Population, Biology

Assignment Help:

Population

You must be familiar with the term 'population'. It is one of the most talked about issues of this century. It is feared that the rapid growth of the world population if allowed to continue, might outstrip the food supply in the near future. The present high rate of population growth is a major concern of the governments, scientists and administrators. Have you ever wondered as to what is meant by population?

In a technical sense 'population' is defured as a group of freely interbreeding the same species present in a specific area at a given time. For example, when we say thatindividuals of the population of a city is 50,000, we mean that there are 50,000 individuals of Homo sapiens in that town. Other living organisms, for example cats and dogs present in the city are not included as they are populations of two different species.

In nature, population of a species is subdivided into a number of local breeding populations called deme. Demes are geographically separated populations of the same species. For example, the garden lizards of Qutub Minar. Delhi, form a separate deme from the garden lizard of Lodi Gardens, Delhi or the garden lizards of Swaraj Bhawan, Allahabad.

Consequently, in a deme each individual has an equal opportunity of mating with another individual of the opposite sex, but not with individuals in another deme. Because of frequent mating and similar environmental conditions members of a deme resemble each other more closely.

A population exhibits certain characteristics which can only be expressed at the population level and not shared by the individuals of the population. For example, individual organisms are born, grow and die but characteristics such as birth rate, death rate, density are only meaningful at the population level.


Related Discussions:- Population

Messenger rna (mrna), Messenger RNA (mRNA) are the proteins are not synthe...

Messenger RNA (mRNA) are the proteins are not synthesized directly from the genomic DNA. Insteadof that an RNA template (a precursor mRNA) is constructed from the sequence of gene

Give some human diseases caused by protozoans, Q. What are other important ...

Q. What are other important human diseases caused by protozoans? Some other significant protozoan infections are amebiasis, trichomoniasis, giardiasis, leishmaniasis, meningoen

How arab influence on the development of anatomy, Please on 3 separate para...

Please on 3 separate paragraph a. Examine the contributions of select scientists from the Greek and Roman period. b. Explore the Arab influence on the development of anatomy

Explain methodology required for osazone test, Explain Methodology Required...

Explain Methodology Required for Osazone Test? Take about 250-300 mg of phenylhydrazine mixture in the 3 clean labelled 15 ml dry test tubes. Add 5 ml of the glucose, fructose

Nucleus, Nucleus - Largest component of the cell. Nucleus is doub...

Nucleus - Largest component of the cell. Nucleus is double membrane bound dense protoplasmic body that controls cellular metabolism, enclose all the genetic information,

Why the rate of photosynthesis does increases, Why the rate of photosynthes...

Why the rate of photosynthesis does increases, peak, and then reduces as temperature increases? Increasing the temperature initially accelerates the many chemical reactions in

Which kind of polarity do water-soluble have, Which kind of polarity do wat...

Which kind of polarity do water-soluble and fat-soluble substances respectively have? Water-soluble substances are polar molecules, i.e., they have electrically charged areas.

Congestive heart failure, In native-valve IE, acute CHF occurs more frequen...

In native-valve IE, acute CHF occurs more frequently in aortic-valve infections (29 per cent) than with mitral (20 per cent) or tricuspid disease (8 per cent). CHF may develop acut

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the treatment for hiv, Anti-retroviral drugs are given to the patie...

Anti-retroviral drugs are given to the patient. They lesser the viral load and gives relief from infection, but it is not lasting it is temporary relief i.e. it cannot cure.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd