Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Plankton - Aquatic Ecosystem
This group includes both microscopic plants (phytoplankton) and animals (zooplankton) found in all aquatic ecosystems, except certain swift moving waters. The locomotory power of the planktons is limited so that their distribution is controlled, largely, by currents in the aquatic ecosystems. Planktons are divisible into:
Summary of Accident Causation In the light of above theories it is concluded that the decision of workers to work safe is largely influenced by external factors such as meetin
Q. What is the acrosome of the sperm cell? How is it formed? The acrosome is a structure that contains a great number of digestive enzymes it is formed by the union of Golgi ap
Perceptual Disorders The procedure actually constitute a sub-battery and include tests of the subject's ability to recognise shapes by touch and identifies numbers written on t
charecterstic features of phylum protozoa.
What proportion of children with down syndrome do you expect when women with down syndrome have children with men who have 46 chromosomes? justify answer
Define Functions of Pyridoxine? There are three different forms of vitamin B6, namely pyridoxine, pyridoxarnine, and pyridoxal. All three must be phosphorylated and the 5'-phos
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
SIMPLE LIPIDS They are lipids formed of fatty acids and alcohol without any additional group. e.g. fats or true fats,wax,cutin, suberin. Simple lipids are mainly of 2 types
Q. What are some important neurotransmitters? The following are some neurotransmitters: serotonin, noradrenaline (norepinephrine), histamine,acetylcholine, adrenaline (epinephr
Q. Medical Management of mitral regurgitation? Vasodilator therapy to reduce afterload may be beneficial in patients with chronic mitral regurgitation, but there is no evidence
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd