Producers-biotic components, Biology

Assignment Help:

Producers

Autotrophs (self-nourishing) are green plants as they synthesise carbohydrates from simple inorganic raw materials like carbon dioxide and water in the presence of sunlight by the process of photosynthesis for themselves, and indirectly for other non-producers. In terrestrial ecosystem, producers are basically herbaceous and woody plants while in marine and fresh water ecosystems producers are various species of microscopic algae. Chemosynthetic bacteria are also producers. However, unlike plants which constitute the major producers, these bacteria, which are found in deep ocean trenches where sun energy is absent, derive energy by the process of chemosynthesis from the hydrogen sulphide seeping through cracks in the sea floor.


Related Discussions:- Producers-biotic components

Mrna molecule codifies only one kind of protein, Q. An mRNA molecule codifi...

Q. An mRNA molecule codifies only one kind of protein? Eukaryotic cells have monocistronic mRNA, that is each mRNA codifies only one polypeptide chain, Prokaryotes can present

Explain oxygen therapyin respiratory support, Explain Oxygen Therapyin resp...

Explain Oxygen Therapyin respiratory support? Oxygen is given to correct hypoxemia. An initial high concentration of oxygen (FiO2) is given while the underlying cause is identi

Brain neurosecretory cells and their hormones, Brain Neurosecretory Cells a...

Brain Neurosecretory Cells and their Hormones Kopec was the very first to suggest the role of hormones in controlling metamorphosis. On the base of his experiments on the lar

The best choice of a physician to determine her condition, A 37-year old wo...

A 37-year old woman is admitted to the hospital after complaining of chest pains. She admits to having had severe headaches for several days prior to seeking medical help. She is a

Non insulin dependent diabetes mellitus, Q. Explain about Non Insulin Depen...

Q. Explain about Non Insulin Dependent Diabetes Mellitus? Overweight and obese adults are generally afflicted by this type of diabetes. The insulin produced by the pancreas is

Sexual reproduction, SEXUA L REPRODUCTION 1 .       Amphigony       ...

SEXUA L REPRODUCTION 1 .       Amphigony        -          Zygote is formed. (i) Syngamy Fusion of gametes. (a) Endogamy - It involves self fertilisation. e.g.

Issues to be discussed while counselling a diabetic patient, Q. Issues to b...

Q. Issues to be discussed while counselling a diabetic patient ? Issues to be discussed · Counselling at Diagnosis · Diabetes is Controllable · Counselling for Day

Define the stages of convaiescenca - nutrition during stress, Define the St...

Define the Stages of ConvaIescenca - Nutrition during Stress? This period of catabolism and alteration of the hormonal environment is known as the 'adrenergic - corticoid phase

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Segregation and treatment of dressing waste, Segregation and Treatment of D...

Segregation and Treatment of Dressing Waste In many departments waste is less and normally they do not have treatment facility for the bio-medical waste. In their case, interme

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd