Possible recombinant genotypes, Biology

Assignment Help:

A woman is heterozygous for three X-linked loci: AaBbDd. She has seven sons with the following genotypes:

two are X ABd Y

three are X abD Y

one is X ABD Y

one is X Abd Y

a. What is the most likely combination of alleles on each of the mother's X chromosomes?

b. Which of the seven sons is/are the result of recombination? Between which genes did the crossover occur in the mother's oocyte to create each recombinant X?

c. List the other possible recombinant genotypes that have not appeared in these sons.


Related Discussions:- Possible recombinant genotypes

Seed formation, What are the 3 phases of seed formation

What are the 3 phases of seed formation

Show very low level of lactase activity, Q. Show Very low level of lactase ...

Q. Show Very low level of lactase activity? Very low level of lactase activity: at very low level of lactase activity all milk products must be eliminated, substitutes of milk

Of what subunits are ribosomes are made, Q. Of what subunits are ribosomes ...

Q. Of what subunits are ribosomes are made? Ribosomes are made of two subunits the small subunit and the large subunit. These subunits are made of proteins and ribosomic RNA (r

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the expression of moisture content, What is the Expression of Moist...

What is the Expression of Moisture Content? Moisture content, you would realize, is expressed in one of two ways i.e dry weight basis (dwb) or wet weight bases (wwb). Moisture

What is the virus that causes flu, Q. What is the virus that causes flu? Wh...

Q. What is the virus that causes flu? Why doesn't the body produce permanent immunity against that virus? How does the vaccine against flu work? Flu is a disease caused through

How different are birds and reptiles, Q. How different are birds and reptil...

Q. How different are birds and reptiles concerning the maintenance of body temperature? Are birds rare in polar regions? Reptiles are heterothermic that is they do not control

How emulsion can stabilized, How emulsion can stabilized Emulsions can ...

How emulsion can stabilized Emulsions can be stabilized by the use of emulsifiers, finely divided particles adsorbed at the interface and water dispersible hydrocolloids. Emuls

What happens to the movement of molecules at equilibrium, What happens to t...

What happens to the movement of molecules at equilibrium? At equilibrium, the movement of molecules continues, but because there is no concentration gradient, there is no net m

What is st heart rate index, Q. What is ST Heart Rate Index? To calcula...

Q. What is ST Heart Rate Index? To calculate the index, the maximum ST depression is divided by the Delta heart rate (difference between the resting and maximum heart rate). As

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd