process of food preservation, has been used since long, ever since man found

Explain cytological evidence, Q. Explain Cytological Evidence? Cytology...

Q. Explain Cytological Evidence? Cytology is the study of the morphology and physiology of cells. The information about the chromosome number, shape and pairing at meiosis is u

Deficiency diseases-ketosis, Ketosis Ketosis, also known as acetonaemia...

Ketosis Ketosis, also known as acetonaemia or ketonaemia is a multifactorial disorder that commonly occurs in dairy cows and buffaloes immediately after calving or in early lac

Zoonoses disease-brucellosis, Brucellosis Brucellosis is a global probl...

Brucellosis Brucellosis is a global problem because of its public health and economic implications. It is one of the serious diseases affecting livestock all over the worlds th

Define the nutritional assessment tools, Define the Nutritional Assessment ...

Define the Nutritional Assessment Tools? Malnutrition/protein energy malnutrition amongst elderly persons has been observed in various studies -be it hospitalized patients, nur

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the function of the citric acid cycle, What is the function of the ...

What is the function of the citric acid cycle? The hnction ofthe  citric acid cycle can be discussed as  follows. The  intermediates of citric acid cycle are used as  precursor

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd