porifera, Biology

Assignment Help:
Classify phylum porifera with examples

Related Discussions:- porifera

Unconventional feed resources and anti-nutritional factors, Unconventional ...

Unconventional Feed Resources and Anti-Nutritional Factors With increasing ruminant population, there is a need to identify and introduce new and lesser-known food and feed cro

Ancestral unicellular organism, Ancestral Unicellular Organism So far ...

Ancestral Unicellular Organism So far in this unit we have considered the characteristic of body designs that are shared by various animals and the different body plans that d

Dna structure, A)Which of the following statements about DNA structure is t...

A)Which of the following statements about DNA structure is true? 1.The nucleic acid strands in a DNA molecule are oriented ant parallel to each other, meaning they run in opposite

Diagnosis and treatment of myocarditis, Diagnosis X-ray chest show...

Diagnosis X-ray chest shows cardiomegaly.  ECG shows conduction defect, low voltage QRS, atrial and ventricular disrhythrnias.  Echocardiogram - decreased LV cont

Procedures for diagnosis - polymerase chain reaction (pcr), P o lymer...

P o lymerase chain reaction (PCR): The PCR technique enables the exponential amplification of nucleic acid sequences from any biological samples. In the last few ye

Social Status and Support Network, Social Status and Support Network ...

Social Status and Support Network Income and Social Status: Higher income and social status lead to better health.Employed persons, having more control over their workin

Define the density of egg, Define the density of egg  The density of e...

Define the density of egg  The density of egg products is not affected by dehydration. When a dried egg product is reconstituted to its natural solids, it has about the same d

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Ventilation of tracheal system – passive suction ventilation, Ventilation o...

Ventilation of Tracheal System – Passive Suction Ventilation Many active insects and insects that live in environments where water is scarce cannot depend on diffusion alone t

Plant physiology.., why does the removal of the extremity of coleoptile pro...

why does the removal of the extremity of coleoptile prohibit plant growth?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd