Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Primary Egg Envelopes
These are the egg envelopes which develop in the ovary between oocyte and follicle cells in the space occupied by the interdigitating microvilli. Such envelopes have been named variously in different animals.
a) It is named as vitelline envelope or vitelline membrane in insects, molluscs, amphibians and birds.
b) In tunicates and fishes, it is known as chorion. In many sharks and bony fishes the primary envelope has striated appearance and is referred to as zona radiata representing the degraded microvilli of the growing oocyte. The perforation in the zona radiata becomes the micropyle through which the spermatozoa can enter the egg.
c) In mammals, the unstriated and modified zona pellucida is formed as a result of joint efforts of egg and follicle cells. While escaping the Graafian follicle mammalian oocyte carries on the surface of zona pellucida a layer of follicle cells known as corona radiata. The primary envelopes usually stick closely to the egg surface. These later on participate in the formation of fertilization membrane.
Distinguish among the terms 'pesticide', 'insecticide' and 'herbicide. A pesticide is a compound which destroys or controls any organism which is considered to be harmful
CRANIAL NERVES 12 pairs. Total weight 12 gms. Upto amphibian 10 pairs cranial nerves are present. 1, 2, 8, - sensory. 3, 4, 6, 11, 12, motor. 5, 7, 9, 10 - mixed. 3
questions and answers on human impacts on environment
Define the term price mechanism and how it works. The price mechanism and its working: The above demonstrated diagram assumes the market is into equilibrium, whereby deman
Explain the term Light reflex - Neuronal pathways The neuronal pathway for light reflex can be afferent and efferent. In the afferent pathway, the pupillary fibres begin in the
Explain about the Texturization? Proteins constitute the basis of structures and texture in several foods, whether these come from living tissue (myofibrills in meat or fish) o
Define Role of Buffer in Electrophoresis? Buffer ions have a two-fold purpose in electrophoresis, they carry the applied current, and they fix the pH at which electrophoresis i
Explain about the Musculoskeletal System? Osteopenia (decrease in bone mineral content) is observed with aging. There is an average of 30% decline in the bone mineral density f
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is the uncontrolled mitotic procedure that occurs as disease in pluricellular beings called? Uncontrolled mitotic cell division is known as neoplasia. Neoplasia the for
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd