Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Turnover number Turnover number:- The number of molecules of substrate transformed per catalytic site of the enzyme per minute,
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
How are the excretory systems of the three main arthropod classes constituted? In crustaceans a pair of excretory organs known as green glands exists. The green glands collect
Describe the process of excitation-contraction coupling (ECC) in the heart. How do adrenaline, noradrenaline and acetylcholine alter heart rate and or force?
What is Cuticle? The nonliving, and noncellular outer layer of an organism secreted by underlying epidermis. Cuticles are common in a range of animals including nematodes, anne
Q. How many cells are made after meiosis II and meiosis I? After meiosis II four cells are created, After Meiosis I two cells with already separated homologous are created
I have a test online it is timed 30 minutes on Anatomy and Physiology I need an expert who is an expert in this subject to take it for me
Chromatin is made of DNA molecules associated to proteins known as histones.
Explain the process of diagnosis of cholera Diagnosis: Cholera can be confirmed only by the isolation of the causative organism from the diarrheic stools of infected individual
Q. Classification of plant on the basis of their resemblances? Pliny seemed to have little interest in the classification of plant on the basis of their resemblances. He classi
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd