Plate tectonic theory, Biology

Assignment Help:

Plate Tectonic Is a Theory of Geology Which describes the large scale motion of earth's lithosphere. The theory builds on the older theory of continental drift from the first half of the 20th century by Alfred Wagoner and the concept of seafloor spreading developed in the 1960s.

The earth is separated into layers on the basis of mechanical properties and its composition. The topmost layer is the lithosphere comprising the crust and solid uppermost part of the mantle. The lithosphere is hotter and flows like a liquid on geological time scale.

According this theory of plate tectonic, the lithosphere is divided into many plates that are called tectonic plates. In case of earth, there are seven major tectonic plates and many smaller ones (fig. 5.1 (a) and (b)).

These tectonic plates are able to move because lithosphere has a higher strength and low density than the underlying asthenosphere. These plates move in different directions speeds in relation to one another. The location where two tectonic plates meet is called a plate boundary. Plate boundaries are generally associated with geological event such as earthquake and the creation of topographic features as mountains, volcanoes, trenches and ocean ridges. As the plates move relative to each other three types of plate boundaries are created which are associated with different types of surface phenomena. Three different types of plate boundaries are convergent or collision boundaries, divergent boundaries and transform boundaries 

(i)     Convergent boundaries: convergent boundaries occur when two plates move towards each other and collide. Formations of mountains are the example of convergent boundaries.

(ii)   Divergent boundaries: divergent boundaries occur where two plates move away from each-other. Mid-ocean ridges are the examples of this boundary rift.

(iii) Transform boundaries: transform boundaries occur when two plates move side-by -side along the same direction or in opposite direction and faults are created.

The relative movement of these plate boundaries varies across the earth. The lateral movement of the plates is typically at a speed of 0.66 to 8.50 centimetres per year.


Related Discussions:- Plate tectonic theory

Influence of lv function, Influence of LV Function :  LV functions, whethe...

Influence of LV Function :  LV functions, whether normal or impaired is important while selecting a patient for CABG and for long-term results of surgical revascularisation. If le

Determine the functions of organ during pregnancy, Determine the Functions ...

Determine the Functions of Organ during pregnancy? Dramatic changes occur in renal functions to eliminate the nitrogenous and other waste products of maternal and foetal metabo

What do you mean by osteichthyes and condrichthyes, Q. From which features ...

Q. From which features do osteichthyes and condrichthyes get these names? "Chondros" means cartilage, "ictis" means fish (both from the Greek) the name chondrichtians is for fi

Bacteria, wine turns sour beause of the action of which bacteria? aerobic o...

wine turns sour beause of the action of which bacteria? aerobic or anerobic?

Is neuron b in the frog central nervous system, IS Neuron B in the frog cen...

IS Neuron B in the frog central nervous system Consider Neuron B in the frog central nervous system whose plasma membrane has a previously unknown channel that is selectly cond

Zoonoses disease-staphylococcosis, Staphylococcosis The disease is caused ...

Staphylococcosis The disease is caused by the ingestion of preformed toxin released by Staphylococcus aureus. Epidemiology: Staphylococci grow in meat, dairy and bakery prod

What is atherosclerosis, Q. What is Atherosclerosis? Atherosclerosis is...

Q. What is Atherosclerosis? Atherosclerosis is an arterial lesion characterized by patchy thickening of the intima (innermost coal of artery) comprising of fat and layers of co

What is guided bone regeneration, What is Guided bone regeneration Gui...

What is Guided bone regeneration Guided bone regeneration (GBR) allow the practitioner to place implants in patients who would not have received this treatment option a few y

Describe the significance of micronucleus., Describe the significance of mi...

Describe the significance of micronucleus. One of two types of dimorphic nuclei found in ciliate protozoans. The single micronucleus contains only one copy of the genome and is

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd