Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
A woman is heterozygous for three X-linked loci: AaBbDd. She has seven sons with the following genotypes:
two are X ABd Y
three are X abD Y
one is X ABD Y
one is X Abd Y
a. What is the most likely combination of alleles on each of the mother's X chromosomes?
b. Which of the seven sons is/are the result of recombination? Between which genes did the crossover occur in the mother's oocyte to create each recombinant X?
c. List the other possible recombinant genotypes that have not appeared in these sons.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Class of Crustacea - Ostracoda Generally called mussel or seed-shrimps, Ostracoda include both fresh water and marine forms. The small crustaceans, computing a few mm have the
Define effect of Caffeine on athletes? Caffeine is found in coffee, tea, colas and chocolates. Its doses at 3- 6 mg/d have been known to increase muscle contractility and aerob
Assuming that variability of populations were non-genetic, that is, not controlled by genetic material, once again chance events alone would determine which of the organisms would
What are the four characteristics that all chordates have at some stage of their lifecycle ?
Phylum Sporozoa 1) Thcy do not liavc any external locomotory dcvice and move by wriggling. 2) Reproduction by producing numerous spores. 3) All are parasites of animals,
The improper handling and transfer of the solid wastes results in various health and environmental hazards, such as: 1. Spoilage of landscape: Municipal wastes heap up o
why succession more likely to occur on valley floor than steep slopes
Reptiles - Regeneration in Vertebrates Among reptiles, the lizards like the Gecko Hemidactylus flaviviridis and Anolis carolinensis can again generate their tail, following au
Toxoplasma cycles between its rodent and feline hosts, living out different phases of its existence in each. What is the scientific means about the cat and mouse?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd