Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Population was defined by Clarke in 1954.
The term population refers to the total number of individuals of a sp. occupying a particular geographic aera at a given time.
A sp. may have a single population or many population inhabiting diff. regions.
Population education is necessory for students to know about -
1. Uncontrolled population leads to environmental pollution, depletion of natural resources extinction of species.
2. Benefits to biosphere.
3. Advantages of a small family names to human.
4. Relation of population to the standards of life.
5. Methods of slowing down the growth of human population.
Species could be divided into which categories?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Quick transient responses - Behaviour of Plants Such responses are stimulated by factors showing significant variations over relatively small time period e.g., those showing w
The psychological effects of total edentulism are complex and varied, and range from very minimal to a state of neuroticism. Although complete dentures are able to satisfy the esth
Hypertensive emergencies should be treated within one hour. Hypertensive urgencies may be treated more slowly. The term accelerated malignant hypertension is used when retinal haem
Which of the following compounds results from cyclization of glucose? Select one: a. alpha-D-glucopyronose b. beta-D-glucopyronose c. alpha-D-glucofuranose d. beta-D
The fact that some pure solutions of hydrocarbons do not readily evaporate at room temperature is a result of- Select one: a. London dispersion forces. b. The hydrophobic
NEO-LAMARCKISM Modem modified form of Lamarck theory is regarded as Neo-Lamarckism. Mc Dougall (1938) found that time taken for training the mice was reducing gradually
Explain about the Probiotics? A mono or mixed culture of living organisms, which when ingested in certain amounts, has a positive impact on host health, beyond conventional nut
Classify suture materials Sutures can broadly be classified into two kinds - Absorbable: will break down harmlessly in the body over time without intervention, Non-absor
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd