Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
It is the most common (occurring in 75 per cent cases of ARF) manifestation of ARF. It involves large joints, it is typically fleeting in character shifting from one large joint to another. Knees, ankles, elbows and wrists are the common joints involved. There is synovitis and synovial fluid shows polymorph cells. Joint swelling and pain usually resolves in 4-6 weeks and there is no residual deformity of joints.
Explain the Radiographic Success of Root Canal Treatment Elimination or lack of development of an area of rarefaction (= Radiolocency ) for a minimum of I year after treatment
Q. What are the archenteron and the blastopore? What is the stage of the embryonic development in which these structures are formed? What are the destinations of the archenteron an
Amiodarone, quinidine, propafenone, and verapamil may increase digoxin levels up to 100 per cent. It is prudent to measure a blood level after 7-14 days (and at least 6 hours after
Explain the following terms in detail - Homology, Homologous ? Structures that have a similar evolutionary origin however different functions. The wing of a bat and a whale's fl
Q. Do plants have tissue organization and specialized organs? Plants have specialized organs (like roots, limbs, reproductive organs, leaves) and differentiated tissues (suppor
Q. Classification and Justification of hemichordata? Kingdom Animalia Animals; multicellular organisms with cells that lack a cell wall, many capable of inovement or movement o
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What are the Symptoms of dyslipidemia? The main symptom is presence of xanthoma: This is a yellowish swelling, nodule or plaque in the skin resulting from deposits of fat. T
What is Phylum Platyhelminthes - Flatworms ? This Class consists of the free-living flatworms, the best known of which is the Genus Planaria. Most of the species in this class
Why is it important to study biology? By studying biology, you can create informed decisions on issues that impact you and society, like environmental issues, health, and tech
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd