Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Procedure of Hormone Act
All plant hormones show extraordinary varied complex effects in controlling plant growth and development, Extrapolation from how an animal hormone works a common framework for different plant hormones may explain their varied effects. In animals, the wide variety of effects shown by different hormones is understood by the mechanism of action at the cell level. You may recall that the target cells have appropriate receptors for hormones either on the plasma membrane or are located generally in the interior of the cell. Similar attempts have been made to explain the mechanism of action of plant hormones employing the receptor concept. Both natural and synthetic hormones behave in a similar way as it is assumed that they bind to specific receptors to form a hormone receptor complex to trigger an effect.
Though search for a receptor protein has been generally a frustrating one, recently, such proteins have been demonstrated in pea which bind with auxins before eliciting a response such as embryoid differentiation in tissue culture. Cell elongation, the most well-known response of auxin, requires that the longitudinal wall stretches, which will involve basic changes in cell wall. In order to stretch, cell wall has to become more plastic, just like a balloon, in which the driving force to increase the volume is proportional to the resistance offered by the balloon wall. Increased plasticity of the cell wall by auxin is considered to be due to breaking of some of the bonds between the polysaccharide components of the cell wall. As it becomes plastic the cell is amenable to stretching. The structure of gibberellin resembles certain animal steroid neurotransmitters.
The search for gibberellin receptor in cytoplasm rather than in the membrane has not been fruitful unlike animal neurotransmitters which bind to cytoplasmic receptors. Though the biochemical mode of action of plant hormones is poorly understood, still the general assumption in current research work is that plants cells have specific receptors which when bound to hormones activate the signal transduction pathway for various activities. However, though many proteins have been found by various workers to bind with hormones, these may be inactive complexes. Currently search is on to identify the nature of the receptor and decipher its mode of action.
Canine parvovirus infections The canine parvovirus infections are caused by a virus, which belongs to the genus Parvovirus in the family Parvoviridae. This virus is similar to
Explain Precautions for Preparation of Bacterial Smear? 1. Plates used should be prepared 24 hours before use to avoid spreading of colonies due to moisture in plates. 2. Sw
Explain the Microscope Colony Counts and Agar Droplets? Microscope Colony Counts - The method involves counting of micro-colonies that develop on agar layered over a microsco
Agro-industrial by-products (AIBP) refer to the by-products derived due to processing of the main crop products and allied industries. They are in comparison to crop residues, are
Define Clinical Manifestations and Nutritional Problems Associated with Cancer? In the previous section we learnt that cancer results in several changes in the metabolism of ca
Q. Determine ST-Segment Elevation? Ans. Exercise induced ST-segment elevation is common in subjects with post MI stress tests in leads where Q-waves are present. It has be
Q. How is photic energy absorbed by chlorophyll transfered to ATP molecules in photophosphorylation and How will be the resulting ATP used? Light excites energizes and chloroph
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Tall (T) plants are dominant and short (t) plants are recessive. Two heterozygous tall plants are crossed. What percentage of the offspring will be tall?
Discuss why Obelia is considered to be of special interest in Zoology as an animal showing an intermediate grade of organization.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd