Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Producers
Autotrophs (self-nourishing) are green plants as they synthesise carbohydrates from simple inorganic raw materials like carbon dioxide and water in the presence of sunlight by the process of photosynthesis for themselves, and indirectly for other non-producers. In terrestrial ecosystem, producers are basically herbaceous and woody plants while in marine and fresh water ecosystems producers are various species of microscopic algae. Chemosynthetic bacteria are also producers. However, unlike plants which constitute the major producers, these bacteria, which are found in deep ocean trenches where sun energy is absent, derive energy by the process of chemosynthesis from the hydrogen sulphide seeping through cracks in the sea floor.
Q. An mRNA molecule codifies only one kind of protein? Eukaryotic cells have monocistronic mRNA, that is each mRNA codifies only one polypeptide chain, Prokaryotes can present
Explain Oxygen Therapyin respiratory support? Oxygen is given to correct hypoxemia. An initial high concentration of oxygen (FiO2) is given while the underlying cause is identi
Brain Neurosecretory Cells and their Hormones Kopec was the very first to suggest the role of hormones in controlling metamorphosis. On the base of his experiments on the lar
A 37-year old woman is admitted to the hospital after complaining of chest pains. She admits to having had severe headaches for several days prior to seeking medical help. She is a
Q. Explain about Non Insulin Dependent Diabetes Mellitus? Overweight and obese adults are generally afflicted by this type of diabetes. The insulin produced by the pancreas is
SEXUA L REPRODUCTION 1 . Amphigony - Zygote is formed. (i) Syngamy Fusion of gametes. (a) Endogamy - It involves self fertilisation. e.g.
Q. Issues to be discussed while counselling a diabetic patient ? Issues to be discussed · Counselling at Diagnosis · Diabetes is Controllable · Counselling for Day
Define the Stages of ConvaIescenca - Nutrition during Stress? This period of catabolism and alteration of the hormonal environment is known as the 'adrenergic - corticoid phase
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Segregation and Treatment of Dressing Waste In many departments waste is less and normally they do not have treatment facility for the bio-medical waste. In their case, interme
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd