Radioactive labelling, Biology

Assignment Help:

Radioactive Labelling

Radioactive labelling method has been effectively applied on the chick blastoderm. The method includes labelling one embryo (donor) and grafting a part of it in similar position on another unlabelled embryo of similar stage (Host). An explanted blastodermis immersed in a medium consisting of the radioactive mtiated (H3) thymidine. In 3 to eight hours the tritiated thymidine is incorporated into the chromosomal DNA of dividing blastodermal cells. The embryo labelled in such type of a way by tritiated thymidine serves as a donor. Another embryo at similar stage of development as attained through the labelled donor in the meantime is then chosen to serve as the host. A small area of the host embryo is excised and replaced by a corresponding piece from the donor of which the fate is to be determined. Healing generally takes place quickly and the development is not impaired if the operation has been done carefully.

The thymidine does not pass out of the nuclei of the labelled cells but stays in the chromosomes of their descendents. Even though the radioactive thymidine present in the DNA is gradually diluted with each subsequent chromosomal replication radioactivity remains for a considerable time. Such type of composite embryo (partly from donor and partly from the host) is tested at a later stage of development for radioactivity through special techniques like autoradiography etc. Only the part(s) or structure(s) developed from the grafted piece display the presence of radioactivity thus establishing the fate of specific area taken from the donor.


Related Discussions:- Radioactive labelling

Explain the alterations occurring in egg, Alterations occurring in egg ...

Alterations occurring in egg The quality, flavour, composition and functional properties of eggs are adversely affected more rapidly and to a greater extent by the speed and co

Others factors affecting occupational health, Others Factors Affecting Occu...

Others Factors Affecting Occupational Health The list of factors which affect the occupational health and that need standard organising, scrutiny, inspection, surveillance and

Explain in detail about working of heart, Explain in detail about working o...

Explain in detail about working of heart Heart has four chambers. Two upper chambers are called atria. Two muscular lower chambers are called ventricles. The right and left

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe the term humidification, Describe the term Humidification Dry...

Describe the term Humidification Dry gases result in the loss of ciliary activity of the mucosa of the airway and can lead to mucosal damage as well as causing the secretions

Explain the digestive system, Explain the Digestive System ? The diges...

Explain the Digestive System ? The digestive system takes in food and processes it. Digestion is the mechanical and chemical breaking down of food into a form that can be used

Identical chromatids or separation of homologous chromosomes, Q. During mit...

Q. During mitotic anaphase is there separation of identical chromatids or separation of homologous chromosomes? In the anaphase of mitosis the identical chromatids complete and

Closed style - style of stigma interaction, Closed Style - Style of Stigma ...

Closed Style - Style of Stigma Interaction Cotton shows an epidermis with stomata, a cortex of thin-walled parenchyma with several vascular bundles and strands of transmitting

Is the epithelium vascularized, Is the epithelium vascularized? How do nutr...

Is the epithelium vascularized? How do nutrients and oxygen reach the epithelium? Why is this feature a significant evolutionary acquisition? Epithelia are not vascularized (ca

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd