Plankton - aquatic ecosystem, Biology

Assignment Help:

Plankton - Aquatic Ecosystem

This group includes both microscopic plants (phytoplankton) and animals (zooplankton) found in all aquatic ecosystems, except certain swift moving waters. The locomotory power of the planktons is limited so that their distribution is controlled, largely, by currents in the aquatic ecosystems. Planktons are divisible into:

  1. Plants (chiefly algae) known as phytoplankton; and
  2. Animals (primarily crustaceans and protozoans) known as zooplankton. Most phytoplanktons and zooplanktons are capable, however, of at least some movement. Certain zooplanktons are extremely active and move relatively large distances, considering their small size, but they are so small that their range is still largely controlled by currents.

Related Discussions:- Plankton - aquatic ecosystem

Summary of accident causation, Summary of Accident Causation In the li...

Summary of Accident Causation In the light of above theories it is concluded that the decision of workers to work safe is largely influenced by external factors such as meetin

What is the acrosome of the sperm cell, Q. What is the acrosome of the sper...

Q. What is the acrosome of the sperm cell? How is it formed? The acrosome is a structure that contains a great number of digestive enzymes it is formed by the union of Golgi ap

Perceptual disorders, Perceptual Disorders The procedure actually const...

Perceptual Disorders The procedure actually constitute a sub-battery and include tests of the subject's ability to recognise shapes by touch and identifies numbers written on t

What proportion of children with down syndrome, What proportion of children...

What proportion of children with down syndrome do you expect when women with down syndrome have children with men who have 46 chromosomes? justify answer

Define functions of pyridoxine, Define Functions of Pyridoxine? There a...

Define Functions of Pyridoxine? There are three different forms of vitamin B6, namely pyridoxine, pyridoxarnine, and pyridoxal. All three must be phosphorylated and the 5'-phos

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Simple lipids, SIMPLE  LIPIDS They are lipids formed of fatty acids an...

SIMPLE  LIPIDS They are lipids formed of fatty acids and alcohol without any additional group. e.g. fats or true fats,wax,cutin, suberin. Simple lipids are mainly of 2 types

What are important neurotransmitters, Q. What are some important neurotrans...

Q. What are some important neurotransmitters? The following are some neurotransmitters: serotonin, noradrenaline (norepinephrine), histamine,acetylcholine, adrenaline (epinephr

Medical management of mitral regurgitation, Q. Medical Management of mitral...

Q. Medical Management of mitral regurgitation? Vasodilator therapy to reduce afterload may be beneficial in patients with chronic mitral regurgitation, but there is no evidence

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd