Prevent vitamin a deficiency, Biology

Assignment Help:

Vitamin a deficiency leads to a variety of disorders of the eyes and this effects the vision. Some of the disorders due to vitamin A deficiency are given below.

1) Night Blindness : The person cannot see the objects in dim light and in nights. 

2) Xeropthalmia or dry eyes : The lachrymal glands in the eyes do not produce tears. The conjuctiva or the outer most layer of the eye becomes dry.

3) The cornea becomes soft and bursts open. This leads to the loss of vision and permanent blindness.

4) Reproductive functions may also be affected in vitamin A deficiency.

5) The various agencies can motivate people to eradicate blindness due to the deficiency of vitamin A. They are:

6) School teachers should impress upon the school children to alter diets suitably.

7) Village guides, local dayees, Anganwadi workers, youth leaders should motivate parents and the members of the society about the need to pay attention.

8) Primary Health Centres, Maternal Health Centres and non-government organisations should help to educate and implement the programme.

9) The various media like T.V. radio, posters, folders, films and talks should spread awarness among the people.


Related Discussions:- Prevent vitamin a deficiency

Define nutritional support management for chemotherapy, Define Nutritional ...

Define Nutritional Support Management for chemotherapy? Antiemetics are used in the treatment of chemotherapy induced nausea and vomiting. Antiemetics become absolutely necessa

Explain about dry heat sterilization, Q. Explain about Dry heat sterilizati...

Q. Explain about Dry heat sterilization? It is used to sterilize glass ware, forceps, scissors, scalpels, all glass syringes, swabs, some pharmaceuticals products such as liqui

How to investigate mitral stenosis by echocardiography, Q. How to Investiga...

Q. How to Investigate mitral stenosis by Echocardiography? Echocardiography is diagnostic in mitral stenosis. There is varying degrees of thickening and calcification of leafle

Nutrition, pictures for hetrotrophic and autotrophic mode of nutrition

pictures for hetrotrophic and autotrophic mode of nutrition

Which type of defense cell do bacteria attract, Which type of defense cell ...

Which type of defense cell do bacteria attract and cause to multiply during the inflammation process? What is the name given to the waste material produced by the inflammation trig

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain antimicrobial prophylaxis, Explain Antimicrobial Prophylaxis An...

Explain Antimicrobial Prophylaxis Antimicrobial prophylaxis can decrease the incidence of infection, particularly surgical site infection, after certain operations, but this be

Lysosomes, LYSOSOMES Like mitochondrial lysosomes are also  typical mem...

LYSOSOMES Like mitochondrial lysosomes are also  typical membrane bound and dense  fluid filled sac  like cytoplasmic  organelles  of all eukaryotic cells these  however, diffe

Bacterial diseases-black disease, Black disease It is a fatal peracute...

Black disease It is a fatal peracute disease caused by Clostridium novyi Type B. It is associated with liver damage caused by liver fluke. The onset of the disease is rapid fo

Define about the glutathione peroxidases - selenium, Define about the Gluta...

Define about the Glutathione peroxidases - Selenium? The role of selenium in the cytosolic enzyme, glutathione peroxidase (GSHPx), was first illustrated in 1973. Four selenium

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd