Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Body temperature is homeostatic ally regulated around a set point. Given your knowledge of negative feedback and homeostatic control system, predict whether narrowing or widening of the blood vessels of the skin will occur when a person exercises strenuously.
What is the function of the umbilical cord? The umbilical cord is a set of blood vessels that connects the fetus with the placenta. In the fetus one extremity of the cord inse
Explain the term Phytates? We are familiar with phytates as an inhibitor of mineral absorption (calcium, iron etc.) especially in the vegetarian diets that are cereal-based. Th
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Why is the uricotelic excretion essential for reptile and avian embryos? In birds and reptiles the excretory system is uricotelic since uric acid is less toxic, insoluble an
How can the abundance and diversity of living beings in the tropical forests be explained? The biodiversity of these ecosystems can be described by the great availability of th
What is Portal and Rental Circulation ? The body has other circulation systems that do not return blood directly to the heart. For instance, the blood that drains from the abdo
Health Impacts of Water Pollution It is well known that clean water is absolutely essential for healthy living. Although adequate supply of fresh and clean drinking water is a
Dispersal of Seeds A plant usually bears many fruits and innumerable seeds. If all the seeds produced by a plant were to germinate in the immediate vicinity, this will have s
Q. What do you mean by Pericardium? Pericardium is the sac covering the heart. Pericardium consists of two layers-the visceral pericardium (epicardium) and the parietal pericar
What is nuclear pollution? Nuclear pollution having of radiations emitted from atomic nuclei, these radiations is highly injurious to living beings. They can be originated from
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd