Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
A woman is heterozygous for three X-linked loci: AaBbDd. She has seven sons with the following genotypes:
two are X ABd Y
three are X abD Y
one is X ABD Y
one is X Abd Y
a. What is the most likely combination of alleles on each of the mother's X chromosomes?
b. Which of the seven sons is/are the result of recombination? Between which genes did the crossover occur in the mother's oocyte to create each recombinant X?
c. List the other possible recombinant genotypes that have not appeared in these sons.
What are the 3 phases of seed formation
Q. Show Very low level of lactase activity? Very low level of lactase activity: at very low level of lactase activity all milk products must be eliminated, substitutes of milk
Q. Of what subunits are ribosomes are made? Ribosomes are made of two subunits the small subunit and the large subunit. These subunits are made of proteins and ribosomic RNA (r
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the Expression of Moisture Content? Moisture content, you would realize, is expressed in one of two ways i.e dry weight basis (dwb) or wet weight bases (wwb). Moisture
Q. What is the virus that causes flu? Why doesn't the body produce permanent immunity against that virus? How does the vaccine against flu work? Flu is a disease caused through
Q. How different are birds and reptiles concerning the maintenance of body temperature? Are birds rare in polar regions? Reptiles are heterothermic that is they do not control
How emulsion can stabilized Emulsions can be stabilized by the use of emulsifiers, finely divided particles adsorbed at the interface and water dispersible hydrocolloids. Emuls
What happens to the movement of molecules at equilibrium? At equilibrium, the movement of molecules continues, but because there is no concentration gradient, there is no net m
Q. What is ST Heart Rate Index? To calculate the index, the maximum ST depression is divided by the Delta heart rate (difference between the resting and maximum heart rate). As
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd