Point out some difference between tumor and cancer, Biology

Assignment Help:

Point out some Difference between Tumor And Cancer?

Tumor is a swelling or growth because of an abnormal growth of tissue. Tumors can either be benign or malignant. The benign tumor remains highly localized. On the other hand, the malignant tumor known as cancer is characterized by invasiveness and can form distant colonies elsewhere in the body. Cancer cells are very irregular in shape and their arrangement in tumor tissue is very unruly. Cancer is painless if it does not compress the adjacent organs. Later, it causes pain by invading or pressing the adjacent vital organs.

Another aspect of malignancy is the ability of tumor cells to elude the immune system. These cells may cover up antigens that would otherwise mark them for destruction or they may rid themselves of the cell surface molecules that lymphocytes use to recognize foreign cells. The immune system is largely ineffective.


Related Discussions:- Point out some difference between tumor and cancer

Explain blood vessels that carry blood, Explain Blood Vessels that carry bl...

Explain Blood Vessels that carry blood? Blood vessels that carry blood away from the heart to the lungs or to the rest of the body are called arteries. The walls of arteries ha

Explain difference between an ecological niche and a habitat, What is the d...

What is the difference between an ecological niche and a habitat? An ecological place is a set of peculiar activities, resources and strategies that a species explores to repro

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Pathophysiology of chronic wasting disease, Q. Pathophysiology of Chronic w...

Q. Pathophysiology of Chronic wasting disease? We all know that heart attack i.e. myocardial infarction is not the beginning but a last stage representing acute clinical manife

Describe class aves in details, Describe Class Aves in details? Class ...

Describe Class Aves in details? Class Aves: The fossil record contains evidence that birds evolved from the reptiles. Birds share anatomical features with Protoavis and Archa

What is the most likely genotype of p1, In cats, curled ears (Cu) results f...

In cats, curled ears (Cu) results from an allele that is dominant over an allele for normal ears (cu). Black colour results from an independently assorting allele (G) that is domin

Where letters represent genetic markers and black dot, Two homologous human...

Two homologous human chromosomes have the following structure: where the letters represent genetic markers and the black dot represents the centromere. 1. Diagram the two chromosom

Explain galactosemia, Galactosemia Inability  of conversion of galactos...

Galactosemia Inability  of conversion of galactose  to glucose results in the accumulation of galactose in  the  blood  -  known  as galactosemia. The biochemical defect usuall

Venting of the heart in myocardial protection, Venting of the Heart :  It ...

Venting of the Heart :  It is important that heart does not distend during cardio pulmonary bypass. This is prevented by venting of the left side of the heart by inserting a cannu

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd