Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Pulses
Careful examination of both upper and lower limb pulses is useful in detecting coarctation, and other arterial stenosis. The carotid arteries should be checked for stenosis and bruit.
Fundus
A detailed fundus examination would show the changes upon which grading of the intensity of hypertension can be made.
General
In general examination, one should look for:
• Oedema: suggestive of heart failure and renal failure.
• Round face, truncal obesity, bufallo hump: in Cushing's syndrome.
• Obesity, rough skin, bradycardia, puffy face: in myxoedema.
• Tremors, exophthalmos: in thyrotoxicosis.
Testing for urine sugars is not recommended for either diagnosis or monitoring of patients with diabetes. This is because a urine sugar is not a reliable test. When no facilities a
on line mitochondria lab
Define Shell Fish as a rich source of protein? Information on shellfish is fragmentary and incomplete. In shell fish, the shell comprises of a large portion of live weight of t
Define Importance of Family and Patient Education - Food Allergy? Remember, involvement of the family and all other relevant caretakers along with the patient is crucial for pr
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
TESTE S (TESTICLES) - 2 in number (Diarchic). Pinkish in colour. Oval shaped. 4-5 cms long, 2.5 cm wide and 3 cm thick. Mesodermal. In embryonic stage attached to kid
Illustrate about the term- Hypnagogic hallucinations Hypnagogic hallucinations (Greek, 'hypnos' meaning "sleep," and 'gogic' meaning "enter into") are episodes of auditory, vi
Ranikhet disease Ranikhet disease, also known in the west as Newcastle disease, is a contagious and highly fatal disease of fowls caused by a virus of the genus Rubulavirus in
Explain Viscosity of proteins Viscosity reflects resistance to flow. The main single factor influencing the viscosity behavior of protein fluids is the apparent diame
Polychaetes - Feeding and Digestion in Annelids Polychaetes involve both free moving (errant) and sedentary species. The free moving species are usually macrophagous and the s
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd