Protein necessity, Biology

Assignment Help:
Proteins necessity
  1. They are called as body builders.
  2. The proteins are used in various metabolic pathways and body building.
  3. They help in repairing the tissues of the body.
  4. They help in the maintenance of osmotic pressure, they also help in chemical coordination.
  5. They are useful in the formation of blood and tissues.
  6. Enzymes are produced from proteins.
  7. Anti- bodies are also formed from proteins.
  8. In extreme conditions, proteins may also be used for the production of energy.

Related Discussions:- Protein necessity

Explain the s1m filament theory of muscle contraction, Explain the s1M fila...

Explain the s1M filament theory of muscle contraction. What is special of "FlavrSavr" variety of tomato? Why is it preferred to its normal native variety? Illustrate a label

Explain sedationin details, Explain Sedationin details? Intubation and ...

Explain Sedationin details? Intubation and mechanical ventilation is associated with a significant degree of discomfort. In addition, many of the procedures done routinely in I

Cell biology, Introduction to Cell Biology Introduction to Cell Biology i...

Introduction to Cell Biology Introduction to Cell Biology illustrate about the evolution of the cell that involves two processes: 1) Occurrence of genetic variations which are p

Mulluscas., economic importance of mulluscas

economic importance of mulluscas

Brain region responsible for the equilibrium of the body, Q. Which is the b...

Q. Which is the brain region responsible for the coordination and equilibrium of the body? In the central nervous system the cerebellum is the main controller of the motor equi

Vitamins, Vitamins Animals cannot sustain a healthy life if they are ...

Vitamins Animals cannot sustain a healthy life if they are fed on a diet having only carbohydrates, fats and proteins. They also require vitamins in small quantities in the r

Haemo filtration-open-heart surgery, Haemo Filtration : Ultra filtration d...

Haemo Filtration : Ultra filtration during open heart surgery helps in removing excess fluid, especially in renal failure patients. Patients are haemo diluted (haematocrit 18-20)

Can you explain bayesian theorem, Q. Can you explain Bayesian Theorem? ...

Q. Can you explain Bayesian Theorem? Bayesian Theorem: The predictive value of a test is related to the incidence of disease in the population. A history of typical angin

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd