Prophase, Biology

Assignment Help:

Prophase

This is the first and longest phase of mitosis .At its beginning  all  10 nm segments   of chromatids (= chromonemata)  of the  duplicated  chromatin fibres of interphase start shortening and thickening (= condensing) by folding  and coiling  becoming  30 nm thick like the heterochromatic  segments  of interphase. Hence the  chromatin  reticulum of  interphase disappears and the duplicated fibres start  appearing as chromosomes  whose  length  can now  be measured .As  mentioned before  the DNA  is packaged  40 fold in 30nm  fibers .Further condensation chromosomes  continues  throughout  prophase,  ultimately achieving a 5000 fold  to 10000 fold  packaging  of DNA molecules in   metaphase  chromosomes ,opinions differ as  to how  higher  levels  of packaging  are achieved.   It  might  occur  by intensive  clustering  of chromomeres and spiralization   of  the chromatids . opinion  is however, now   emerging  that further  condensation of 30 nm fibres  might be  achieved first  by folding and coiling  to form chromomeres  as described  before  and   ultimately by radial looping  around  a central  core  of nonhistone structural proteins . Secondary constrictions of the chromatids appear at late prophase. 

Other  changes which  occur  during prophase include gradual  dispersion and  ultimate disappearance of nucleoli and formation  of a fibrous spindle apparatus , The latter  is a system  of microtubules, the  two centrioles,  located  in the centrosome  of interphase, get duplicated  probably  in the s period , but  the new  ones grow  during  g2 period   and  attain full size  only as prophase begins ,Prophase  probably  begins with the  appearance, around the centrosome , of short radiating  fibres, each   comprising  a bundle of microtubules .These fibres  are called astral rays,  because  these impart  a starlike appearance to the  centrosome , which is now called  an aster ,the  latter  now splits  into  half  asters each  containing a daughter  centrosome and a pair  of centrioles .The  half  aster. Containing  the new centriole  pair , now  starts moving  away from the other  half  that contains the original   pair  of cenbtrioles  and as it does so several  other  fibres connecting the two  half  asters appear. These  fibres  form a spindle shaped framework   and are called  continuous  or polar spindle  fibres. The migrating half  aster keeps  moving  along  the nuclear membrane  throughout  prophase and ultimately occupies a position at the  opposite pole  of the nucleus, With  increasing  distance between  the two  daughter  centrosomes,  the continuous spindle fibres  get gradually j stretched,  The  complete framework (with  spindle astral rays, daughter centrosomes ,and the centriole  pairs)  finally  formed  is termed mitotic  apparatus  or  bipolar spindle apparatus or acromatic figure  or amphiaster .Cells of higher plants  do not have  centrioles. Hence asters are not formed but  a spindle  is formed. Their  division  is , therefore,  of anastral type.

Evidences suggest  that the microtubules   which  form  the astral rays   and spindle  fibres  are derived from  those  of the cytoskeleton  of the  cell, Towards  the close  of prophase, called prometaphase. By some nuclear envelope breaks down into small fragments resembling   those of endoplasmic reticulum. This results in a free mixing of nucleoplasm with cytosol.


Related Discussions:- Prophase

Excretion, The excretory of lizard

The excretory of lizard

Colibacillosis of newborn animals, Colibacillosis of newborn animals T...

Colibacillosis of newborn animals This is the commonest disease entity of newborn farm animals. In calves the disease  occurs in three forms, viz. enteric colibacillosis manif

Explain the toxicity of vitamin e, Explain the Toxicity of Vitamin E? ...

Explain the Toxicity of Vitamin E? Vitamin E is relatively non-toxic. Adults tolerate doses as high as 100 to 1,000 IU per day. However, adverse effects such as muscle weaknes

What is the bio-medical waste, What is the Bio-medical waste The Bio-m...

What is the Bio-medical waste The Bio-medical waste (Management & Handling Rules), 1998 is applicable to all persons, who generate, collect, receive, store, transport, treat,

What is eutrophication in ecology explain briefly, What is Eutrophication i...

What is Eutrophication in ecology explain briefly? Freshwater ecosystems demonstrate the close relationship between aquatic and terrestrial ecosystems. Until recently, most peo

Value of biodiversity, Q. Value of biodiversity? Today, there is widesp...

Q. Value of biodiversity? Today, there is widespread concern for conservation of wild animals and plants. One might wonder why there is so much concern about protecting other s

Explain what is inversion, Explain what is Inversion ? Inversion is ano...

Explain what is Inversion ? Inversion is another way in which genetic recombination can occur, as seen below. In this case, the change occurs within a chromosome, rather than b

Do algae reproduce asexually or sexually, Q. Do algae reproduce asexually o...

Q. Do algae reproduce asexually or sexually? There are algae that reproduce asexually, There are algae that reproduce sexually and. In unicellular algae reproduction is usually

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Panting - temperature relations in animals, Normal 0 false fa...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd