Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Protection Against Insect Bites
To minimize insect bites, travellers should wear light-colored, long-sleeved shirts, pants and socks. The most effective topical insect repellent is N, N-diethyl-m-toluamide (DEET). Sprayed on exposed skin, DEET repels mos- quitoes, ticks, chiggers, fleas, gnats and some flies. DEET is available in formulations of 5-40% and 100%. Higher concentrations do not improve efficacy, but usually protect longer; 30-35% DEET formulations are preferred by Medical Letter consultants. A long-acting DEET formulation originally developed for the US Armed Forces (US Army Extended Duration Topical Insect and Arthropod Repellent - EDTIAR) containing 25-33% DEET (Ultrathon) can provide protection for 6-12 hours
Classification of Different Agro-Industrial By-Products The agro-industrial by-products can be grouped according to the content of nutrients namely: (i) Energy rich supplem
Explain Phenylephine and Methoxamine in amyl nitrite ? They have opposing effects to amyl nitrite as they increase the systemic BP. phenylephine due to its shorter duration of
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Particulates: These are suspended droplets, solid particles or mixture of two. So all the atmospheric substances that are not gases are called particulates. A number of term
Use of biotechnology in characterization of animal biodiversity. Genetic uniqueness of populations is measured by the relative genetic distances of such populations from each o
what is the differnce between syndrome and symptom?
Only during recent years, due to commercialization of agriculture, more emphasis has been given on cash crops, which contribute very little to the animal food. As a result, the liv
ELECTROCONVULSIVE THERAPY: 1) ConceptlMeaning of Electroconvulsive Therapy (ECT) Electroconvulsive Therapy (ECT) is a painless form of electric therapy. It is called as ph
Explain the Criteria for Assessment of Folate Status Red cell folate, continues to be used as an important index of folate status. It is suggested that adequate folate status i
You are given a hamster that has a very short tail (dominant trait) a) Describe a cross that would allow you to determine the short tailed hamster's genotype b) What are the possib
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd