Primary egg envelopes, Biology

Assignment Help:

Primary Egg Envelopes

These are the egg envelopes which develop in the ovary between oocyte and follicle cells in the space occupied by the interdigitating microvilli. Such envelopes have been named variously in different animals.

a) It is named as vitelline envelope or vitelline membrane in insects, molluscs, amphibians and birds.

b) In tunicates and fishes, it is known as chorion. In many sharks and bony fishes the primary envelope has striated appearance and is referred to as zona radiata representing the degraded microvilli of the growing oocyte. The perforation in the zona radiata becomes the micropyle through which the spermatozoa can enter the egg.

c) In mammals, the unstriated and modified zona pellucida is formed as a result of joint efforts of egg and follicle cells. While escaping the Graafian follicle mammalian oocyte carries on the surface of zona pellucida a layer of follicle cells known as corona radiata. The primary envelopes usually stick closely to the egg surface. These later on participate in the formation of fertilization membrane.


Related Discussions:- Primary egg envelopes

Distinguish between the terms pesticide and insecticide, Distinguish among ...

Distinguish among the terms 'pesticide', 'insecticide' and 'herbicide.   A pesticide is a compound which destroys or controls any organism which is considered to be harmful

Nervous system - cranial nerves, CRANIAL NERVES 12 pairs. Total weig...

CRANIAL NERVES 12 pairs. Total weight 12 gms. Upto amphibian 10 pairs cranial nerves are present. 1, 2, 8, - sensory. 3, 4, 6, 11, 12, motor. 5, 7, 9, 10 - mixed. 3

Human impact on environment, questions and answers on human impacts on envi...

questions and answers on human impacts on environment

Define the term price mechanism and its working, Define the term price mech...

Define the term price mechanism and how it works. The price mechanism and its working: The above demonstrated diagram assumes the market is into equilibrium, whereby deman

Explain the term light reflex - neuronal pathways, Explain the term Light r...

Explain the term Light reflex - Neuronal pathways The neuronal pathway for light reflex can be afferent and efferent. In the afferent pathway, the pupillary fibres begin in the

Explain about the texturization, Explain about the Texturization? Prote...

Explain about the Texturization? Proteins constitute the basis of structures and texture in several foods, whether these come from living tissue (myofibrills in meat or fish) o

Define role of buffer in electrophoresis, Define Role of Buffer in Electrop...

Define Role of Buffer in Electrophoresis? Buffer ions have a two-fold purpose in electrophoresis, they carry the applied current, and they fix the pH at which electrophoresis i

Explain about the musculoskeletal system, Explain about the Musculoskeletal...

Explain about the Musculoskeletal System? Osteopenia (decrease in bone mineral content) is observed with aging. There is an average of 30% decline in the bone mineral density f

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe uncontrolled mitotic procedure, Q. What is the uncontrolled mitoti...

Q. What is the uncontrolled mitotic procedure that occurs as disease in pluricellular beings called? Uncontrolled mitotic cell division is known as neoplasia. Neoplasia the for

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd