Radiography, Biology

Assignment Help:

Radiography:

Radiograph or X-ray remains the most well-known and primary diagnostic tool of all the imaging modalities. It works based on the difference in tissue density within the animal and provides 2 dimensional black and white image of variable intensity depending on radio-density of the examined structure or body part. The common pathological conditions which are diagnosed through radiograph are fractures, dislocation, arthritis, tumor, pregnancy, obstruction, osteoarthritis, osteo-chondrosis (OCD), bone tumors, hip dysphasia and a host of the other skeletal diseases. Radiographs can also be used to look at the soft tissue in the body, such as the heart, lungs and abdominal organs. In addition to the routine radiograph studies, contrast procedures are performed starting from upper gastrointestinal tract, arthrogram to myelogram, etc.


Related Discussions:- Radiography

Define the cooper''s run (12 minute run) method, Define the Cooper's Run (1...

Define the Cooper's Run (12 minute run) Method? To undertake this test, a 400 metre running track is required-marked every 100 m and a stop watch. The test comprises of noticin

What are nymph and imago, What are nymph and imago? Nymphs are larvae o...

What are nymph and imago? Nymphs are larvae of hemimetabolic insects (like grasshoppers). They are very same to the adult insect although smaller. In holometabolic insects (lik

The cell membrane or plasma membrane ruptures, What happens when the cell m...

What happens when the cell membrane or plasma membrane ruptures or breaks down? When cell membrane ruptures Ions leek out and if not repaired in time the cell will die. As we k

Why did scientists want to map the human genome, Why did scientists want to...

Why did scientists want to map the human genome? They wanted to learn the location of all the significant genes in the genome in order to learn how the genome is organized, ho

Gorgonids, Gorgonids yield chemicals like prostaglandins, medically useful ...

Gorgonids yield chemicals like prostaglandins, medically useful for birth control, prevention of peptic ulcers, treatment of asthma, regulation of blood pressure, etc. Sponges are

Of what importance are lactic acid fermentation to the cell, Of what import...

Of what importance are lactic acid fermentation and alcoholic fermentation to the cells that use these pathways? These pathways regenerate NAD, which the cells can use to keep

Write short notes on urine, Write short notes on Urine? The concentrate...

Write short notes on Urine? The concentrated filtrate produced by the kidney is called urine, and is composed mainly of water, urea, toxins, and mineral salts. Urine from the c

Explain android obesity, Normal 0 false false false EN-...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the absorption, Explain the Absorption, Storage and Elimination of ...

Explain the Absorption, Storage and Elimination of Folate? Folic acid is readily absorbed from the small intestines through the portal vein and  passed onto the tissues throug

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd