Primary production - ecosystem, Biology

Assignment Help:

Primary Production - Ecosystem

Energy accumulated by plants during photosynthesis is called production or more specifically primary production. It is the first and the basic form of energy stored in an ecosystem. Production is defined technically as the amount of biomass or organic matter produced per unit &ea in a given period. It can be expressed in terms of 2 weight (g/m2) or energy {kcal/m).

The rate at which energy accumulates is  known as primary productivity. It is expressed in terms of kcal/m /yr or g/m2/yr. In case of plants, primary production is generally differentiated into two distinct categories, namely gross primary production (GPP) and net primary production (NPP). Gross primary production refers to the total amount of solar energy fixed into organic matter by primary producers through photosynthesis. A considerable portion of the solar energy fixed by plants (GPPI. is utilised by plants themselves in respiration (R) to get the energy needed for their metabolism and for other vital functions. The amount of energy left after respiratory consumption (R) is incorporated into new body tissue (growth) or is used for producing new individuals (reproduction). The amount of biomass or organic matter accumulated by plants per unit area in a given period is called net primary production. The overall relationship between GPP and NPP can be written as:

GPP - R = NPP or GPP = NPP + R

From this equation you might have noticed  that whatever  energy is fixed by plants (GPP) some of  it  is used  for their own maintenance  (R) and only remaining  (NPP) is  available for the next trophic  level.  So net primary production is the only energy available for the next trophic level.


Related Discussions:- Primary production - ecosystem

Explain the basic concept of proteins, Explain the Basic Concept of Protein...

Explain the Basic Concept of Proteins? Proteins, as we already knows by now are products of amino acids. Each molecule of protein is composed of many molecules of amino acids j

Nutrition, The oxidation of sugar in the cell of higher organisms takes pla...

The oxidation of sugar in the cell of higher organisms takes place in the ?

Explain about the freeze drying Method, Explain about the freeze drying Met...

Explain about the freeze drying Method? The Techniques of freeze-drying have been developed over the past half-century for the purpose of preserving certain biological material

External sources for health care, Normal 0 false false fals...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Explain dietetics, Explain Dietetics Dietetics  has been defined as  t...

Explain Dietetics Dietetics  has been defined as  the science and art of feeding individuals based  on the principles of  nutrition. It can also be  said  to  be  the "science

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Natality - population parameters and regulation, Natality - Population Para...

Natality - Population Parameters and Regulation Natality is the ability of a population to increase. Natality rate is equivalent to birth rate which means the production of ne

Fertilisation, Fertilisation: Fertilisation is the process of fusion...

Fertilisation: Fertilisation is the process of fusion of male and female gametes. For fusion of male and female gametes, pollen grains have to reach the surface of the stigm

Climax forest - xerarch, Climax Forest - Xerarch First, some xerophyti...

Climax Forest - Xerarch First, some xerophytic species of trees, establish in this area. They are sparsely distributed and are stunted because the conditions are still not ver

Mycroboilogy mycoplasma, How we write assimgment about mycobiology of mycop...

How we write assimgment about mycobiology of mycoplasma in detail

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd