protozoa, Biology

Assignment Help:
disadvanatge of protozoa

Related Discussions:- protozoa

Define half saturation test and full saturation test, Define Half Saturatio...

Define Half Saturation Test and Full Saturation Test? This test is specific to polysaccharides. The test is used to detect dextrin from starch. The details related to the test

Infectious diseases, In f e c tiou s Diseases Infectious diseases ...

In f e c tiou s Diseases Infectious diseases inflicts major economic losses as the disease spreads from one animal to other and large number of animals are affected with t

#title.examples of classes of vertebrates, how to explain an example from e...

how to explain an example from each class of vertebrate

Explain why this essential that muscle cells, Explain why it is essential t...

Explain why it is essential that muscle cells, during anaerobic respiration, convert pyruvic acid (pyruvate) into lactic acid, even though the conversion results in an accumulation

What is the functional unity of the kidneys, Q. What is the functional unit...

Q. What is the functional unity of the kidneys? The functional (filtering) unity of the kidneys is the nephron a nephron is made of efferent arteriole, afferent arteriole, glom

Morula in humans, Which one of the following statements about morula in hum...

Which one of the following statements about morula in humans is correct? 1. It has almost equal quantity of cytoplasm as an uncleaved zygote but much more DNA 2. It has far l

Prawn.., Ask question #Minimum 2o pages accepted#

Ask question #Minimum 2o pages accepted#

How is gas exchange done in flatworms, Q. How is gas exchange done in flatw...

Q. How is gas exchange done in flatworms? Platyhelminthes exchange gases exclusively by diffusion through their body surface. This is only possible because all cells are locali

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd