Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is diarrhoea? Diarrhoea is characterized by the frequent evacuation of liquid stools, usually exceeding 300 ml, accompanied by an excessive loss of fluids and electrolyte
In Drosophila, the anterior determinant Bicoid is known to activate expression of the gene hunchback in the anterior half of the embryo. (Bicoid is a transcription factor, which b
two larva forms of sponge
Q. Describe the use of Sorbates acid in Microorganisms? Sorbic acid is an unsaturated carboxylic acid whose salts as sodium, calcium or potassium are used in foods upto
Which of the following groups is NOT ionizable? Select one: a. Guanidinium b. Imidazole c. Phosphoryl d. Amine e. Aldehyde
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Mouth Inspect and palpate the lips, gums, tongue, palate and oropharynx. Rule out cleft lip and palate, size of chin if small and receding it shows micrognathia ind
How are bacteria classified according to their need for oxygen? According to their necessity of oxygen bacteria are classified into:- a) Anaerobic (those that survive withou
Moss Stage - Xerarch The accumulation of soil, particularly in the crevices and depressions of rock favours the growth of certain xerophytic mosses, e.g., species of Polytrich
habitat, habit, cell wall chemistry, reason why cell wall like this of Archaebacteria , eubacteria,fungi,algae,bryophytes ,pteridophyes, gymnosperms , angiosperms..
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd