Pulses - hypertension, Biology

Assignment Help:

Pulses

Careful examination of both upper and lower limb pulses is useful in detecting coarctation, and other arterial stenosis. The carotid arteries should be checked for stenosis and bruit.

Fundus

A detailed fundus examination would show the changes upon which grading of the intensity of hypertension can be made.

General

In general examination, one should look for:

• Oedema: suggestive of heart failure and renal failure.

• Round face, truncal obesity, bufallo hump: in Cushing's syndrome.

• Obesity, rough skin, bradycardia, puffy face: in myxoedema.

• Tremors, exophthalmos: in thyrotoxicosis.


Related Discussions:- Pulses - hypertension

Urine sugar testing, Testing for urine sugars is not recommended for either...

Testing for urine sugars is not recommended for either diagnosis or monitoring of patients with diabetes. This is because a urine sugar is not a reliable test. When no facilities a

Define shell fish as a rich source of protein, Define Shell Fish as a rich ...

Define Shell Fish as a rich source of protein? Information on shellfish is fragmentary and incomplete. In shell fish, the shell comprises of a large portion of live weight of t

Importance of family and patient education - food allergy, Define Importanc...

Define Importance of Family and Patient Education - Food Allergy? Remember, involvement of the family and all other relevant caretakers along with the patient is crucial for pr

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Testes (testicles), TESTE S (TESTICLES) - 2 in number (Diarchic). P...

TESTE S (TESTICLES) - 2 in number (Diarchic). Pinkish in colour. Oval shaped. 4-5 cms long, 2.5 cm wide and 3 cm thick. Mesodermal. In embryonic stage attached to kid

Illustrate about the term- hypnagogic hallucinations, Illustrate about the ...

Illustrate about the term- Hypnagogic hallucinations  Hypnagogic hallucinations (Greek, 'hypnos' meaning "sleep," and 'gogic' meaning "enter into") are episodes of auditory, vi

Poultry and duck diseases-ranikhet disease, Ranikhet disease Ranikhet ...

Ranikhet disease Ranikhet disease, also known in the west as Newcastle disease, is a contagious and highly fatal disease of fowls caused by a virus of the genus Rubulavirus in

Define viscosity - function of proteins, Explain Viscosity of proteins ...

Explain Viscosity of proteins Viscosity reflects resistance to flow. The  main  single factor influencing the viscosity  behavior  of protein  fluids  is   the  apparent  diame

Polychaetes - feeding and digestion in annelids, Polychaetes - Feeding and ...

Polychaetes - Feeding and Digestion in Annelids Polychaetes involve both free moving (errant) and sedentary species. The free moving species are usually macrophagous and the s

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd