protozoa., Biology

Assignment Help:
brief account on classification and general characters of protozoa

Related Discussions:- protozoa.

Explain the nutrient composition of different milk, Explain the Nutrient co...

Explain the Nutrient composition of different milk? Sometimes exclusive breast-feeding cannot be sustained. Working mothers join their duty in the fourth month and exclusively

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Carbohydrate case study, CT is a 3 year old female who develops signs of hy...

CT is a 3 year old female who develops signs of hypoglycemia in the early morning unless she is fed during the night.  CT eats balanced meals for her age group during the day, with

Explain zanamivir, Zanamivir  (Relenza) Started within 2 days after on...

Zanamivir  (Relenza) Started within 2 days after onset of symptoms, this orally inhaled neuraminidase inhibitor can shorten the duration of illness and may decrease the incide

Bone formation, 3 main stages of bone formation, and explain the process of...

3 main stages of bone formation, and explain the process of these 3 stages.

How sequences of events occur to activate protein kinase a, When glucagon b...

When glucagon binds to it's receptor on a liver cell, which one of the following sequences of events occurs to activate protein kinase A? -activation of G protein, activation of

What are synthetic auxins, What are synthetic auxins and what are their use...

What are synthetic auxins and what are their uses? Synthetic auxins, like indolebutyric acid (IBA) and naphthalenic acid (NAA) are substances same to IAA (a natural auxin) but

Roles of abscisic acid, Roles of Abscisic Acid Abscisic acid (ABA) is ...

Roles of Abscisic Acid Abscisic acid (ABA) is a particularly interesting hormone with regard to the regulation of its own levels. Its levels rise and fall dramatically in seve

Class of crustacea - copepoda, Class of Crustacea - Copepoda Copepoda ...

Class of Crustacea - Copepoda Copepoda is a huge class of small (1-5mm) crustaceans occupying both marine and freshwater environments. Copepods form the several abundant and c

What is the greenhouse effect, What is the greenhouse effect? The green...

What is the greenhouse effect? The greenhouse effect is a phenomenon in which atmospheric gases like CO 2 trap reradiated heat from the Earth, much as the glass panes of a gre

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd