Principles of binomial nomenclature, Biology

Assignment Help:

Q. Principles of Binomial Nomenclature?

There are certain, basic principles of binomial nomenclature which are as follows:

i) Different nomenclatural systems are independent of each other e.g. though "CORYDALIS" is a genus name of plants in the family Fumaricaceae, "CORYDALIS" is a genus name of insects in the order Megaloptera. Although it is permissible in the code it is not desirable to employ the same name for different kinds of organisms of same status of two different systems, This might constitute an obstacle to interdisciplinary understanding.

ii) Within each nomenclature each taxon. with a particular definition, position and rank can bear only one correct name except in unusual or specified cases.

iii) No two taxa may bear the same name.

iv) Scientific names of taxa are treated as Latin names regardless of their derivation.

v) The correct name of a taxon except above the rank of family is based upon priority of publication.

vi) For the categories of order (in Botany) or super family (in Zoology) and lower categories in both, the application of name of taxa is based on type specimens, type species or type genera except in specified. cases.


Related Discussions:- Principles of binomial nomenclature

Explain the dna hybridisation, Explain the DNA Hybridisation? This tech...

Explain the DNA Hybridisation? This technique is used to study or compare the genetic affinity between two organism. In such studies the deoxyribonucleic acid (DNA) of both org

Organisms contain enzymes, Some organisms contain enzymes that condense a f...

Some organisms contain enzymes that condense a fatty alcohol and a fatty acid to generate wax esters. Draw decanol, plamitic acid (C16:0 fatty acid) and the resulting wax ester gen

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Show measurement of mitral valve, Q. Show Measurement of mitral valve? ...

Q. Show Measurement of mitral valve? Measurement of mitral valve and gradients across mitral valve are of importance in clinical decision making. Mitral valve area can be measu

Explain the periapical surgery - endodontic surgery, Explain the Periapical...

Explain the Periapical surgery - Endodontic Surgery a) Curretage 1 b) Root-end ressection 2 c) Root-end preparation 3 d) Root-end filling 4

Consists of the production of atp, Select all that are true/correct: Cellul...

Select all that are true/correct: Cellular respiration consists of the production of ATP in several steps using enzymes. Photosynthesis produces carbohydrates using carbon dioxide

Preadmission preparation - nursing, Preadmission Preparation   Preadmi...

Preadmission Preparation   Preadmission preparation is most effective when the admission is planned and there is enough time for the nurse to provide necessary information to

Plant, what is the scientific explanation of "touch me not" plant that can ...

what is the scientific explanation of "touch me not" plant that can react due to any touch

What is mitochondria , What is Mitochondria ? Mitochondria are the cell...

What is Mitochondria ? Mitochondria are the cellular organelles responsible for the conversion of energy into a form called ATP. ATP is a high energy chemical compound that cel

Which hormones secreted by adrenal medulla, Q. What are the hormones secret...

Q. What are the hormones secreted by the adrenal medulla? What are their respective functions? The medullary portion of the adrenals secretes hormones of the catecholamine grou

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd