protozoa, Biology

Assignment Help:
what is phylum protozoa

Related Discussions:- protozoa

What are the hyphae and the mycelium of pluricellular fungi, What are the h...

What are the hyphae and the mycelium of pluricellular fungi? The major structures of pluricellular fungi are the hyphae (threadlike filaments made of contiguous uni or multinuc

Difficulty of establishing collaborations - infuse biology, Explain the Dif...

Explain the Difficulty of establishing and sustaining collaborations? Working with another is both rewarding and challenging. Working across disciplines is even more so. Though

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Main phases and clinical manifestations of schistosomiasis, Q. What are the...

Q. What are the main phases and clinical manifestations of schistosomiasis? The Schistosomiasis has acute and chronic phases and Days after the infection the cercarial dermatit

Do protozoans have a cellular nucleus, Q. Do protozoans have a cellular nuc...

Q. Do protozoans have a cellular nucleus? All protozoans, as eukaryotes have nucleus, some species like the paramecium have two nuclei the micronucleus and the macronucleus.

Similarities between chlorplasts and prokaryotic cells, What are the simila...

What are the similarities between chlorplasts and prokaryotic cells?

Explain about the conjugated proteins, Explain about the Conjugated protein...

Explain about the Conjugated proteins? The phospho proteins and the metallo proteins are loose (as with phosphate carrying protein) or tight (as with the phosphate in casein or

What is lipoproteins, A lipoprotein is a biochemical assembly which haves b...

A lipoprotein is a biochemical assembly which haves both lipids and proteins, bound to the proteins that allow fats to move by the water outside and inside cells. The proteins serv

Define food sources of calcium, Define Food Sources of Calcium? Dairy p...

Define Food Sources of Calcium? Dairy products are of course the primary source of calcium followed by grains and pulses. Among the millets, ragi contains substantial amount of

The biomass available for consumption by the herbivores, The biomass availa...

The biomass available for consumption by the herbivores and the decomposers is called : 1. Net primary productivity 2. Secondary productivity 3. Standing crop 4. Gross

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd