Receptors - ear, Biology

Assignment Help:

EAR

  1. It is phono receptor as respond to sound waves.
  2. It is teloreceptor as receive stimuli from far distance.
  3. It is stato-acousting organ as concerned with balancing and hearing.
  4. Study of hearing is audiology. Study of structure and function of ear is otology.
  5. Instrument used to examine ear is auriscope.
  6. Ear ache is otalgia. Inflamation of ear is otitis.
  7. In ear three parts are clear -

                       1. External ear or pinnae          

                       2. Middle ear         

                       3. Internal ear


Related Discussions:- Receptors - ear

Typical vegetation and the typical fauna of the deserts, What are the typic...

What are the typical vegetation and the typical fauna of the deserts? The predominant fauna of the desert ecosystems is formed by reptiles, like snakes and lizards, terrestrial

Phosphorus cycle - nutrient cycles, Phosphorus Cycle - Nutrient Cycles ...

Phosphorus Cycle - Nutrient Cycles Phosphorus is a very important nutrient because of its role in the form of phosphate, in reactions that store and release energy. The availa

What gases was the earths primitive atmosphere, Before the emergence of lif...

Before the emergence of life of what gases was the earth's primitive atmosphere constituted? The earth's primitive atmosphere was basically produced of methane, hydrogen, ammon

The oxidative phase generates nadph, 1)  The oxidative phase  generates N...

1)  The oxidative phase  generates NADPH The oxidative branch of  the pathway  generates NADPH  and pentose-5-phosphate, through the following  reactions: a)  Glucose-6-pho

Agro industrial-post-partum anoestrus, Post-partum anoestrus Reproduct...

Post-partum anoestrus Reproductive efficiency among animals greatly depends upon detection of estrus. This is even more important in reference to small herds managed under tro

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the term ageing, Explain the term Ageing? Ageing in human being...

Explain the term Ageing? Ageing in human being is of a multifunctional origin and there is a programmed senescence (ageing) of the cells in the body. The genetic make-up of an

What is the meaning of body composition, What is the meaning of Body compos...

What is the meaning of Body composition? It refers primarily to the distribution of muscle, fat, bone and other tissues in the body, and its measurement is often considered as

Conclusions from the monohybrid crosses, Conclusions drawn from the Monohyb...

Conclusions drawn from the Monohybrid Crosses From the results of his monohybrid crosses, following conclusions were obtained :- 1 .       Law of Unit or Paired Factors (Po

Describe the importance of neuropsychological tests, Describe the importanc...

Describe the importance of Neuropsychological tests Neuropsychological tests are generally thought of as assessment instrument for a variety of cognitive, perceptual, and motor

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd