Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What are the hyphae and the mycelium of pluricellular fungi? The major structures of pluricellular fungi are the hyphae (threadlike filaments made of contiguous uni or multinuc
Explain the Difficulty of establishing and sustaining collaborations? Working with another is both rewarding and challenging. Working across disciplines is even more so. Though
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What are the main phases and clinical manifestations of schistosomiasis? The Schistosomiasis has acute and chronic phases and Days after the infection the cercarial dermatit
Q. Do protozoans have a cellular nucleus? All protozoans, as eukaryotes have nucleus, some species like the paramecium have two nuclei the micronucleus and the macronucleus.
What are the similarities between chlorplasts and prokaryotic cells?
Explain about the Conjugated proteins? The phospho proteins and the metallo proteins are loose (as with phosphate carrying protein) or tight (as with the phosphate in casein or
A lipoprotein is a biochemical assembly which haves both lipids and proteins, bound to the proteins that allow fats to move by the water outside and inside cells. The proteins serv
Define Food Sources of Calcium? Dairy products are of course the primary source of calcium followed by grains and pulses. Among the millets, ragi contains substantial amount of
The biomass available for consumption by the herbivores and the decomposers is called : 1. Net primary productivity 2. Secondary productivity 3. Standing crop 4. Gross
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd