Pollenkitt - pollen wall, Biology

Assignment Help:

Pollenkitt - Pollen Wall

The lipoidal layer found on the outside of the mature pollen grains of many insect pollinated species is known as the pollenkitt. In addition to lipids it is made up of flavonoids, carotenoids and degeneration products of tapetal proteins. The carotenoids are responsible for its characteristic yellow or orange color. The function of pollenkitt is not clear. It is believed to act as an insect attractant, help in pollen dispersal and in protecting against the damaging effects of UV rays. Deposition o flavonoids appear important for the nod functioning of pollen. In maize it has been shown that the pollen grains that lack flavonoids are incapable of developing tubes that are effective in fertilization. Lipids also help in checking water loss after anther dehiscence and discharge of pollen.


Related Discussions:- Pollenkitt - pollen wall

Advantage of using the regulatory strategy of enzyme, You have two enzymes,...

You have two enzymes, 1 and 2. Both convert substance A into substance B. 1 is inhibited by B, because B partially blocks the active site and will not allow more A to enter. 2 is i

Evolution of man, EVOLUTION OF MAN - Mammals evolved from primitive...

EVOLUTION OF MAN - Mammals evolved from primitive reptiles (therapsida) in Triassic period, about 210 million years ago. Mammals existed as inconspicuous group of small

How do bacteria reproduce, How do bacteria reproduce? Bacteria replicat...

How do bacteria reproduce? Bacteria replicate by binary fission (scissiparity). Some bacteria though present a kind of sexual reproduction (transformation, transduction or conj

Biological valves, Biological Valves :  Biological valves are available fo...

Biological Valves :  Biological valves are available for all positions. For mitral position they are usually mounted on a stent (stent mounted) whereas for aortic position they ma

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe different animal groups, Describe different animal groups a) C...

Describe different animal groups a) Could  comprehensively  compare  and  contrast  the  behaviours  exhibited  by  social animals rather than describe different animal groups

How is carbon dioxide released by cellular respiration, How is carbon dioxi...

How is carbon dioxide released by cellular respiration transported from the tissues to be eliminated through the lungs? In vertebrates almost 70% of the carbon dioxide is trans

Fungai, introduction in fungai

introduction in fungai

Poisoning - pesticide toxicity, P o i s on i n g P e sticide ...

P o i s on i n g P e sticide toxicity Chemical pesticides were introduced as an important tool for pest control and have been used extensively in human health ope

What are the proportions of gametes, An organism having the genotype AaBbCc...

An organism having the genotype AaBbCcDdEe is self-fertilized. What are the proportions of gametes that are expected to carry only dominant alleles?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd