Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Pulses
Careful examination of both upper and lower limb pulses is useful in detecting coarctation, and other arterial stenosis. The carotid arteries should be checked for stenosis and bruit.
Fundus
A detailed fundus examination would show the changes upon which grading of the intensity of hypertension can be made.
General
In general examination, one should look for:
• Oedema: suggestive of heart failure and renal failure.
• Round face, truncal obesity, bufallo hump: in Cushing's syndrome.
• Obesity, rough skin, bradycardia, puffy face: in myxoedema.
• Tremors, exophthalmos: in thyrotoxicosis.
Explain about the Observation and Classification of Arthropoda? Introduction In the previous unit you have examined the representatives of artliropoda. In this unit, you wi
Sympatric speciation can be regarded as speciation where parent species gives rise to a daughter species without the individuals of a species being separated by space or territory.
Rumen protection of nutrient (bypass nutrients) technology The amino acid and energy requirements of medium and high yielding cows and buffaloes are not fully met from the micr
Origin and Evolution of Metazoa Most of the early metazoans were soft bodied and so their fossils are rare. The extremely fragmented fossil record does not shed any specific l
Checkpoints and Cell Cycle Control Cell cycle checkpoints are control mechanisms which ensure the fidelity of cell division within eukaryotic cells. These checkpoints confirm w
Summary of the Phylum and protozoa and the important
Hello, I did a experiment: I used 5 salt solutions (0 g/L; 5 g/L; 10 g/L; 15 g/L; 20 g/L), and in each one I cooked beans (25 g) for 5 minutes. At the end, I measured the absorpti
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Tests to Measure Muscular Strength and Endurance? It is important to first understand the difference between muscular strength and endurance. To know the muscular streng
Dormancy - Plant Growth Substances Dormancy can be defined as a state of suspended growth and metabolism. When most plants are exposed to seasonal periods of very inclement we
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd